Single Variant Submission Exercise 

 

http://onlinelibrary.wiley.com/doi/10.1111/ceo.12355/abstract;jsessionid=983B8211ED85633EE5888498E093D7FB.f03t04?deniedAccessCustomisedMessage=&userIsAuthenticated=false

New MT-ND1 pathologic mutation for Leber hereditary optic neuropathy

Íñigo Martínez-Romero PhD1, .... Eduardo Ruiz-Pesini PhD

Clinical & Experimental Ophthalmology, Volume 42, Issue 9, pages 856–864, December 2014

Abstract

Background

Mutations causing Leber hereditary optic neuropathy are usually homoplasmic, show incomplete penetrance, and many of the affected positions are not well conserved through evolution. A large percentage of patients harboring these mutations have no family history of disease. Moreover, the transfer of the mutation in the cybrid model is frequently not accompanied by the transfer of the cellular, biochemical and molecular phenotype. All these features make difficult their classification as the etiologic factors for this disease. We report a patient who exhibits typical clinical features of Leber hereditary optic neuropathy but lacks all three of the most common mitochondrial DNA mutations.

Methods

The diagnosis was made based on clinical studies. The mitochondrial DNA was completely sequenced, and the candidate mutation was analyzed in more than 18 000 individuals around the world, its conservation index was estimated in more than 3100 species from protists to mammals, its position was modelled in the crystal structure of a bacteria ortholog subunit, and its functional consequences were studied in a cybrid model.

Results

Genetic analysis revealed an m.3472T>C transition in the MT-ND1 gene that changes a phenylalanine to leucine at position 56. Bioinformatics, molecular-genetic analysis and functional studies suggest that this transition is the etiological factor for the disorder.

Conclusions

This mutation expands the spectrum of deleterious changes in mitochondrial DNA-encoded complex I polypeptides associated with this pathology and highlights the difficulties in assigning pathogenicity to new homoplasmic mutations that show incomplete penetrance in sporadic Leber hereditary optic neuropathy patients.

Sample mtDNA input for copy-paste, or save to fasta file and upload. More samples files at tool’s pages:

>gi|301298463|gb|HM765473.1| Homo sapiens isolate Case20 mitochondrion, complete genome

GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGG

GTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTC

CTGCCTCATCCCATTATTTATCGCACCTACGTTCAATATTACAGGCGAACATATTTACTGAAGTGTGTTA

ATTAATTAATGCTTGTAGGACATAATAATAACAATTGAATGTCTGCACAGCCGCTTTCCACACAGACATC

ATAACAAAAAATTTCCACCAAACCCCCCCTCCCCCCGCTTCTGGCCACAGCACTTAAACACATCTCTGCC

AAACCCCAAAAACAAAGAACCCTAACACCAGCCTAACCAGATTTCAAATTTTATCTTTTGGCGGTATGCA

CTTTTAACAGTCACCCCCCAACTAACACATTATTTTCCCCTCCCACTCCCATACTACTAATCTCATCAAT

ACAACCCCCGCCCATCCTACCCAGCACACACACACCGCTGCTAACCCCATACCCCGAACCAACCAAACCC

CAAAGACACCCCCCACAGTTTATGTAGCTTACCTCCTCAAAGCAATACACTGAAAATGTTTAGACGGGCT

CACATCACCCCATAAACAAATAGGTTTGGTCCTAGCCTTTCTATTAGCTCTTAGTAAGATTACACATGCA

AGCATCCCCATTCCAGTGAGTTCACCCTCTAAATCACCACGATCAAAAGGGACAAGCATCAAGCACGCAG

CAATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATA

AACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACCGCGGTCACACG

ATTAACCCAAGTCAATAGAAGCCGGCGTAAAGAGTGTTTTAGATCACCCCCTCCCCAATAAAGCTAAAAC

TCACCTGAGTTGTAAAAAACTCCAGTTGACACAAAATAGACTACGAAAGTGGCTTTAACATATCTGAACA

CACAATAGCTAAGACCCAAACTGGGATTAGATACCCCACTATGCTTAGCCCTAAACCTCAACAGTTAAAT

CAACAAAACTGCTCGCCAGAACACTACGAGCCACAGCTTAAAACTCAAAGGACCTGGCGGTGCTTCATAT

CCCTCTAGAGGAGCCTGTTCTGTAATCGATAAACCCCGATCAACCTCACCACCTCTTGCTCAGCCTATAT

ACCGCCATCTTCAGCAAACCCTGATGAAGGCTACAAAGTAAGCGCAAGTACCCACGTAAAGACGTTAGGT

CAAGGTGTAGCCCATGAGGTGGCAAGAAATGGGCTACATTTTCTACCCCAGAAAACTACGATAGCCCTTA

TGAAACTTAAGGGTCGAAGGTGGATTTAGCAGTAAACTGAGAGTAGAGTGCTTAGTTGAACAGGGCCCTG

AAGCGCGTACACACCGCCCGTCACCCTCCTCAAGTATACTTCAAAGGACATTTAACTAAAACCCCTACGC

ATTTATATAGAGGAGACAAGTCGTAACATGGTAAGTGTACTGGAAAGTGCACTTGGACGAACCAGAGTGT

AGCTTAACACAAAGCACCCAACTTACACTTAGGAGATTTCAACTTAACTTGACCGCTCTGAGCTAAACCT

AGCCCCAAACCCACTCCACCTTACTACCAGACAACCTTAGCCAAACCATTTACCCAAATAAAGTATAGGC

GATAGAAATTGAAACCTGGCGCAATAGATATAGTACCGCAAGGGAAAGATGAAAAATTATAACCAAGCAT

AATATAGCAAGGACTAACCCCTATACCTTCTGCATAATGAATTAACTAGAAATAACTTTGCAAGGAGAAC

CAAAGCTAAGACCCCCGAAACCAGACGAGCTACCTAAGAACAGCTAAAAGAGCACACCCGTCTATGTAGC

AAAATAGTGGGAAGATTTATAGGTAGAGGCGACAAACCTACCGAGCCTGGTGATAGCTGGTTGTCCAAGA

TAGAATCTTAGTTCAACTTTAAATTTGCCCACAGAACCCTCTAAATCCCCTTGTAAATTTAACTGTTAGT

CCAAAGAGGAACAGCTCTTTGGACACTAGGAAAAAACCTTGTAGAGAGAGTAAAAAATTTAACACCCATA

GTAGGCCTAAAAGCAGCCACCAATTAAGAAAGCGTTCAAGCTCAACACCCACTACCTAAAAAATCCCAAA

CATATAACTGAACTCCTCACACCCAATTGGACCAATCTATCACCCTATAGAAGAACTAATGTTAGTATAA

GTAACATGAAAACATTCTCCTCCGCATAAGCCTGCGTCAGATTAAAACACTGAACTGACAATTAACAGCC

CAATATCTACAATCAACCAACAAGTCATTATTACCCTCACTGTCAACCCAACACAGGCATGCTCATAAGG

AAAGGTTAAAAAAAGTAAAAGGAACTCGGCAAATCTTACCCCGCCTGTTTACCAAAAACATCACCTCTAG

CATCACCAGTATTAGAGGCACCGCCTGCCCAGTGACACATGTTTAACGGCCGCGGTACCCTAACCGTGCA

AAGGTAGCATAATCACTTGTTCCTTAAATAGGGACCTGTATGAATGGCTCCACGAGGGTTCAGCTGTCTC

TTACTTTTAACCAGTGAAATTGACCTGCCCGTGAAGAGGCGGGCATGACACAGCAAGACGAGAAGACCCT

ATGGAGCTTTAATTTATTAATGCAAACAGTACCTAACAAACCCACAGGTCCTAAACTACCAAACCTGCAT

TAAAAATTTCGGTTGGGGCGACCTCGGAGCAGAACCCAACCTCCGAGCAGTACATGCTAAGACTTCACCA

GTCAAAGCGAACTACTATACTCAATTGATCCAATAACTTGACCAACGGAACAAGTTACCCTAGGGATAAC

AGCGCAATCCTATTCTAGAGTCCATATCAACAATAGGGTTTACGACCTCGATGTTGGATCAGGACATCCC

GATGGTGCAGCCGCTATTAAAGGTTCGTTTGTTCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCG

GAGTAATCCAGGTCGGTTTCTATCTACTTCAAATTCCTCCCTGTACGAAAGGACAAGAGAAATAAGGCCT

ACTTCACAAAGCGCCTTCCCCCGTAAATGATATCATCTCAACTTAGTATTATACCCACACCCACCCAAGA

ACAGGGTTTGTTAAGATGGCAGAGCCCGGTAATCGCATAAAACTTAAAACTTTACAGTCAGAGGTTCAAT

TCCTCTTCTTAACAACATACCCATGGCCAACCTCCTACTCCTCATTGTACCCATTCTAATCGCAATGGCA

TTCCTAATGCTTACCGAACGAAAAATTCTAGGCTATATACAACTACGCAAAGGCCCCAACGTTGTAGGCC

CCTACGGGCTACTACAACCCTTCGCTGACGCCATAAAACTCTTCACCAAAGAGCCCCTAAAACCCGCCAC

ATCTACCATCACCCTCTACATCACCGCCCCGACCTTAGCTCTCACCATCGCTCTTCTACTATGAACCCCC

CTCCCCATACCCAACCCCCTGGTCAACCTCAACCTAGGCCTCCTATTTATTCTAGCCACCTCTAGCCTAG

CCGTTTACTCAATCCTCTGATCAGGGTGAGCATCAAACTCAAACTACGCCCTGATCGGCGCACTGCGAGC

AGTAGCCCAAACAATCTCATATGAAGTCACCCTAGCCATCATTCTACTATCAACATTACTAATAAGTGGC

TCCTTTAACCTCTCCACCCTTATCACAACACAAGAACACCTCTGATTACTCCTGCCATCATGACCCTTGG

CCATAATATGATTTATCTCCACACTAGCAGAGACCAACCGAACCCCCTTCGACCTTGCCGAAGGGGAGTC

CGAACTAGTCTCAGGCTTCAACATCGAATACGCCGCAGGCCCCTTCGCCCTATTCTTCATAGCCGAATAC

ACAAACATTATTATAATAAACACCCTCACCACTACAATCTTCCTAGGAACAACATATGACGCACTCTCCC

CTGAACTCTACACAACATATTTTGTCACCAAGACCCTACTTCTAACCTCCCTGTTCTTATGAATTCGAAC

AGCATACCCCCGATTCCGCTACGACCAACTCATACACCTCCTATGAAAAAACTTCCTACCACTCACCCTA

GCATTACTTATATGACATGTCTCCATACCCATTACAATCTCCAGCATTCCCCCTCAAACCTAAGAAATAT

GTCTGATAAAAGAGTTACTTTGATAGAGTAAATAATAGGAGCTTAAACCCCCTTATTTCTAGGACTATGA

GAATCGAACCCATCCCTGAGAATCCAAAATTCTCCGTGCCACCTATCACACCCCATCCTAAAGTAAGGTC

AGCTAAATAAGCTATCGGGCCCATACCCCGAAAATGTTGGTTATACCCTTCCCGTACTAATTAATCCCCT

GGCCCAACCCGTCATCTACTCTACCATCTTTGCAGGCACACTCATCACAGCGCTAAGCTCGCACTGATTT

TTTACCTGAGTAGGCCTAGAAATAAACATGCTAGCTTTTATTCCAGTTCTAACCAAAAAAATAAACCCTC

GTTCCACAGAAGCTGCCATCAAGTATTTCCTCACGCAAGCAACCGCATCCATAATCCTTCTAATAGCTAT

CCTCTTCAACAATATACTCTCCGGACAATGAACCATAACCAATACTACCAATCAATACTCATCATTAATA

ATCATAATGGCTATAGCAATAAAACTAGGAATAGCCCCCTTTCACTTCTGAGTCCCAGAGGTTACCCAAG

GCACCCCTCTGACATCCGGCCTGCTTCTTCTCACATGACAAAAACTAGCCCCCATCTCAATCATATACCA

AATCTCTCCCTCACTAGACGTAAGCCTTCTCCTCACTCTCTCAATCTTATCCATCATAGCAGGCAGTTGA

GGTGGATTAAACCAAACCCAGCTACGCAAAATCTTAGCATACTCCTCAATTACCCACATAGGATGAATAA

TAGCAGTTCTACCGTACAACCCTAACATAACCATTCTTAATTTAACTATTTATATTATCCTAACTACTAC

CGCATTCCTACTACTCAACTTAAACTCCAGCACCACGACCCTACTACTATCTCGCACCTGAAACAAGCTA

ACATGACTAACACCCTTAATTCCATCCACCCTCCTCTCCCTAGGAGGCCTGCCCCCGCTAACCGGCTTTT

TGCCCAAATGGGCCATTATCGAAGAATTCACAAAAAACAATAGCCTCATCATCCCCACCATCATAGCCAC

CATCACCCTCCTTAACCTCTACTTCTACCTACGCCTAATCTACTCCACCTCAATCACACTACTCCCCATA

TCTAACAACGTAAAAATAAAATGACAGTTTGAACATACAAAACCCACCCCATTCCTCCCCACACTCATCG

CCCTTACCACGCTACTCCTACCTATCTCCCCTTTTATACTAATAATCTTATAGAAATTTAGGTTAAATAC

AGACCAAGAGCCTTCAAAGCCCTCAGTAAGTTGCAATACTTAATTTCTGTAACAGCTAAGGACTGCAAAA

CCCCACTCTGCATCAACTGAACGCAAATCAGCCACTTTAATTAAGCTAAGCCCTTACTAGACCAATGGGA

CTTAAACCCACAAACACTTAGTTAACAGCTAAGCACCCTAATCAACTGGCTTCAATCTACTTCTCCCGCC

GCCGGGGAAAAAGGCGGGAGAAGCCCCGGCAGGTTTGAAGCTGCTTCTTCGAATTTGCAATTCAATATGA

AAATCACCTCGGAGCTGGTAAAAAGAGGCCTAACCCCTGTCTTTAGATTTACAGTCCAATGCTTCACTCA

GCCATTTTACCTCACCCCCACTGATGTTCGCCGACCGTTGACTATTCTCTACAAACCACAAAGACATTGG

AACACTATACCTATTATTCGGCGCATGAGCTGGAGTCCTAGGCACAGCTCTAAGCCTCCTTATTCGAGCC

GAGCTGGGCCAGCCAGGCAACCTTCTAGGTAACGACCACATCTACAACGTTATCGTCACAGCCCATGCAT

TTGTAATAATCTTCTTCATAGTAATACCCATCATAATCGGAGGCTTTGGCAACTGACTAGTTCCCCTAAT

AATCGGTGCCCCCGATATGGCGTTTCCCCGCATAAACAACATAAGCTTCTGACTCTTACCTCCCTCTCTC

CTACTCCTGCTCGCATCTGCTATAGTGGAGGCCGGAGCAGGAACAGGTTGAACAGTCTACCCTCCCTTAG

CAGGGAACTACTCCCACCCTGGAGCCTCCGTAGACCTAACCATCTTCTCCTTACACCTAGCAGGTGTCTC

CTCTATCTTAGGGGCCATCAATTTCATCACAACAATTATCAATATAAAACCCCCTGCCATAACCCAATAC

CAAACGCCCCTCTTCGTCTGATCCGTCCTAATCACAGCAGTCCTACTTCTCCTATCTCTCCCAGTCCTAG

CTGCTGGCATCACTATACTACTAACAGACCGCAACCTCAACACCACCTTCTTCGACCCCGCCGGAGGAGG

AGACCCCATTCTATACCAACACCTATTCTGATTTTTCGGTCACCCTGAAGTTTATATTCTTATCCTACCA

GGCTTCGGAATAATCTCCCATATTGTAACTTACTACTCCGGAAAAAAAGAACCATTTGGATACATAGGTA

TGGTCTGAGCTATGATATCAATTGGCTTCCTAGGGTTTATCGTGTGAGCACACCATATATTTACAGTAGG

AATAGACGTAGACACACGAGCATATTTCACCTCCGCTACCATAATCATCGCTATCCCCACCGGCGTCAAA

GTATTTAGCTGACTCGCCACACTCCACGGAAGCAATATGAAATGATCTGCTGCAGTGCTCTGAGCCCTAG

GATTCATCTTTCTTTTCACCGTAGGTGGCCTGACTGGCATTGTATTAGCAAACTCATCACTAGACATCGT

ACTACACGACACGTACTACGTTGTAGCTCACTTCCACTATGTCCTATCAATAGGAGCTGTATTTGCCATC

ATAGGAGGCTTCATTCACTGATTTCCCCTATTCTCAGGCTACACCCTAGACCAAACCTACGCCAAAATCC

ATTTCACTATCATATTCATCGGCGTAAATCTAACTTTCTTCCCACAACACTTTCTCGGCCTATCCGGAAT

GCCCCGACGTTACTCGGACTACCCCGATGCATACACCACATGAAACATCCTATCATCTGTAGGCTCATTC

ATTTCTCTAACAGCGGTAATATTAATAATTTTCATGATTTGAGAAGCCTTCGCTTCGAAGCGAAAAGTCC

TAATAGTAGAAGAACCCTCCATAAACCTGGAGTGACTATATGGATGCCCCCCACCCTACCACACATTCGA

AGAACCCGTATACATAAAATCTAGACAAAAAAGGAAGGAATCGAACCCCCCAAAGCTGGTTTCAAGCCAA

CCCCATGGCCTCCATGACTTTTTCAAAAAGGTATTAGAAAAACCATTTCATAACTTTGTCAAAGTTAAAT

TATAGGCTAAATCCTATATATCTTAATGGCACATGCAGCGCAAGTAGGTCTACAAGACGCTACTTCCCCT

ATCATAGAAGAGCTTATCACCTTTCATGATCACGCCCTCATAATCATTTTCCTTATCTGCTTCCTAGTCC

TGTATGCCCTTTTCCTAACACTCACAACAAAACTAACTAATACTAACATCTCAGACGCTCAGGAAATAGA

AACCGTCTGAACTATCCTGCCCGCCATCATCCTAGTCCTCATCGCCCTCCCATCCCTACGCATCCTTTAC

ATAACAGACGAGGTCAACGATCCCTCCCTTACCATCAAATCAATTGGCCACCAATGGTACTGAACCTACG

AGTACACCGACTACGGCGGACTAATCTTCAACTCCTACATACTTCCCCCATTATTCCTAGAACCAGGCGA

CCTGCGACTCCTTGACGTTGACAATCGAGTAGTACTCCCGATTGAAGCCCCCATTCGTATAATAATTACA

TCACAAGACGTCTTGCACTCATGAGCTGTCCCCACATTAGGCTTAAAAACAGATGCAATTCCCGGACGTC

TAAACCAAACCACTTTCACCGCTACACGACCGGGGGTATACTACGGTCAATGCTCTGAAATCTGTGGAGC

AAACCACAGTTTCATGCCCATCGTCCTAGAATTAATTCCCCTAAAAATCTTTGAAATAGGGCCCGTATTT

ACCCTATAGCACCCCCTCTACCCCCTCTAGAGCCCACTGTAAAGCTAACTTAGCATTAACCTTTTAAGTT

AAAGATTAAGAGAACCAACACCTCTTTACAGTGAAATGCCCCAACTAAATACTACCGTATGGCCCACCAT

AATTACCCCCATACTCCTTACACTATTCCTCATCACCCAACTAAAAATATTAAACACAAACTACCACCTA

CCTCCCTCACCAAAGCCCATAAAAATAAAAAATTATAACAAACCCTGAGAACCAAAATGAACGAAAATCT

GTTCGCTTCATTCATTGCCCCCACAATCCTAGGCCTACCCGCCGCAGTACTGATCATTCTATTTCCCCCT

CTATTGATCCCCACCTCCAAATATCTCATCAACAACCGACTAATCACCACCCAACAATGACTAATCAAAC

TAACCTCAAAACAAATAATAACCATACACAACACTAAAGGACGAACCTGATCTCTTATACTAGTATCCTT

AATCATTTTTATTGCCACAACTAACCTCCTCGGACTCCTGCCTCACTCATTTACACCAACCACCCAACTA

TCTATAAACCTAGCCATGGCCATCCCCTTATGAGCGGGCGCAGTGATTATAGGCTTCCGCTCTAAGATTA

AAAATGCCCTAGCCCACTTCTTACCACAAGGCACACCTACACCCCTTATCCCCATACTAGTTATTATCGA

AACCATCAGCCTACTCATTCAACCAATAGCCCTGGCCGTACGCCTAACCGCTAACATTACTGCAGGCCAC

CTACTCATGCACCTAATTGGAAGCGCCACCCTAGCAATATCAACCATTAACCTTCCCTCTACACTTATCA

TCTTCACAATTCTAATTCTACTGACTATCCTAGAAATCGCTGTCGCCTTAATCCAAGCCTACGTTTTCAC

ACTTCTAGTAAGCCTCTACCTGCACGACAACACATAATGACCCACCAATCACATGCCTATCACATAGTAA

AACCCAGCCCATGACCCCTAACAGGGGCCCTCTCAGCCCTCCTAATGACCTCCGGCCTAGCCATGTGATT

TCACTTCCACTCCATAACGCTCCTCATACTAGGCCTACTAACCAACACACTAACCATATACCAATGATGG

CGCGATGTAACACGAGAAAGCACATACCAAGGCCACCACACACCACCTGTCCAAAAAGGCCTTCGATACG

GGATAATCCTATTTATTACCTCAGAAGTTTTTTTCTTCGCAGGATTTTTCTGAGCCTTTTACCACTCCAG

CCTAGCCCCTACCCCCCAATTAGGAGGGCACTGGCCCCCAACAGGCATCACCCCGCTAAATCCCCTAGAA

GTCCCACTCCTAAACACATCCGTTTTACTCGCATCAGGAGTATCAATCACCTGAGCTCACCATAGTCTAA

TAGAAAACAACCGAAACCAAATAATTCAAGCACTGCTTATTACAATTTTACTGGGTCTCTATTTTACCCT

CCTACAAGCCTCAGAGTACTTCGAGTCTCCCTTCACCATTTCCGACGGCATCTACGGCTCAACATTTTTT

GTAGCCACAGGCTTCCACGGACTTCACGTCATTATTGGCTCAACTTTCCTCACGATCTGCTTCATCCGCC

AACTAATATTTCACTTTACATCCAAACATCACTTTGGCTTCGAAGCCGCCGCCTGATACTGGCATTTTGT

AGATGTGGTTTGACTATTTCTGTATGTCTCCATCTATTGATGAGGGTCTTACTCTTTTAGTATAAATAGT

ACCGTTAACTTCCAATTAACTAGTTTTGACAACATTCAAAAAAGAGTAATAAACTTCGCCTTAATTTTAA

TAATCAACACCCTCCTAGCCTTACTACTAATAATTATTACATTTTGACTACCACAACTCAACGGCTACAT

AGAAAAATCCACCCCTTACGAGTGCGGCTTCGACCCTATATCCCCCGCCCGCGTCCCTTTCTCCATAAAA

TTCTTCTTAGTAGCTATTACCTTCTTATTATTTGATCTAGAAATTGCCCTCCTTTTACCCCTACCATGAG

CCCTACAAACAACTAACCTGCCACTAATAGTTATGTCATCCCTCTTATTAATCATCATCCTAGCCCTAAG

TCTGGCCTATGAGTGACTACAAAAAGGATTAGACTGAACCGAATTGGTATATAGTTTAAACAAAACGAAT

GATTTCGACTCATTAAATTATGATAATCATATCTACCAAATGCCCCTCATTTACATAAATATTATACTAG

CATTTACCATCTCACTTCTAGGAATACTAGTATATCGCTCACACCTCATATCCTCCCTACTATGCCTAGA

AGGAATAATACTATCGCTGTTCATTATAGCTACTCTCATAACCCTCAACACCCACTCCCTCTTAGCCAAT

ATTGTGCCTATTGCCATACTAGTCTTTGCCGCCTGCGAAGCAGCGGTGGGCCTAGCCCTACTAGTCTCAA

TCTCCAACACATATGGCCTAGACTACGTACATAACCTAAACCTACTCCAATGCTAAAACTAATCGTCCCA

ACAATTATATTACTACCACTGACATGACTTTCCAAAAAACACATAATTTGAATCAACACAACCACCCACA

GCCTAATTATTAGCATCATCCCTCTACTATTTTTTAACCAAATCAACAACAACCTATTTAGCTGTTCCCC

AACCTTTTCCTCCGACCCCCTAACAACCCCCCTCCTAATACTAACTACCTGACTCCTACCCCTCACAATC

ATGGCAAGCCAACGCCACTTATCCAGTGAACCACTATCACGAAAAAAACTCTACCTCTCTATACTAATCT

CCCTACAAATCTCCTTAATTATAACATTCACAGCCACAGAACTAATCATATTTTATATCTTCTTCGAAAC

CACACTTATCCCCACCTTGGCTATCATCACCCGATGAGGCAACCAGCCAGAACGCCTGAACGCAGGCACA

TACTTCCTATTCTACACCCTAGTAGGCTCCCTTCCCCTACTCATCGCACTGATTTACACTCACAACACCC

TAGGCTCACTAAACATTCTACTACTCACTCTCACTGCCCAAGAACTATCAAACTCCTGAGCCAACAACTT

AATATGACTAGCTTACACAATAGCTTTTATAGTAAAGATACCTCTTTACGGACTCCACTTATGACTCCCT

AAAGCCCATGTCGAAGCCCCCATCGCTGGGTCAATAGTACTTGCCGCAGTACTCTTAAAACTAGGCGGCT

ATGGTATAATACGCCTCACACTCATTCTCAACCCCCTGACAAAACACATAGCCTACCCCTTCCTTGTACT

ATCCCTATGAGGCATAATTATAACAAGCTCCATCTGCCTACGACAAACAGACCTAAAATCGCTCATTGCA

TACTCTTCAATCAGCCACATAGCCCTCGTAGTAACAGCCATTCTCATCCAAACCCCCTGAAGCTTCACCG

GCGCAGTCATTCTCATAATCGCCCACGGACTTACATCCTCATTACTATTCTGCCTAGCAAACTCAAACTA

CGAACGCACTCACAGTCGCATCATAATCCTCTCTCAAGGACTTCAAACTCTGCTCCCACTAATAGCTTTT

TGATGACTTCTAGCAAGCCTCGCTAACCTCGCCTTACCCCCCACTATTAACCTACTGGGAGAACTCTCTG

TGCTAGTAACCACGTTCTCCTGATCAAATATCACTCTCCTACTTACAGGACTCAACATACTAGTCACAGC

CCTATACTCCCTCTACATATTTACCACAACACAATGGGGCTCACTCACCCACCACATTAACAACATAAAA

CCCTCATTCACACGAGAAAACACCCTCATGTTCATACACCTATCCCCCATTCTCCTCCTATCCCTCAACC

CCGACATCATTACCGGGTTTTCCTCTTGTAAATATAGTTTAACCAAAACATCAGATTGTGAATCTGACAA

CAGAGGCTTACGACCCCTTATTTACCGAGAAAGCTCACAAGAACTGCTAACTCATGCCCCCATGTCTAAC

AACATGGCTTTCTCAACTTTTAAAGGATAACAGCTATCCATTGGTCTTAGGCCCCAAAAATTTTGGTGCA

ACTCCAAATAAAAGTAATAACCATGCACACTACTATAACCACCCTAACCCTGGCTTCCCTAATTCCCCCC

ATCCTTACCACCCTCGTTAACCCTAACAAAAAAAACTCATACCCCCATTATGTAAAATCCATTGTCGCAT

CCACCTTTATTATCAGTCTCTTCCCCACAACAATATTCATGTGCCTAGACCAAGAAGTTATTATCTCGAA

CTGACACTGAGCCACAACCCAAACAACCCAGCTCTCCCTAAGCTTCAAACTAGACTACTTCTCCATAATA

TTCATCCCTGTAGCATTGTTCGTTACATGGTCCATCATAGAATTCTCACTGTGATATATAAACTCAGACC

CAAACATTAATCAGTTCTTCAAATATCTACTCATCTTCCTAATTACCATACTAATCTTAGTTACCGCTAA

CAACCTATTCCAACTGTTCATCGGCTGAGAGGGCGTAGGAATTATATCCTTCTTGCTCATCAGTTGATGA

TACGCCCGAGCAGATGCCAACACAGCAGCCATTCAAGCAATCCTATACAACCGTATCGGCGATATCGGTT

TCATCCTCGCCTTAGCATGATTTATCCTACACTCCAACTCATGAGACCCACAACAAATAGCCCTTCTAAA

CGCTAATCCAAGCCTCACCCCACTACTAGGCCTCCTCCTAGCAGCAGCAGGCAAATCAGCCCAATTAGGT

CTCCACCCCTGACTCCCCTCAGCCATAGAAGGCCCCACCCCAGTCTCAGCCCTACTCCACTCAAGCACTA

TAGTTGTAGCAGGAATCTTCTTACTCATCCGCTTCCACCCCCTAGCAGAAAATAGCCCACTAATCCAAAC

TCTAACACTATGCTTAGGCGCTATCACCACTCTGTTCGCAGCAGTCTGCGCCCTTACACAAAATGACATC

AAAAAAATCGTAGCCTTCTCCACTTCAAGCCAACTAGGACTCATAATAGTTACAATCGGCATCAACCAAC

CACACCTAGCATTCCTGCACATCTGTACCCACGCCTTCTTCAAAGCCATACTATTTATGTGCTCCGGATC

CATCATCCACAACCTTAACAATGAACAAGATATTCGAAAAATAGGAGGACTACTCAAAACCATACCTCTC

ACTTCAACCTCCCTCACCATTGGCAGCCTAGCATTAGCAGGAATACCTTTCCTCACAGGTTTCTACTCCA

AAGACCACATCATCGAAACCGCAAACATATCATACACAAACGCCTGAGCCCTATCTATTACTCTCATCGC

TACCTCCCTGACAAGCGCCTATAGCACTCGAATAATTCTTCTCACCCTAACAGGTCAACCTCGCTTCCCC

ACCCTTACTAACATTAACGAAAATAACCCCACCCTACTAAACCCCATTAAACGCCTGACAGCCGGAAGCC

TATTCGCAGGATTTCTCATTACTAACAACATTTCCCCCGCATCCCCCTTCCAAACAACAATCCCCCTCTA

CCTAAAACTCACAGCCCTCGCTGTCACTTTCCTAGGACTTCTAACAGCCCTAGACCTCAACTACCTAACC

AACAAACTTAAAATAAAATCCCCACTATGCACATTTTATTTCTCCAACATACTCGGATTCTACCCTAGCA

TCACACACCGCACAATCCCCTATCTAGGCCTTCTTACGAGCCAAAACCTGCCCCTACTCCTCCTAGACCT

AACCTGACTAGAAAAGCTATTACCTAAAACAATTTCACAGCACCAAATCTCCACCTCCATCATCACCTCA

ACCCAAAAAGGCATAATTAAACTTTACTTCCTCTCTTTCTTCTTCCCACTCATCCTAACCCTACTCCTAA

TCACATAACCTATTCCCCCGAGCAATCTCAATTACAATACATACACCAACAAACAATGTTCAACCAGTAA

CTACTACTAATCAACGCCCATAGTCATACAAAGCCCCCGCACCAATAGGATCCTCCCGAATCAACCCTGA

CCCCTCTCCTTCATAAATTATTCAGCTTCCTACACTATTAAAGTTTACCACAACCACCACCCCATCATAC

TCTTTCACCCACAGCACCAATCCTACCTCCATCGCTAACCCCACTAAAACACTCACCAAGACCTCAACCC

CTGACCCCCATGCCTCAGGATACTCCTCAATAGCCATCGCTGTAGTATATCCAAAGACAACCATCATTCC

CCCTAAATAAATTAAAAAAACTATTAAACCCATATAACCTCCCCCAAAATTCAGAATAATAACACACCCG

ACCACACCGCTAACAATCAATACTAAACCCCCATAAATAGGAGAAGGCTTAGAAGAAAACCCCACAAACC

CCATTACTAAACCCACACTCAACAGAAACAAAGCATACATCATTATTCTCGCACGGACTACAACCACGAC

CAATGATATGAAAAACCATCGTTGTATTTCAACTACAAGAACACCAATGACCCCAATACGCAAAATTAAC

CCCCTAATAAAATTAATTAACCACTCATTCATCGACCTCCCCACCCCATCCAACATCTCCGCATGATGAA

ACTTCGGCTCACTCCTTGGCGCCTGCCTGATCCTCCAAATCACCACAGGACTATTCCTAGCCATACACTA

CTCACCAGACGCCTCAACCGCCTTTTCATCAATCGCCCACATCACTCGAGACGTAAATTATGGCTGAATC

ATCCGCTACCTTCACGCCAATGGCGCCTCAATATTCTTTATCTGCCTCTTCCTACACATCGGGCGAGGCC

TATATTACGGATCATTTCTCTACTCAGAAACCTGAAACATCGGCATTATCCTCCTGCTTGCAACTATAGC

AACAGCCTTCATAGGCTATGTCCTCCCGTGAGGCCAAATATCATTCTGAGGGGCCACAGTAATTACAAAC

TTACTATCCGCCATCCCATACATTGGGACAGACCTAGTTCAATGAATCTGAGGAGGCTACTCAGTAGACA

GTCCCACCCTCACACGATTCTTTACCTTTCACTTCATCTTGCCCTTCATTATTGCAGCCCTAGCAGCACT

CCACCTCCTATTCTTGCACGAAACGGGATCAAACAACCCCCTAGGAATCACCTCCCATTCCGATAAAATC

ACCTTCCACCCTTACTACACAATCAAAGACGCCCTCGGCTTACTTCTCTTCATTCTCTCCTTAATGACAT

TAACACTATTCTCACCAGACCTCCTAGGCGACCCAGACAATTATACCCTAGCCAACCCCTTAAACACCCC

TCCCCACATCAAGCCCGAATGATATTTCCTATTCGCCTACACAATTCTCCGATCCGTCCCTAACAAGCTA

GGAGGCGTCCTTGCCCTATTACTATCCATCCTCATCCTAGCAATAATCCCCATCCTCCATATATCCAAAC

AACAAAGCATAATATTTCGCCCACTAAGCCAATCACTTTATTGACTCCTAGCCGCAGACCTCCTCATTCT

AACCTGAATCGGAGGACAACCAGTAAGCTACCCTTTTACCATCATTGGACAAGTAGCATCCGTACTATAC

TTCACAACAATCCTAATCCTAATACCAACTATCTCCCTAATTGAAAACAAAATACTCAAATGGGCCTGTC

CTTGTAGTATAAACTAATACACCAGTCTTGTAAACCGAAGATGAAAACCTTTTTCCAAGGACAAATCAGA

GAAAAAGTCTTTAACTCCACCATTAGCACCCAAAGCTAAGATTCTAATTTAAACTATTCTCTGTTCTTTC

ATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACA

TTACTGCCAGCCACCATGAATATTGCACGGTACCATAAATACTTGACCACCTGTAGTACATAAAAACCCA

ATCCACATCAAAACCCCCTCCCCATGCTTACAAGCAAGTACAGCAATCAACCCTCAACTATCACACATCA

ACTGCAACTCCAAAGCCACCCCTCACCCACTAGGATACCAACAAACCTACCCATCCTTAACAGTACATAG

TACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCC

TCAGATAGGGGTCCCTTGACCACCATCCTCCGTGAAATCAATATCCCGCACAAGAGTGCTACTCTCCTCG

CTCCGGGCCCATAACACTTGGGGGTAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGCC

ATAAAGCCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATG