MSeqDR Mitochondrial Disease Portal


 
*:HP: HPO terms, UMDF: 1= Disease, ND: NAMDC terms.
  Most Studied  CPEO, Complex I Deficiency, COXPD1, Leigh, LHON, MELAS, MERRF, Myopathy, SANDO
Disease Browser
Parent Node:
expand
Immunologic Deficiency Syndromes (D007153)
..Starting node
..expand
IMMUNODEFICIENCY 51 (OMIM:613953)

       Child Nodes:



 Sister Nodes: 
..expandActivated PI3K-delta Syndrome (C585640)
..expandAgammaglobulinemia (D000361) Child19
..expandAntibody Deficiency due to Defect in CD19 (C566275)
..expandAtaxia Telangiectasia (D001260) Child6
..expandAUTOINFLAMMATION, ANTIBODY DEFICIENCY, AND IMMUNE DYSREGULATION, PLCG2-ASSOCIATED (OMIM:614878)
..expandB-Cell Immunodeficiency, Distal Limb Anomalies, And Urogenital Malformations (C563745)
..expandC1q DEFICIENCY (OMIM:613652)
..expandC9 Deficiency (C565165)
..expandC9 Deficiency with Dermatomyositis (C565166)
..expandCartilage hair hypoplasia like syndrome (C535915)
..expandCartilage-hair hypoplasia (C535916)
..expandCd4+ Lymphocyte Deficiency (C566079)
..expandCD8 Deficiency, Familial (C563824)
..expandCombined Immunodeficiency with Autoimmunity and Spondylometaphyseal Dysplasia (C564307)
..expandCombined Inflammatory and Immunologic Defect (C565684)
..expandCommon Variable Immunodeficiency (D017074)
..expandCOMPLEMENT COMPONENT 2 DEFICIENCY (OMIM:217000)
..expandComplement Component 3 Deficiency, Autosomal Recessive (C565169)
..expandComplement Component 4, Partial Deficiency Of (C565168)
..expandComplement Component 4a Deficiency (C565167)
..expandCOMPLEMENT COMPONENT 4B DEFICIENCY (OMIM:614379)
..expandComplement component 5 deficiency (C537005)
..expandComplement Component 6 Deficiency (C567307)
..expandComplement Component 7 Deficiency (C566443)
..expandCOMPLEMENT COMPONENT C1r/C1s DEFICIENCY (OMIM:216950)
..expandComplement Component C1s Deficiency (C565170)
..expandCOMPLEMENT FACTOR B DEFICIENCY (OMIM:615561)
..expandComplement Factor D Deficiency (C565027)
..expandDavenport Donlan syndrome (C535988)
..expandDeltaretrovirus Infections (D006800) Child4
..expandDiarrhea, Glucose-Stimulated Secretory, with Common Variable Immunodeficiency (C565099)
..expandDysgammaglobulinemia (D004406) Child11
..expandEctodermal Dysplasia, Anhidrotic, with Immunodeficiency, Osteopetrosis, and Lymphedema (C564538)
..expandEctodermal Dysplasia, Anhidrotic, With T-Cell Immunodeficiency, Autosomal Dominant (C567411)
..expandEctodermal dysplasia, hypohidrotic, with immune deficiency (C536181)
..expandEndotoxin Hyporesponsiveness (C566417)
..expandEnteropathy, Familial, with Villous Edema and Immunoglobulin G2 Deficiency (C563949)
..expandERYTHRODERMA, CONGENITAL, WITH PALMOPLANTAR KERATODERMA, HYPOTRICHOSIS, AND HYPER-IgE (OMIM:615508)
..expandFACIAL DYSMORPHISM, IMMUNODEFICIENCY, LIVEDO, AND SHORT STATURE (OMIM:615139)
..expandFanconi like syndrome (C536855)
..expandFICOLIN 3 DEFICIENCY (OMIM:613860)
..expandGriscelli syndrome type 2 (C537302)
..expandHepatic venoocclusive disease with immunodeficiency (C537257)
..expandHIV Infections (D015658) Child12
..expandHypoglobulinemia and Absent B Cells (C565765)
..expandImmune Deficiency Disease (C565469)
..expandImmune Deficiency, Familial Variable (C564136)
..expandIMMUNODEFICIENCY 11 (OMIM:615206)
..expandIMMUNODEFICIENCY 12 (OMIM:615468)
..expandIMMUNODEFICIENCY 14 (OMIM:615513)
..expandIMMUNODEFICIENCY 15B (OMIM:615592)
..expandIMMUNODEFICIENCY 16 (OMIM:615593)
..expandIMMUNODEFICIENCY 17 (OMIM:615607)
..expandIMMUNODEFICIENCY 18 (OMIM:615615)
..expandIMMUNODEFICIENCY 19 (OMIM:615617)
..expandIMMUNODEFICIENCY 20 (OMIM:615707)
..expandIMMUNODEFICIENCY 21 (OMIM:614172)
..expandIMMUNODEFICIENCY 22 (OMIM:615758)
..expandIMMUNODEFICIENCY 23 (OMIM:615816)
..expandIMMUNODEFICIENCY 24 (OMIM:615897)
..expandIMMUNODEFICIENCY 26 WITH OR WITHOUT NEUROLOGIC ABNORMALITIES (OMIM:615966)
..expandIMMUNODEFICIENCY 27B (OMIM:615978)
..expandIMMUNODEFICIENCY 28 (OMIM:614889)
..expandIMMUNODEFICIENCY 29 (OMIM:614890)
..expandIMMUNODEFICIENCY 30 (OMIM:614891)
..expandIMMUNODEFICIENCY 31A (OMIM:614892)
..expandIMMUNODEFICIENCY 31B (OMIM:613796)
..expandIMMUNODEFICIENCY 31C (OMIM:614162)
..expandIMMUNODEFICIENCY 32A (OMIM:614893)
..expandIMMUNODEFICIENCY 32B (OMIM:226990)
..expandIMMUNODEFICIENCY 36 (OMIM:616005)
..expandIMMUNODEFICIENCY 37 (OMIM:616098)
..expandIMMUNODEFICIENCY 38 WITH BASAL GANGLIA CALCIFICATION (OMIM:616126)
..expandIMMUNODEFICIENCY 39 (OMIM:616345)
..expandIMMUNODEFICIENCY 40 (OMIM:616433)
..expandIMMUNODEFICIENCY 42 (OMIM:616622)
..expandIMMUNODEFICIENCY 44 (OMIM:616636)
..expandIMMUNODEFICIENCY 45 (OMIM:616669)
..expandIMMUNODEFICIENCY 46 (OMIM:616740)
..expandIMMUNODEFICIENCY 47 (OMIM:300972)
..expandIMMUNODEFICIENCY 48 (OMIM:269840)
..expandIMMUNODEFICIENCY 49 (OMIM:617237)
..expandIMMUNODEFICIENCY 50 (OMIM:300988)
..expandIMMUNODEFICIENCY 51 (OMIM:613953)
..expandIMMUNODEFICIENCY 54 (OMIM:609981)
..expandIMMUNODEFICIENCY 56 (OMIM:615207)
..expandIMMUNODEFICIENCY 8 (OMIM:615401)
..expandImmunodeficiency due to Defect in CD3-Epsilon (C566082)
..expandImmunodeficiency due to Defect in CD3-Gamma (C566083)
..expandImmunodeficiency due to Defect in CD3-Zeta (C565712)
..expandImmunodeficiency due to Defect in MAPBP-Interacting Protein (C563663)
..expandImmunodeficiency syndrome, variable (C537362) Child1
..expandImmunodeficiency with Defective Leukocyte and Lymphocyte Function and with Response to Histamine-1 Antagonist (C564135)
..expandImmunodeficiency without anhidrotic ectodermal dysplasia (C536289)
..expandImmunodeficiency, Gonadal Dysgenesis, And Pulmonary Fibrosis (C567457)
..expandImmunodeficiency, Hypogammaglobulinemia, and Reduced B Cells (C567200)
..expandImmunodeficiency, Partial Combined, with Absence of HLA Determinants and Beta-2-Microglobulin from Lymphocytes (C565468)
..expandImmunodeficiency, X-Linked, with Deficiency of 115,000 Dalton Surface Glycoprotein (C564120)
..expandIMMUNOGLOBULIN KAPPA LIGHT CHAIN DEFICIENCY (OMIM:614102)
..expandInosine Phosphorylase Deficiency, Immune Defect Due To (C565465)
..expandInterleukin 2 Receptor, Alpha, Deficiency of (C565232)
..expandInvasive Pneumococcal Disease, Recurrent Isolated, 1 (C563662)
..expandInvasive Pneumococcal Disease, Recurrent Isolated, 2 (C564468)
..expandIRAK4 Deficiency (C564352)
..expandKappa-Chain Deficiency (C564131)
..expandKotzot-Richter syndrome (C537025)
..expandLeukocyte-Adhesion Deficiency Syndrome (D018370) Child2
..expandLichtenstein syndrome (C535894)
..expandLIG4 Syndrome (C564694)
..expandLUNG DISEASE, IMMUNODEFICIENCY, AND CHROMOSOME BREAKAGE SYNDROME (OMIM:617241)
..expandLymphoblastic Transformation, Intrinsic Defect in (C565431)
..expandLymphoid System Deterioration, Progressive (C565430)
..expandLymphokine Deficiency (C565428)
..expandLymphopenia (D008231) Child5
..expandLymphopenic Hypergammaglobulinemia, Antibody Deficiency, Autoimmune Hemolytic Anemia, and Glomerulonephritis (C565427)
..expandMASP2 Deficiency (C565360)
..expandMYD88 Deficiency (C567379)
..expandMyelodysplasia, Immunodeficiency, Facial Dysmorphism, Short Stature, and Psychomotor Delay (C563345)
..expandNatural Killer Cell Deficiency, Familial Isolated (C566492)
..expandNEMO mutation with immunodeficiency (C538399)
..expandNeutrophil Immunodeficiency Syndrome (C564275)
..expandPhagocyte Bactericidal Dysfunction (D010585) Child14
..expandProperdin Deficiency, Type II (C564075)
..expandProperdin Deficiency, Type III (C564076)
..expandRiddle Syndrome (C567453)
..expandRoifman syndrome (C535866)
..expandRoifman-Chitayat Syndrome (C567641)
..expandSchimke immunoosseous dysplasia (C536629)
..expandSevere Combined Immunodeficiency (D016511) Child22  LSDB C:1
..expandSevere Combined Immunodeficiency, Autosomal Recessive, T Cell-Negative, B Cell-Negative, NK Cell-Positive (C563311)
..expandSplenic Hypoplasia (C563028)
..expandT cell immunodeficiency primary (C536780)
..expandT-CELL IMMUNODEFICIENCY, RECURRENT INFECTIONS, AND AUTOIMMUNITY WITH OR WITHOUT CARDIAC MALFORMATIONS (OMIM:614868)
..expandT-Cell OKT4 Deficiency (C566080)
..expandT-CELL RECEPTOR-ALPHA/BETA DEFICIENCY (OMIM:615387)
..expandThumb Agenesis, Short Stature, And Immunodeficiency (C564770)
..expandThymic aplasia (C536288)
..expandTuftsin Deficiency (C562872)
..expandWHIM syndrome (C536697)
   

Human Disease MESH is developed by UMLS.
Further data from MedGen, OMIM,ClinVar, CTD
Term ID:6286
Name:IMMUNODEFICIENCY 51
Definition:
Alternative IDs:DO:DOID:2058
ParentIDs:MESH:D007153
TreeNumbers:C20.673/613953
Synonyms:CANDF5, FORMERLY |CANDIDIASIS, FAMILIAL, 5, FORMERLY |IMD51
Slim Mappings:Immune system disease
Reference: MedGen: 613953
MeSH: 613953
OMIM: 613953;
MSeqDR LSDB:  
Genes: IL17RA;
Phenotypes
1 HP:0000007Autosomal recessive inheritance
2 HP:0002728Chronic mucocutaneous candidiasis
3 HP:0002205Recurrent respiratory infectionsHP:0040283
Disease Causing ClinVar Variants
Variation_NameGeneIDGeneSymbolClinicalSignificancedbSNPRCVaccessionTestedInGTRPhenotypeIDsChromosomeStartStopHGVS_cHGVS_pHGVS_gOtherIDsDisease_ClinVar
NM_014339.6(IL17RA):c.-126C>G23765IL17RABenignrs562165706RCV000361820; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221756585617565856CGNC_000022.10:g.17565856C>GClinGen:CA10653757CN239217 Familial Candidiasis, Recessive;
NM_014339.6(IL17RA):c.-95G>C23765IL17RAUncertain significancers529290465RCV000267703; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221756588717565887GCNC_000022.10:g.17565887G>CClinGen:CA10653758CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.-42G>A23765IL17RAUncertain significancers551693587RCV000261630; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221756594017565940GANC_000022.10:g.17565940G>AClinGen:CA10086196CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.-39C>T23765IL17RAUncertain significancers775719038RCV000319181; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221756594317565943CTNC_000022.10:g.17565943C>TClinGen:CA10086197CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.-33C>G23765IL17RABenignrs41525344RCV001136745; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221756594917565949CG22:g.17565949C>G-
NM_014339.7(IL17RA):c.-27C>G23765IL17RAUncertain significancers886057199RCV000385295; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221756595517565955CGNC_000022.10:g.17565955C>GClinGen:CA10653130CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.-23C>A23765IL17RAUncertain significancers537206064RCV001138982; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221756595917565959CA22:g.17565959C>A-
NC_000022.11:g.(?_17085072)_(17109840_?)dup23765IL17RAUncertain significance-1RCV001033040; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221756596217590730nana-1-
NM_014339.7(IL17RA):c.-8G>C23765IL17RABenignrs917865RCV000293416|RCV000454833|RCV001730672; NMedGen:CN239217|MedGen:CN169374|MONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221756597417565974GCNC_000022.10:g.17565974G>CClinGen:CA10086203CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.8C>T (p.Ala3Val)23765IL17RAUncertain significancers567320041RCV000799938; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221756598917565989CT22:g.17565989C>T-
NM_014339.7(IL17RA):c.13C>T (p.Arg5Cys)23765IL17RAUncertain significance-1RCV001912005; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221756599417565994CT17565994-
NM_014339.7(IL17RA):c.18C>T (p.Ser6=)23765IL17RALikely benign-1RCV001409490; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221756599917565999CT17565999-
NM_014339.7(IL17RA):c.19C>T (p.Pro7Ser)23765IL17RALikely benignrs534399492RCV000886918; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221756600017566000CT22:g.17566000C>T-
NM_014339.7(IL17RA):c.20C>T (p.Pro7Leu)23765IL17RALikely benignrs143652002RCV000352789|RCV000533617|RCV001701860; NMedGen:CN239217|MONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334|MedGen:CN517202221756600117566001CTNC_000022.10:g.17566001C>TClinGen:CA10086205CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.23C>T (p.Pro8Leu)23765IL17RAUncertain significance-1RCV002034997; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221756600417566004CT17566004-
NM_014339.7(IL17RA):c.26C>T (p.Ser9Phe)23765IL17RAUncertain significancers752407403RCV000796551; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221756600717566007CT22:g.17566007C>T-
NM_014339.7(IL17RA):c.30T>A (p.Ala10=)23765IL17RAConflicting interpretations of pathogenicityrs577217331RCV000886919; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221756601117566011TA22:g.17566011T>A-
NM_014339.7(IL17RA):c.33C>A (p.Val11=)23765IL17RALikely benign-1RCV001399919; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221756601417566014CA17566014-
NM_014339.7(IL17RA):c.36G>T (p.Pro12=)23765IL17RAConflicting interpretations of pathogenicityrs886057200RCV000381694|RCV000927504; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334|MedGen:CN517202221756601717566017GTNC_000022.10:g.17566017G>TClinGen:CA10650769CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.52CTGCTCCTG[1] (p.Leu21_Leu23del)23765IL17RAUncertain significancers751990928RCV001351273; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221756603217566040GGCTGCTCCTG17566031-
NM_014339.7(IL17RA):c.53T>C (p.Leu18Pro)23765IL17RAUncertain significancers2061321486RCV001325608; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221756603417566034TC17566034-
NM_014339.7(IL17RA):c.54G>A (p.Leu18=)23765IL17RALikely benign-1RCV001498153; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221756603517566035GA17566035-
NM_014339.7(IL17RA):c.55C>T (p.Leu19Phe)23765IL17RAUncertain significance-1RCV002031566; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221756603617566036CT17566036-
NM_014339.7(IL17RA):c.56T>G (p.Leu19Arg)23765IL17RAUncertain significancers937902710RCV001236340; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221756603717566037TG22:g.17566037T>G-
NM_014339.7(IL17RA):c.57C>T (p.Leu19=)23765IL17RALikely benign-1RCV002111107; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221756603817566038CT17566038-
NM_014339.7(IL17RA):c.64C>T (p.Leu22Phe)23765IL17RAUncertain significance-1RCV001864037; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221756604517566045CT17566045-
NM_014339.7(IL17RA):c.70G>C (p.Gly24Arg)23765IL17RAUncertain significancers41510847RCV000548005; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221756605117566051GCNC_000022.10:g.17566051G>CClinGen:CA10086214C3151402 613953 Immunodeficiency 51;
NM_014339.7(IL17RA):c.73G>C (p.Val25Leu)23765IL17RAUncertain significancers1297016157RCV001038373; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221756605417566054GC22:g.17566054G>C-
NM_014339.7(IL17RA):c.80C>A (p.Ala27Asp)23765IL17RAUncertain significancers1490955421RCV000803689; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221756606117566061CA22:g.17566061C>A-
NM_014339.7(IL17RA):c.81C>T (p.Ala27=)23765IL17RALikely benignrs1222771166RCV000927149|RCV001392245; NMedGen:CN517202|MONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221756606217566062CT22:g.17566062C>T-
NM_014339.7(IL17RA):c.84G>T (p.Pro28=)23765IL17RALikely benign-1RCV001490272; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221756606517566065GT17566065-
NM_014339.7(IL17RA):c.100C>A (p.Arg34=)23765IL17RALikely benign-1RCV001485270; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221756608117566081CA17566081-
NM_014339.7(IL17RA):c.105C>G (p.Leu35=)23765IL17RALikely benign-1RCV001443983; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221756608617566086CG17566086-
NM_014339.7(IL17RA):c.106C>G (p.Leu36Val)23765IL17RAUncertain significancers2061321959RCV001348959; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221756608717566087CG17566087-
NM_014339.7(IL17RA):c.120G>C (p.Ala40=)23765IL17RALikely benign-1RCV001501660; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221756610117566101GC17566101-
NM_014339.7(IL17RA):c.121C>G (p.Leu41Val)23765IL17RAUncertain significancers1295037189RCV001141594; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221756610217566102CG22:g.17566102C>G-
NM_014339.7(IL17RA):c.126C>T (p.Val42=)23765IL17RALikely benign-1RCV002079235; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221756610717566107CT17566107-
NM_014339.7(IL17RA):c.133C>A (p.Gln45Lys)23765IL17RAUncertain significancers1006074686RCV000698300; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221756611417566114CANC_000022.10:g.17566114C>A-C3151402 613953 Immunodeficiency 51;
NM_014339.7(IL17RA):c.138G>A (p.Pro46=)23765IL17RAUncertain significancers1186749135RCV000792386; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221756611917566119GA22:g.17566119G>A-
NM_014339.7(IL17RA):c.138+8_138+9del23765IL17RALikely benign-1RCV002216849; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221756612617566127ACTA17566125-
NM_014339.7(IL17RA):c.138+12C>T23765IL17RABenignrs534287611RCV000289706; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221756613117566131CTNC_000022.10:g.17566131C>TClinGen:CA10086217CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.138+16G>A23765IL17RALikely benign-1RCV002180560; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221756613517566135GA17566135-
NM_014339.7(IL17RA):c.138+18G>C23765IL17RALikely benign-1RCV002096850; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221756613717566137GC17566137-
NM_014339.7(IL17RA):c.139-6C>T23765IL17RALikely benign-1RCV002179713; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221757794617577946CT17577946-
NM_014339.7(IL17RA):c.140G>A (p.Gly47Glu)23765IL17RAUncertain significance-1RCV001960173; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221757795317577953GA17577953-
NM_014339.7(IL17RA):c.142C>A (p.Leu48Ile)23765IL17RAUncertain significance-1RCV001973982; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221757795517577955CA17577955-
NM_014339.7(IL17RA):c.152C>T (p.Thr51Met)23765IL17RAConflicting interpretations of pathogenicityrs143008696RCV000653466; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221757796517577965CT22:g.17577965C>TClinGen:CA10086230CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.153G>A (p.Thr51=)23765IL17RALikely benign-1RCV001438815; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221757796617577966GA17577966-
NM_014339.7(IL17RA):c.153G>T (p.Thr51=)23765IL17RALikely benign-1RCV001436882; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221757796617577966GT17577966-
NM_014339.7(IL17RA):c.162T>C (p.Asn54=)23765IL17RAUncertain significance-1RCV002023174; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221757797517577975TC17577975-
NM_014339.7(IL17RA):c.163+2T>C23765IL17RALikely pathogenic-1RCV001378818; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221757797817577978TC17577978-
NM_014339.7(IL17RA):c.163+19TTC[2]23765IL17RABenign-1RCV002098070; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221757799517577997GTTCG17577994-
NM_014339.7(IL17RA):c.166_169dup (p.Cys57fs)23765IL17RAPathogenicrs1601340933RCV000804480; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221757868717578688GGTACC22:g.17578687_17578688insTACC-
NM_014339.7(IL17RA):c.166A>G (p.Thr56Ala)23765IL17RAUncertain significancers756664595RCV000806061; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221757868917578689AG22:g.17578689A>G-
NM_014339.7(IL17RA):c.186G>A (p.Trp62Ter)23765IL17RAPathogenic-1RCV001881672; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221757870917578709GA17578709-
NM_014339.7(IL17RA):c.196C>T (p.Arg66Ter)23765IL17RAPathogenicrs1057518745RCV000412660; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221757871917578719CT22:g.17578719C>TClinGen:CA16042240,OMIM:605461.0004C3151402 613953 Immunodeficiency 51;
NM_014339.7(IL17RA):c.199A>G (p.Asn67Asp)23765IL17RAUncertain significancers886057201RCV000406311; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221757872217578722AG22:g.17578722A>GClinGen:CA10653760CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.213dup (p.Ser72fs)23765IL17RAPathogenic-1RCV001885597; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221757873417578735TTC17578734-
NM_014339.7(IL17RA):c.213C>T (p.Ser71=)23765IL17RALikely benign-1RCV001413660; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221757873617578736CT17578736-
NM_014339.7(IL17RA):c.220A>G (p.Lys74Glu)23765IL17RAUncertain significancers752964419RCV000283852; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221757874317578743AG22:g.17578743A>GClinGen:CA10086261CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.227T>C (p.Leu76Pro)23765IL17RAUncertain significancers745774811RCV001230468; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221757875017578750TC22:g.17578750T>C-
NM_014339.7(IL17RA):c.228G>A (p.Leu76=)23765IL17RALikely benign-1RCV001437935; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221757875117578751GA17578751-
NM_014339.7(IL17RA):c.233del (p.Ile78fs)23765IL17RAPathogenicrs1321690789RCV001063413; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221757875617578756ATA22:g.17578756_17578756del-
NM_014339.7(IL17RA):c.247G>A (p.Ala83Thr)23765IL17RAUncertain significance-1RCV001864946; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221757877017578770GA17578770-
NM_014339.7(IL17RA):c.250C>G (p.His84Asp)23765IL17RAUncertain significancers772083135RCV001324906; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221757877317578773CG17578773-
NM_014339.7(IL17RA):c.251A>G (p.His84Arg)23765IL17RAUncertain significance-1RCV001906118; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221757877417578774AG17578774-
NM_014339.7(IL17RA):c.268del (p.Leu90fs)23765IL17RAPathogenicrs1057518746RCV000412553; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221757879017578790ACA22:g.17578790_17578790delClinGen:CA16042241,OMIM:605461.0005C3151402 613953 Immunodeficiency 51;
NM_014339.7(IL17RA):c.277G>A (p.Val93Met)23765IL17RAUncertain significancers147495146RCV000815506; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221757880017578800GA22:g.17578800G>A-
NM_014339.7(IL17RA):c.281C>T (p.Ala94Val)23765IL17RAUncertain significance-1RCV001963953; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221757880417578804CT17578804-
NM_014339.7(IL17RA):c.289G>A (p.Glu97Lys)23765IL17RAUncertain significancers749306401RCV000795861; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221757881217578812GA22:g.17578812G>A-
NM_014339.7(IL17RA):c.310+2T>C23765IL17RALikely pathogenicrs201128237RCV000701763; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221757883517578835TCNC_000022.10:g.17578835T>C-C3151402 613953 Immunodeficiency 51;
NM_014339.7(IL17RA):c.310+3G>A23765IL17RAUncertain significancers771719685RCV001067118; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221757883617578836GA22:g.17578836G>A-
NM_014339.7(IL17RA):c.310+9G>T23765IL17RALikely benign-1RCV002201884; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221757884217578842GT17578842-
NM_014339.7(IL17RA):c.311-20C>G23765IL17RALikely benign-1RCV002072718; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221757964517579645CG17579645-
NM_014339.7(IL17RA):c.311-18C>A23765IL17RALikely benign-1RCV002105525; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221757964717579647CA17579647-
NM_014339.7(IL17RA):c.311-10T>A23765IL17RAUncertain significancers1209181037RCV001316775; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221757965517579655TA17579655-
NM_014339.7(IL17RA):c.311-4G>A23765IL17RALikely benign-1RCV002176357; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221757966117579661GA17579661-
NM_014339.7(IL17RA):c.318C>G (p.Ile106Met)23765IL17RAUncertain significancers746727468RCV001313452; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221757967217579672CG17579672-
NM_014339.7(IL17RA):c.327C>T (p.Leu109=)23765IL17RALikely benignrs202060976RCV000886937|RCV001796304; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334|MedGen:CN517202221757968117579681CT22:g.17579681C>T-
NM_014339.7(IL17RA):c.327C>G (p.Leu109=)23765IL17RALikely benign-1RCV002206892; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221757968117579681CG17579681-
NM_014339.7(IL17RA):c.328G>A (p.Glu110Lys)23765IL17RAUncertain significancers376575302RCV000653446; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221757968217579682GA22:g.17579682G>AClinGen:CA10086314C3151402 613953 Immunodeficiency 51;
NM_014339.7(IL17RA):c.354G>A (p.Gln118=)23765IL17RAUncertain significancers762177800RCV000341148; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221757970817579708GA22:g.17579708G>AClinGen:CA10086319CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.355C>A (p.Leu119Met)23765IL17RAUncertain significancers766246086RCV000393283; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221757970917579709CA22:g.17579709C>AClinGen:CA10086320CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.360C>T (p.Asn120=)23765IL17RALikely benign-1RCV002145299; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221757971417579714CT17579714-
NM_014339.7(IL17RA):c.371G>A (p.Arg124His)23765IL17RAUncertain significancers367569746RCV001247196; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221757972517579725GA22:g.17579725G>A-
NM_014339.7(IL17RA):c.386T>A (p.Phe129Tyr)23765IL17RAUncertain significancers372834294RCV001238489; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221757974017579740TA22:g.17579740T>A-
NM_014339.7(IL17RA):c.388G>C (p.Glu130Gln)23765IL17RAUncertain significancers2061378960RCV001306553; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221757974217579742GC17579742-
NM_014339.7(IL17RA):c.422G>A (p.Arg141Gln)23765IL17RAUncertain significancers746193437RCV000305739; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221757977617579776GA22:g.17579776G>AClinGen:CA10086331CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.424-12C>T23765IL17RAConflicting interpretations of pathogenicityrs531208196RCV000353604|RCV002057794; NMedGen:CN239217|MONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758123317581233CT22:g.17581233C>TClinGen:CA10086359CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.424-8C>A23765IL17RALikely benign-1RCV001504662; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758123717581237CA17581237-
NM_014339.7(IL17RA):c.427C>T (p.Arg143Cys)23765IL17RAUncertain significancers145378071RCV000535138; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758124817581248CT22:g.17581248C>TClinGen:CA10086362CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.450G>T (p.Val150=)23765IL17RALikely benign-1RCV001426098; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758127117581271GT17581271-
NM_014339.7(IL17RA):c.456C>A (p.Asp152Glu)23765IL17RAUncertain significance-1RCV001894414; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758127717581277CA17581277-
NM_014339.7(IL17RA):c.456C>T (p.Asp152=)23765IL17RALikely benign-1RCV002078599; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758127717581277CT17581277-
NM_014339.7(IL17RA):c.460G>C (p.Asp154His)23765IL17RAUncertain significance-1RCV001371428; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758128117581281GC17581281-
NM_014339.7(IL17RA):c.465G>C (p.Gln155His)23765IL17RAConflicting interpretations of pathogenicityrs142199303RCV000884861; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758128617581286GC22:g.17581286G>CClinGen:CA10086368CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.481G>A (p.Val161Ile)23765IL17RAUncertain significancers552176381RCV001047129; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758130217581302GA22:g.17581302G>A-
NM_014339.7(IL17RA):c.482T>C (p.Val161Ala)23765IL17RAUncertain significancers376923038RCV001069308; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758130317581303TC22:g.17581303T>C-
NM_014339.7(IL17RA):c.512G>A (p.Gly171Glu)23765IL17RAUncertain significance-1RCV001874505; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758133317581333GA17581333-
NM_014339.7(IL17RA):c.543T>C (p.Leu181=)23765IL17RALikely benignrs1601343161RCV000983139|RCV001399388; NMedGen:CN517202|MONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758136417581364TC22:g.17581364T>C-
NM_014339.7(IL17RA):c.544G>C (p.Val182Leu)23765IL17RAUncertain significancers1312675148RCV001136851; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758136517581365GC22:g.17581365G>C-
NM_014339.7(IL17RA):c.551-9G>T23765IL17RABenign/Likely benignrs17205308RCV000357195|RCV000543055; NMedGen:CN239217|MONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758287717582877GT22:g.17582877G>TClinGen:CA10086395CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.551-9_551-7del23765IL17RALikely benign-1RCV001463822; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758287717582879GGGTG17582876-
NM_014339.7(IL17RA):c.551-5G>A23765IL17RALikely benign-1RCV002175062; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758288117582881GA17582881-
NM_014339.7(IL17RA):c.561C>T (p.His187=)23765IL17RAConflicting interpretations of pathogenicityrs371342533RCV000274104|RCV000960646; NMedGen:CN239217|MONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758289617582896CT22:g.17582896C>TClinGen:CA10086399CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.562G>A (p.Ala188Thr)23765IL17RAUncertain significancers527593084RCV001211160; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758289717582897GA22:g.17582897G>A-
NM_014339.7(IL17RA):c.565A>G (p.Arg189Gly)23765IL17RAUncertain significancers774179962RCV001295912; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758290017582900AG17582900-
NM_014339.7(IL17RA):c.581C>T (p.Thr194Met)23765IL17RAUncertain significancers151220068RCV000560304; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758291617582916CT22:g.17582916C>TClinGen:CA10086406C3151402 613953 Immunodeficiency 51;
NM_014339.7(IL17RA):c.598+1G>T23765IL17RALikely pathogenic-1RCV002021583; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758293417582934GT17582934-
NM_014339.7(IL17RA):c.598+5C>T23765IL17RAUncertain significancers765670063RCV000331557; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758293817582938CT22:g.17582938C>TClinGen:CA10086410CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.598+7G>A23765IL17RALikely benign-1RCV002154166; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758294017582940GA17582940-
NM_014339.7(IL17RA):c.598+19G>C23765IL17RALikely benign-1RCV002101109; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758295217582952GC17582952-
NM_014339.7(IL17RA):c.599-17G>A23765IL17RABenign-1RCV001513317; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758301217583012GA17583012-
NM_014339.7(IL17RA):c.599-5G>A23765IL17RALikely benignrs570076897RCV000940743; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758302417583024GA22:g.17583024G>A-
NM_014339.7(IL17RA):c.599-3C>T23765IL17RAUncertain significance-1RCV001901053; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758302617583026CT17583026-
NM_014339.7(IL17RA):c.603C>G (p.Ser201Arg)23765IL17RAUncertain significancers369409494RCV001136852; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758303317583033CG22:g.17583033C>G-
NM_014339.7(IL17RA):c.617A>C (p.Asn206Thr)23765IL17RAUncertain significancers750454090RCV001203754; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758304717583047AC22:g.17583047A>C-
NM_014339.7(IL17RA):c.625G>A (p.Val209Met)23765IL17RAConflicting interpretations of pathogenicityrs534512644RCV000369953; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758305517583055GA22:g.17583055G>AClinGen:CA10086441CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.634C>T (p.Leu212=)23765IL17RALikely benignrs1046787585RCV000892716; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758306417583064CT22:g.17583064C>T-
NM_014339.7(IL17RA):c.641C>T (p.Ala214Val)23765IL17RAConflicting interpretations of pathogenicityrs558799480RCV000926289; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758307117583071CT22:g.17583071C>T-
NM_014339.7(IL17RA):c.653G>A (p.Arg218His)23765IL17RAUncertain significancers140367455RCV000700582; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758308317583083GA22:g.17583083G>A-C3151402 613953 Immunodeficiency 51;
NM_014339.7(IL17RA):c.655G>T (p.Val219Leu)23765IL17RALikely benignrs186541010RCV001136853; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758308517583085GT22:g.17583085G>T-
NM_014339.7(IL17RA):c.665C>A (p.Thr222Asn)23765IL17RAUncertain significancers1568920472RCV000695429; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758309517583095CANC_000022.10:g.17583095C>A-C3151402 613953 Immunodeficiency 51;
NM_014339.7(IL17RA):c.676G>A (p.Glu226Lys)23765IL17RAUncertain significancers144085995RCV000277143; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758310617583106GA22:g.17583106G>AClinGen:CA10086452CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.676G>C (p.Glu226Gln)23765IL17RAConflicting interpretations of pathogenicityrs144085995RCV000536377; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758310617583106GC22:g.17583106G>CClinGen:CA10086451CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.679T>G (p.Ser227Ala)23765IL17RAUncertain significance-1RCV002022662; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758310917583109TG17583109-
NM_014339.7(IL17RA):c.692A>G (p.Gln231Arg)23765IL17RAUncertain significance-1RCV001993622; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758312217583122AG17583122-
NM_014339.7(IL17RA):c.698T>C (p.Leu233Pro)23765IL17RAUncertain significance-1RCV001877244; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758312817583128TC17583128-
NM_014339.7(IL17RA):c.702G>C (p.Leu234=)23765IL17RALikely benign-1RCV002182250; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758313217583132GC17583132-
NM_014339.7(IL17RA):c.704C>T (p.Thr235Ile)23765IL17RAUncertain significance-1RCV001977794; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758313417583134CT17583134-
NM_014339.7(IL17RA):c.706A>T (p.Ser236Cys)23765IL17RAUncertain significancers374891419RCV001042119; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758313617583136AT22:g.17583136A>T-
NM_014339.7(IL17RA):c.714G>A (p.Pro238=)23765IL17RALikely benign-1RCV001473842; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758314417583144GA17583144-
NM_014339.7(IL17RA):c.714G>T (p.Pro238=)23765IL17RALikely benign-1RCV001489869; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758314417583144GT17583144-
NM_014339.7(IL17RA):c.715C>T (p.His239Tyr)23765IL17RAUncertain significance-1RCV001924066; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758314517583145CT17583145-
NM_014339.7(IL17RA):c.718A>G (p.Met240Val)23765IL17RAUncertain significancers1433880642RCV001041161; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758314817583148AG22:g.17583148A>G-
NM_014339.7(IL17RA):c.719T>C (p.Met240Thr)23765IL17RAUncertain significancers780107646RCV001320431; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758314917583149TC17583149-
NM_014339.7(IL17RA):c.721G>A (p.Glu241Lys)23765IL17RAUncertain significance-1RCV002019053; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758315117583151GA17583151-
NM_014339.7(IL17RA):c.749A>G (p.His250Arg)23765IL17RAUncertain significance-1RCV001877720; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758317917583179AG17583179-
NM_014339.7(IL17RA):c.758C>T (p.Pro253Leu)23765IL17RAUncertain significancers779662031RCV001139092; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758318817583188CT22:g.17583188C>T-
NM_014339.7(IL17RA):c.762+20C>T23765IL17RABenign-1RCV001522870; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758321217583212CT17583212-
NM_014339.7(IL17RA):c.763-15C>T23765IL17RALikely benign-1RCV002213356; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758436917584369CT17584369-
NM_014339.7(IL17RA):c.763-12C>A23765IL17RALikely benign-1RCV002088317; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758437217584372CA17584372-
NM_014339.7(IL17RA):c.763C>T (p.Pro255Ser)23765IL17RAUncertain significancers375341860RCV001063948; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758438417584384CT22:g.17584384C>T-
NM_014339.7(IL17RA):c.769_773del (p.Pro257fs)23765IL17RAPathogenicrs1057518747RCV000412583; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758438517584389CCCAGACNC_000022.10:g.17584390_17584394delCCAGAClinGen:CA16042242,OMIM:605461.0006C3151402 613953 Immunodeficiency 51;
NM_014339.7(IL17RA):c.769C>G (p.Pro257Ala)23765IL17RAUncertain significance-1RCV001938950; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758439017584390CG17584390-
NM_014339.7(IL17RA):c.787C>T (p.Arg263Ter)23765IL17RAPathogenicrs778624945RCV000704330; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758440817584408CTNC_000022.10:g.17584408C>T-C3151402 613953 Immunodeficiency 51;
NM_014339.7(IL17RA):c.788G>A (p.Arg263Gln)23765IL17RAUncertain significancers772405373RCV001204313; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758440917584409GA22:g.17584409G>A-
NM_014339.7(IL17RA):c.791C>T (p.Ser264Phe)23765IL17RAUncertain significancers2061399166RCV001323363; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758441217584412CT17584412-
NM_014339.7(IL17RA):c.794A>G (p.Asn265Ser)23765IL17RAUncertain significancers201250724RCV001063809; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758441517584415AG22:g.17584415A>G-
NM_014339.7(IL17RA):c.796G>A (p.Val266Ile)23765IL17RAUncertain significance-1RCV001932911; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758441717584417GA17584417-
NM_014339.7(IL17RA):c.808C>G (p.Leu270Val)23765IL17RAUncertain significance-1RCV001359272; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758442917584429CG17584429-
NM_014339.7(IL17RA):c.812G>A (p.Arg271His)23765IL17RAUncertain significancers775839180RCV000653449; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758443317584433GA22:g.17584433G>AClinGen:CA10086498CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.812_813delinsAA (p.Arg271Gln)23765IL17RAUncertain significancers1601345228RCV000812731; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758443317584434GCAANC_000022.10:g.17584433_17584434delinsAA-
NM_014339.7(IL17RA):c.813C>A (p.Arg271=)23765IL17RAUncertain significancers763313591RCV000289969; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758443417584434CA22:g.17584434C>AClinGen:CA10086499CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.832C>T (p.Arg278Cys)23765IL17RAUncertain significancers767388612RCV000528555; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758445317584453CTNC_000022.10:g.17584453C>TClinGen:CA10086500C3151402 613953 Immunodeficiency 51;
NM_014339.7(IL17RA):c.833G>A (p.Arg278His)23765IL17RABenignrs141467790RCV000967787|RCV001727832|RCV001701387; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334|MedGen:CN169374|MedGen:CN517202221758445417584454GA22:g.17584454G>A-
NM_014339.7(IL17RA):c.846+4_846+31del23765IL17RAUncertain significance-1RCV001995383; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758447017584497TGGGTGAGTGTGGTGTGGACAGGTGCAGGT17584469-
NM_014339.7(IL17RA):c.846+4G>A23765IL17RAUncertain significance-1RCV002029290; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758447117584471GA17584471-
NM_014339.7(IL17RA):c.846+8A>G23765IL17RALikely benign-1RCV002146804; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758447517584475AG17584475-
NM_014339.7(IL17RA):c.847-15C>T23765IL17RALikely benign-1RCV002148295; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758560117585601CT17585601-
NM_014339.7(IL17RA):c.847-14C>G23765IL17RAConflicting interpretations of pathogenicityrs201410617RCV000328487; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758560217585602CG22:g.17585602C>GClinGen:CA10086512CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.847A>G (p.Ile283Val)23765IL17RAUncertain significancers886057202RCV000376187; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758561617585616AG22:g.17585616A>GClinGen:CA10653763CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.849C>G (p.Ile283Met)23765IL17RAUncertain significance-1RCV001906348; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758561817585618CG17585618-
NM_014339.7(IL17RA):c.850C>T (p.Gln284Ter)23765IL17RAPathogenicrs387906913RCV000023443; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758561917585619CT22:g.17585619C>TClinGen:CA129263,OMIM:605461.0001C3151402 613953 Immunodeficiency 51;
NM_014339.7(IL17RA):c.855C>G (p.Pro285=)23765IL17RABenignrs41339945RCV000653461; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758562417585624CG22:g.17585624C>GClinGen:CA10086518C3151402 613953 Immunodeficiency 51;
NM_014339.7(IL17RA):c.857T>C (p.Phe286Ser)23765IL17RAUncertain significance-1RCV001885534; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758562617585626TC17585626-
NM_014339.7(IL17RA):c.859T>C (p.Phe287Leu)23765IL17RAUncertain significancers753793215RCV001226090; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758562817585628TC22:g.17585628T>C-
NM_014339.7(IL17RA):c.873C>T (p.Leu291=)23765IL17RABenignrs2228077RCV000653457; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758564217585642CTNC_000022.10:g.17585642C>TClinGen:CA10086525C3151402 613953 Immunodeficiency 51;
NM_014339.7(IL17RA):c.873C>G (p.Leu291=)23765IL17RALikely benign-1RCV001469418; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758564217585642CG17585642-
NM_014339.7(IL17RA):c.882C>T (p.Cys294=)23765IL17RALikely benign-1RCV001506860; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758565117585651CT17585651-
NM_014339.7(IL17RA):c.889C>T (p.His297Tyr)23765IL17RABenignrs180787596RCV000887198; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758565817585658CT22:g.17585658C>T-
NM_014339.7(IL17RA):c.894C>T (p.Ser298=)23765IL17RAConflicting interpretations of pathogenicityrs374537654RCV000284020; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758566317585663CT22:g.17585663C>TClinGen:CA10086529CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.895G>A (p.Ala299Thr)23765IL17RAUncertain significance-1RCV002025777; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758566417585664GA17585664-
NM_014339.7(IL17RA):c.897G>A (p.Ala299=)23765IL17RALikely benign-1RCV001426742; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758566617585666GA17585666-
NM_014339.7(IL17RA):c.904T>C (p.Ser302Pro)23765IL17RAUncertain significance-1RCV001987149; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758567317585673TC17585673-
NM_014339.7(IL17RA):c.906C>T (p.Ser302=)23765IL17RALikely benign-1RCV002135233; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758567517585675CT17585675-
NM_014339.7(IL17RA):c.907T>C (p.Cys303Arg)23765IL17RAUncertain significancers2061407304RCV001141704; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758567617585676TC22:g.17585676T>C-
NM_014339.7(IL17RA):c.926C>T (p.Thr309Ile)23765IL17RAUncertain significancers776247658RCV000653447; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758569517585695CTNC_000022.10:g.17585695C>TClinGen:CA10086539C3151402 613953 Immunodeficiency 51;
NM_014339.7(IL17RA):c.931+7del23765IL17RABenignrs531944007RCV000536725; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758570417585704AGANC_000022.10:g.17585707delClinGen:CA10086542C3151402 613953 Immunodeficiency 51;
NM_014339.7(IL17RA):c.931+6G>C23765IL17RAUncertain significancers762449094RCV001305029; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758570617585706GC17585706-
NM_014339.7(IL17RA):c.931+6G>A23765IL17RAUncertain significance-1RCV001864289; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758570617585706GA17585706-
NM_014339.7(IL17RA):c.931+7G>A23765IL17RALikely benign-1RCV001464729; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758570717585707GA17585707-
NM_014339.7(IL17RA):c.931+14G>A23765IL17RALikely benign-1RCV002209972; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758571417585714GA17585714-
NM_014339.7(IL17RA):c.932-10C>T23765IL17RABenignrs2241046RCV000341309|RCV000455273|RCV000610203|RCV001824748; NMedGen:CN239217|MedGen:CN169374|MONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334|MedGen:CN517202221758647117586471CTNC_000022.10:g.17586471C>TClinGen:CA10086565CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.932-5T>A23765IL17RAUncertain significance-1RCV001360111; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758647617586476TA17586476-
NM_014339.7(IL17RA):c.941C>T (p.Pro314Leu)23765IL17RAUncertain significancers762930594RCV001233166; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758649017586490CT22:g.17586490C>T-
NM_014339.7(IL17RA):c.942G>A (p.Pro314=)23765IL17RALikely benignrs41321447RCV000653462; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758649117586491GANC_000022.10:g.17586491G>AClinGen:CA10086569CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.942G>C (p.Pro314=)23765IL17RAUncertain significancers41321447RCV001069001; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758649117586491GC22:g.17586491G>C-
NM_014339.7(IL17RA):c.943+3A>T23765IL17RAUncertain significancers377254160RCV001232386; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758649517586495AT22:g.17586495A>T-
NM_014339.7(IL17RA):c.943+10G>A23765IL17RALikely benignrs1251354497RCV000916330|RCV001477321; NMedGen:CN517202|MONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758650217586502GA22:g.17586502G>A-
NM_014339.7(IL17RA):c.943+15C>G23765IL17RALikely benign-1RCV002194834; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758650717586507CG17586507-
NM_014339.7(IL17RA):c.944-19G>C23765IL17RALikely benign-1RCV002195314; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758672417586724GC17586724-
NM_014339.7(IL17RA):c.944-16G>A23765IL17RABenign-1RCV002080582; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758672717586727GA17586727-
NM_014339.7(IL17RA):c.944-6C>A23765IL17RAUncertain significance-1RCV002049685; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758673717586737CA17586737-
NM_014339.7(IL17RA):c.944-5C>T23765IL17RALikely benignrs370875549RCV000920138; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758673817586738CT22:g.17586738C>T-
NM_014339.7(IL17RA):c.944-4G>A23765IL17RALikely benign-1RCV002177900; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758673917586739GA17586739-
NM_014339.7(IL17RA):c.949A>G (p.Met317Val)23765IL17RAUncertain significance-1RCV001967423; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758674817586748AG17586748-
NM_014339.7(IL17RA):c.952C>T (p.Pro318Ser)23765IL17RAUncertain significancers200724343RCV001043032; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758675117586751CT22:g.17586751C>T-
NM_014339.7(IL17RA):c.955C>T (p.Leu319=)23765IL17RALikely benign-1RCV001439725; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758675417586754CT17586754-
NM_014339.7(IL17RA):c.958T>C (p.Trp320Arg)23765IL17RAConflicting interpretations of pathogenicityrs140221307RCV000278506|RCV000653465; NMedGen:CN239217|MONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758675717586757TCNC_000022.10:g.17586757T>CClinGen:CA10086605CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.960G>T (p.Trp320Cys)23765IL17RAUncertain significancers758399114RCV001041054; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758675917586759GT22:g.17586759G>T-
NM_014339.7(IL17RA):c.978G>A (p.Thr326=)23765IL17RAConflicting interpretations of pathogenicityrs143239201RCV000893496; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758677717586777GA22:g.17586777G>A-
NM_014339.7(IL17RA):c.978G>T (p.Thr326=)23765IL17RALikely benign-1RCV001492426; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758677717586777GT17586777-
NM_014339.7(IL17RA):c.993G>A (p.Leu331=)23765IL17RALikely benign-1RCV002215515; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758679217586792GA17586792-
NM_014339.7(IL17RA):c.995T>C (p.Leu332Pro)23765IL17RAUncertain significance-1RCV001881371; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758679417586794TC17586794-
NM_014339.7(IL17RA):c.996_997delinsCT (p.Val333Leu)23765IL17RAUncertain significancers2061413124RCV001303597; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758679517586796GGCT17586795-
NM_014339.7(IL17RA):c.1006G>A (p.Val336Ile)23765IL17RAUncertain significancers138404135RCV001308979; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758680517586805GA17586805-
NM_014339.7(IL17RA):c.1021G>A (p.Val341Ile)23765IL17RAUncertain significancers868826492RCV001231424; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758682017586820GA22:g.17586820G>A-
NM_014339.7(IL17RA):c.1030A>G (p.Thr344Ala)23765IL17RAUncertain significancers2061413259RCV001062277; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758682917586829AG22:g.17586829A>G-
NM_014339.7(IL17RA):c.1032C>G (p.Thr344=)23765IL17RALikely benign-1RCV002220106; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758683117586831CG17586831-
NM_014339.7(IL17RA):c.1038G>C (p.Arg346Ser)23765IL17RAUncertain significance-1RCV001931980; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758683717586837GC17586837-
NM_014339.7(IL17RA):c.1045+6C>T23765IL17RAConflicting interpretations of pathogenicityrs763664351RCV000917963; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758685017586850CTNC_000022.10:g.17586850C>TClinGen:CA10086625CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.1045+7G>A23765IL17RAConflicting interpretations of pathogenicityrs572837622RCV000892588; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758685117586851GANC_000022.10:g.17586851G>AClinGen:CA10086626CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.1045+10G>A23765IL17RALikely benign-1RCV002191458; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758685417586854GA17586854-
NM_014339.7(IL17RA):c.1045+12G>A23765IL17RALikely benign-1RCV002103575; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758685617586856GA17586856-
NM_014339.7(IL17RA):c.1046-10dup23765IL17RABenign-1RCV001517494; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758860317588604CCT17588603-
NM_014339.7(IL17RA):c.1046-11T>C23765IL17RALikely benign-1RCV001442693; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758860617588606TC17588606-
NM_014339.7(IL17RA):c.1046-4C>T23765IL17RALikely benign-1RCV002149809; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758861317588613CT17588613-
NM_014339.7(IL17RA):c.1046G>C (p.Gly349Ala)23765IL17RAConflicting interpretations of pathogenicityrs143897670RCV000941998; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758861717588617GCNC_000022.10:g.17588617G>CClinGen:CA10086648CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.1067G>A (p.Ser356Asn)23765IL17RAUncertain significance-1RCV002041839; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758863817588638GA17588638-
NM_014339.7(IL17RA):c.1081T>C (p.Tyr361His)23765IL17RAUncertain significancers34545718RCV000699691; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758865217588652TC22:g.17588652T>C-C3151402 613953 Immunodeficiency 51;
NM_014339.7(IL17RA):c.1085C>T (p.Thr362Ile)23765IL17RAUncertain significance-1RCV001874302; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758865617588656CT17588656-
NM_014339.7(IL17RA):c.1086C>A (p.Thr362=)23765IL17RAUncertain significancers139716919RCV000694843; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758865717588657CANC_000022.10:g.17588657C>A-C3151402 613953 Immunodeficiency 51;
NM_014339.7(IL17RA):c.1086C>T (p.Thr362=)23765IL17RAUncertain significancers139716919RCV001143526; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758865717588657CT22:g.17588657C>T-
NM_014339.7(IL17RA):c.1087G>A (p.Asp363Asn)23765IL17RAUncertain significancers149771513RCV000814596; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758865817588658GA22:g.17588658G>A-
NM_014339.7(IL17RA):c.1087+14G>A23765IL17RALikely benign-1RCV002183864; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758867217588672GA17588672-
NM_014339.7(IL17RA):c.1100C>T (p.Ala367Val)23765IL17RABenignrs879577RCV000367282|RCV000456040|RCV001510215|RCV001824749; NMedGen:CN239217|MedGen:CN169374|MONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334|MedGen:CN517202221758920917589209CTNC_000022.10:g.17589209C>TClinGen:CA10086673,UniProtKB:Q96F46#VAR_027966CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.1100C>A (p.Ala367Glu)23765IL17RAUncertain significance-1RCV001968017; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758920917589209CA17589209-
NM_014339.7(IL17RA):c.1102G>A (p.Ala368Thr)23765IL17RAUncertain significancers1568923119RCV000698833; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758921117589211GANC_000022.10:g.17589211G>A-C3151402 613953 Immunodeficiency 51;
NM_014339.7(IL17RA):c.1116C>T (p.Pro372=)23765IL17RABenignrs138584265RCV000538804; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758922517589225CT22:g.17589225C>TClinGen:CA10086676C3151402 613953 Immunodeficiency 51;
NM_014339.7(IL17RA):c.1117C>T (p.Pro373Ser)23765IL17RAUncertain significance-1RCV002049272; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758922617589226CT17589226-
NM_014339.7(IL17RA):c.1118C>T (p.Pro373Leu)23765IL17RAUncertain significancers768987583RCV000816248; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758922717589227CT22:g.17589227C>T-
NM_014339.7(IL17RA):c.1120C>T (p.Pro374Ser)23765IL17RAUncertain significancers1601349199RCV000806444; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758922917589229CT22:g.17589229C>T-
NM_014339.7(IL17RA):c.1122G>A (p.Pro374=)23765IL17RALikely benignrs202242816RCV000944904; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758923117589231GA22:g.17589231G>A-
NM_014339.7(IL17RA):c.1128G>A (p.Lys376=)23765IL17RALikely benign-1RCV001439231; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758923717589237GA17589237-
NM_014339.7(IL17RA):c.1137G>A (p.Lys379=)23765IL17RABenignrs879576RCV000399063|RCV001513308; NMedGen:CN239217|MONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758924617589246GANC_000022.10:g.17589246G>AClinGen:CA10086682CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.1158C>T (p.Ala386=)23765IL17RALikely benign-1RCV001448570; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758926717589267CT17589267-
NM_014339.7(IL17RA):c.1159G>A (p.Asp387Asn)23765IL17RAPathogenicrs1057519079RCV000412594; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758926817589268GANC_000022.10:g.17589268G>AClinGen:CA16042239,OMIM:605461.0003C3151402 613953 Immunodeficiency 51;
NM_014339.7(IL17RA):c.1161C>T (p.Asp387=)23765IL17RALikely benign-1RCV002102756; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758927017589270CT17589270-
NM_014339.7(IL17RA):c.1165C>T (p.Pro389Ser)23765IL17RAUncertain significancers776885778RCV000794518; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758927417589274CT22:g.17589274C>T-
NM_014339.7(IL17RA):c.1166C>G (p.Pro389Arg)23765IL17RAUncertain significancers561656428RCV000816824; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758927517589275CG22:g.17589275C>G-
NM_014339.7(IL17RA):c.1167C>G (p.Pro389=)23765IL17RAConflicting interpretations of pathogenicityrs139412425RCV000313706; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758927617589276CGNC_000022.10:g.17589276C>GClinGen:CA10086687CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.1174G>T (p.Val392Leu)23765IL17RAConflicting interpretations of pathogenicityrs146478431RCV000653464|RCV001091901; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334|MedGen:CN517202221758928317589283GT22:g.17589283G>TClinGen:CA10086690C3151402 613953 Immunodeficiency 51;
NM_014339.7(IL17RA):c.1179C>T (p.Asp393=)23765IL17RALikely benign-1RCV001392637; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758928817589288CT17589288-
NM_014339.7(IL17RA):c.1180G>A (p.Val394Met)23765IL17RAUncertain significance-1RCV001884724; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758928917589289GA17589289-
NM_014339.7(IL17RA):c.1188G>A (p.Leu396=)23765IL17RABenignrs2229151RCV000362761|RCV001521475; NMedGen:CN239217|MONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758929717589297GANC_000022.10:g.17589297G>AClinGen:CA10086697CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.1189A>C (p.Lys397Gln)23765IL17RAUncertain significance-1RCV001944268; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758929817589298AC17589298-
NM_014339.7(IL17RA):c.1204C>G (p.Leu402Val)23765IL17RAUncertain significance-1RCV002037985; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758931317589313CG17589313-
NM_014339.7(IL17RA):c.1224G>A (p.Thr408=)23765IL17RALikely benign-1RCV002196614; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758933317589333GA17589333-
NM_014339.7(IL17RA):c.1232C>T (p.Ala411Val)23765IL17RAConflicting interpretations of pathogenicityrs151166583RCV000892960; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758934117589341CT22:g.17589341C>T-
NM_014339.7(IL17RA):c.1233C>T (p.Ala411=)23765IL17RAConflicting interpretations of pathogenicityrs552425210RCV000270420; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758934217589342CTNC_000022.10:g.17589342C>TClinGen:CA10086704CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.1254G>C (p.Gln418His)23765IL17RAUncertain significance-1RCV001975833; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758936317589363GC17589363-
NM_014339.7(IL17RA):c.1256C>G (p.Ala419Gly)23765IL17RAUncertain significancers1263027029RCV001235602; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758936517589365CG22:g.17589365C>G-
NM_014339.7(IL17RA):c.1289G>C (p.Gly430Ala)23765IL17RAUncertain significancers192300437RCV001316006; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758939817589398GC17589398-
NM_014339.7(IL17RA):c.1302_1318dup (p.Asn440fs)23765IL17RAPathogenicrs1057518744RCV000412511; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758940617589407AAAGCAGGAGATGGTGGAG22:g.17589406_17589407insAGCAGGAGATGGTGGAGClinGen:CA16042238,OMIM:605461.0002C3151402 613953 Immunodeficiency 51;
NM_014339.7(IL17RA):c.1304A>G (p.Glu435Gly)23765IL17RAUncertain significance-1RCV002033304; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758941317589413AG17589413-
NM_014339.7(IL17RA):c.1316G>A (p.Ser439Asn)23765IL17RAUncertain significancers2061423435RCV001139201; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758942517589425GA22:g.17589425G>A-
NM_014339.7(IL17RA):c.1323dup (p.Lys442Ter)23765IL17RAUncertain significancers1568923319RCV000767996; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758943117589432CCTNC_000022.10:g.17589432dup-
NM_014339.7(IL17RA):c.1338G>A (p.Leu446=)23765IL17RALikely benignrs140139879RCV000556093; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758944717589447GA22:g.17589447G>AClinGen:CA10086717C3151402 613953 Immunodeficiency 51;
NM_014339.7(IL17RA):c.1347C>T (p.Arg449=)23765IL17RAConflicting interpretations of pathogenicityrs781731675RCV001139202; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758945617589456CT22:g.17589456C>T-
NM_014339.7(IL17RA):c.1354C>T (p.Arg452Cys)23765IL17RAUncertain significancers771869327RCV000703992; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758946317589463CT22:g.17589463C>T-C3151402 613953 Immunodeficiency 51;
NM_014339.7(IL17RA):c.1379G>A (p.Gly460Asp)23765IL17RAUncertain significancers147965632RCV001300926; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758948817589488GA17589488-
NM_014339.7(IL17RA):c.1381C>T (p.Arg461Trp)23765IL17RAConflicting interpretations of pathogenicityrs554211497RCV000981731|RCV001139203; NMedGen:CN517202|MONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758949017589490CT22:g.17589490C>T-
NM_014339.7(IL17RA):c.1382G>A (p.Arg461Gln)23765IL17RAUncertain significancers758003165RCV001299129; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758949117589491GA17589491-
NM_014339.7(IL17RA):c.1387G>A (p.Ala463Thr)23765IL17RAUncertain significance-1RCV001923953; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758949617589496GA17589496-
NM_014339.7(IL17RA):c.1387G>T (p.Ala463Ser)23765IL17RAUncertain significance-1RCV002016179; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758949617589496GT17589496-
NM_014339.7(IL17RA):c.1400T>C (p.Leu467Pro)23765IL17RAUncertain significancers369912474RCV000653445; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758950917589509TCNC_000022.10:g.17589509T>CClinGen:CA10086742CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.1402C>T (p.Arg468Cys)23765IL17RAUncertain significancers1465132286RCV000532154; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758951117589511CTNC_000022.10:g.17589511C>TClinGen:CA410216826C3151402 613953 Immunodeficiency 51;
NM_014339.7(IL17RA):c.1407C>T (p.Cys469=)23765IL17RAConflicting interpretations of pathogenicityrs41396346RCV000653456; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758951617589516CTNC_000022.10:g.17589516C>TClinGen:CA10086745CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.1412A>G (p.His471Arg)23765IL17RALikely benignrs138446583RCV000653458; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758952117589521AGNC_000022.10:g.17589521A>GClinGen:CA10086748C3151402 613953 Immunodeficiency 51;
NM_014339.7(IL17RA):c.1414G>A (p.Gly472Arg)23765IL17RAUncertain significancers765188580RCV001139204; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758952317589523GA22:g.17589523G>A-
NM_014339.7(IL17RA):c.1416A>G (p.Gly472=)23765IL17RALikely benign-1RCV002115531; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758952517589525AG17589525-
NM_014339.7(IL17RA):c.1423G>A (p.Val475Met)23765IL17RAUncertain significance-1RCV001879126; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758953217589532GA17589532-
NM_014339.7(IL17RA):c.1426G>A (p.Gly476Arg)23765IL17RAUncertain significancers763589779RCV000653455; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758953517589535GANC_000022.10:g.17589535G>AClinGen:CA10086752C3151402 613953 Immunodeficiency 51;
NM_014339.7(IL17RA):c.1427G>A (p.Gly476Glu)23765IL17RAUncertain significancers1198329596RCV001058961; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758953617589536GA22:g.17589536G>A-
NM_014339.7(IL17RA):c.1437C>G (p.Phe479Leu)23765IL17RAUncertain significance-1RCV001892185; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758954617589546CG17589546-
NM_014339.7(IL17RA):c.1446C>T (p.Ala482=)23765IL17RALikely benign-1RCV001466388; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758955517589555CT17589555-
NM_014339.7(IL17RA):c.1447A>G (p.Met483Val)23765IL17RAUncertain significance-1RCV001884131; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758955617589556AG17589556-
NM_014339.7(IL17RA):c.1458C>T (p.Ile486=)23765IL17RABenignrs879575RCV000264672|RCV000454866|RCV001824750|RCV001510216; NMedGen:CN239217|MedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758956717589567CTNC_000022.10:g.17589567C>TClinGen:CA10086760CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.1464G>A (p.Pro488=)23765IL17RAUncertain significancers368404830RCV001312919; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758957317589573GA17589573-
NM_014339.7(IL17RA):c.1472A>G (p.Lys491Arg)23765IL17RAUncertain significance-1RCV001372762; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758958117589581AG17589581-
NM_014339.7(IL17RA):c.1475G>A (p.Arg492Lys)23765IL17RAConflicting interpretations of pathogenicityrs770597137RCV001141817; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758958417589584GA22:g.17589584G>A-
NM_014339.7(IL17RA):c.1477C>G (p.Pro493Ala)23765IL17RAUncertain significance-1RCV002033887; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758958617589586CG17589586-
NM_014339.7(IL17RA):c.1486T>C (p.Phe496Leu)23765IL17RAUncertain significancers886057203RCV000322190; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758959517589595TCNC_000022.10:g.17589595T>CClinGen:CA10650786CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.1493C>T (p.Thr498Ile)23765IL17RAConflicting interpretations of pathogenicityrs41529049RCV000540309; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758960217589602CT22:g.17589602C>TClinGen:CA10086768C3151402 613953 Immunodeficiency 51;
NM_014339.7(IL17RA):c.1498G>A (p.Val500Ile)23765IL17RAUncertain significance-1RCV002008097; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758960717589607GA17589607-
NM_014339.7(IL17RA):c.1530C>T (p.Asp510=)23765IL17RAConflicting interpretations of pathogenicityrs148319877RCV000379138|RCV000552801|RCV001702620; NMedGen:CN239217|MONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334|MedGen:CN517202221758963917589639CTNC_000022.10:g.17589639C>TClinGen:CA10086777CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.1531G>A (p.Gly511Ser)23765IL17RAUncertain significancers754989357RCV001305650; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758964017589640GA17589640-
NM_014339.7(IL17RA):c.1533C>T (p.Gly511=)23765IL17RAUncertain significancers779086814RCV001233719; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758964217589642CT22:g.17589642C>T-
NM_014339.7(IL17RA):c.1547T>C (p.Leu516Pro)23765IL17RAUncertain significancers2061425386RCV001233651; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758965617589656TC22:g.17589656T>C-
NM_014339.7(IL17RA):c.1548G>A (p.Leu516=)23765IL17RALikely benign-1RCV002139503; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758965717589657GA17589657-
NM_014339.7(IL17RA):c.1551C>G (p.Phe517Leu)23765IL17RAUncertain significancers769646719RCV000822767; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758966017589660CG22:g.17589660C>G-
NM_014339.7(IL17RA):c.1551C>T (p.Phe517=)23765IL17RALikely benign-1RCV002196904; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758966017589660CT17589660-
NM_014339.7(IL17RA):c.1552G>A (p.Gly518Ser)23765IL17RAUncertain significance-1RCV002018585; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758966117589661GA17589661-
NM_014339.7(IL17RA):c.1556C>T (p.Ala519Val)23765IL17RAUncertain significance-1RCV002024682; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758966517589665CT17589665-
NM_014339.7(IL17RA):c.1560G>A (p.Ala520=)23765IL17RALikely benign-1RCV001410024; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758966917589669GA17589669-
NM_014339.7(IL17RA):c.1564C>T (p.Arg522Trp)23765IL17RAUncertain significance-1RCV001365907; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758967317589673CT17589673-
NM_014339.7(IL17RA):c.1565G>A (p.Arg522Gln)23765IL17RAUncertain significancers372510142RCV000810791; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758967417589674GA22:g.17589674G>A-
NM_014339.7(IL17RA):c.1569C>T (p.Tyr523=)23765IL17RALikely benign-1RCV002108470; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758967817589678CT17589678-
NM_014339.7(IL17RA):c.1575C>T (p.Leu525=)23765IL17RALikely benign-1RCV002152954; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758968417589684CT17589684-
NM_014339.7(IL17RA):c.1615C>G (p.Leu539Val)23765IL17RAUncertain significance-1RCV002028853; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758972417589724CG17589724-
NM_014339.7(IL17RA):c.1621A>G (p.Met541Val)23765IL17RAUncertain significance-1RCV001899231; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758973017589730AG17589730-
NM_014339.7(IL17RA):c.1632G>C (p.Pro544=)23765IL17RAConflicting interpretations of pathogenicityrs550947413RCV000267763|RCV000892962; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334|MedGen:CN517202221758974117589741GCNC_000022.10:g.17589741G>CClinGen:CA10086803CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.1632G>A (p.Pro544=)23765IL17RALikely benign-1RCV001394115; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758974117589741GA17589741-
NM_014339.7(IL17RA):c.1644C>T (p.His548=)23765IL17RALikely benign-1RCV002110267; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758975317589753CT17589753-
NM_014339.7(IL17RA):c.1656G>A (p.Glu552=)23765IL17RAUncertain significancers746697957RCV001141818; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758976517589765GA22:g.17589765G>A-
NM_014339.7(IL17RA):c.1659G>C (p.Leu553=)23765IL17RALikely benign-1RCV002092878; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758976817589768GC17589768-
NM_014339.7(IL17RA):c.1662G>C (p.Ser554=)23765IL17RALikely benign-1RCV002138859; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758977117589771GC17589771-
NM_014339.7(IL17RA):c.1670A>G (p.Asn557Ser)23765IL17RAUncertain significancers1445798719RCV001315329; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758977917589779AG17589779-
NM_014339.7(IL17RA):c.1675C>G (p.Leu559Val)23765IL17RAUncertain significancers751753949RCV000689416; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758978417589784CG22:g.17589784C>G-C3151402 613953 Immunodeficiency 51;
NM_014339.7(IL17RA):c.1685C>A (p.Pro562Gln)23765IL17RABenignrs12484684RCV000315878|RCV001510884; NMedGen:CN239217|MONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758979417589794CANC_000022.10:g.17589794C>AClinGen:CA10086822,UniProtKB:Q96F46#VAR_049176CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.1686G>A (p.Pro562=)23765IL17RALikely benign-1RCV001503378; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758979517589795GA17589795-
NM_014339.7(IL17RA):c.1689C>T (p.Gly563=)23765IL17RABenign/Likely benignrs146292661RCV000653463|RCV001091902; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334|MedGen:CN517202221758979817589798CTNC_000022.10:g.17589798C>TClinGen:CA10086825CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.1701C>A (p.Leu567=)23765IL17RALikely benign-1RCV001396105; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758981017589810CA17589810-
NM_014339.7(IL17RA):c.1704C>T (p.Arg568=)23765IL17RALikely benign-1RCV002138569; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758981317589813CT17589813-
NM_014339.7(IL17RA):c.1716C>G (p.Asp572Glu)23765IL17RAUncertain significancers549305543RCV001345487; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758982517589825CG17589825-
NM_014339.7(IL17RA):c.1724G>A (p.Arg575Gln)23765IL17RAUncertain significancers1285581737RCV001204180; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758983317589833GA22:g.17589833G>A-
NM_014339.7(IL17RA):c.1728C>T (p.Asp576=)23765IL17RAConflicting interpretations of pathogenicityrs767714232RCV000908527; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758983717589837CTNC_000022.10:g.17589837C>TClinGen:CA10086837CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.1735G>T (p.Val579Phe)23765IL17RAUncertain significancers750666893RCV001143622; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758984417589844GT22:g.17589844G>T-
NM_014339.7(IL17RA):c.1735G>A (p.Val579Ile)23765IL17RAUncertain significance-1RCV001959820; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758984417589844GA17589844-
NM_014339.7(IL17RA):c.1738C>T (p.Arg580Cys)23765IL17RAUncertain significancers764980726RCV001230132; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758984717589847CT22:g.17589847C>T-
NM_014339.7(IL17RA):c.1742G>C (p.Cys581Ser)23765IL17RAUncertain significance-1RCV001967403; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758985117589851GC17589851-
NM_014339.7(IL17RA):c.1747G>C (p.Asp583His)23765IL17RABenignrs41432148RCV000974683; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758985617589856GC22:g.17589856G>C-
NM_014339.7(IL17RA):c.1749C>G (p.Asp583Glu)23765IL17RAUncertain significancers770168313RCV000811936; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758985817589858CG22:g.17589858C>G-
NM_014339.7(IL17RA):c.1755C>T (p.Phe585=)23765IL17RAUncertain significancers371055145RCV001143623; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758986417589864CT22:g.17589864C>T-
NM_014339.7(IL17RA):c.1756G>A (p.Glu586Lys)23765IL17RAUncertain significance-1RCV001921007; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758986517589865GA17589865-
NM_014339.7(IL17RA):c.1768C>G (p.Leu590Val)23765IL17RAUncertain significancers372238432RCV000801056; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758987717589877CG22:g.17589877C>G-
NM_014339.7(IL17RA):c.1796C>G (p.Pro599Arg)23765IL17RAUncertain significance-1RCV001941147; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758990517589905CG17589905-
NM_014339.7(IL17RA):c.1807G>T (p.Glu603Ter)23765IL17RAUncertain significancers1484936517RCV001227989; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758991617589916GT22:g.17589916G>T-
NM_014339.7(IL17RA):c.1813G>A (p.Val605Met)23765IL17RAUncertain significancers766645390RCV001051521; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758992217589922GA22:g.17589922G>A-
NM_014339.7(IL17RA):c.1819G>A (p.Glu607Lys)23765IL17RABenignrs28376631RCV000653459|RCV001702710|RCV001726296; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334|MedGen:CN517202|MedGen:CN169374221758992817589928GA22:g.17589928G>AClinGen:CA10086859C3151402 613953 Immunodeficiency 51;
NM_014339.7(IL17RA):c.1820A>G (p.Glu607Gly)23765IL17RAUncertain significance-1RCV001917307; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758992917589929AG17589929-
NM_014339.7(IL17RA):c.1835C>G (p.Pro612Arg)23765IL17RAUncertain significancers1451038504RCV000824300; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758994417589944CG22:g.17589944C>G-
NM_014339.7(IL17RA):c.1839G>C (p.Pro613=)23765IL17RALikely benign-1RCV001451665; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758994817589948GC17589948-
NM_014339.7(IL17RA):c.1839G>A (p.Pro613=)23765IL17RAUncertain significance-1RCV001942922; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758994817589948GA17589948-
NM_014339.7(IL17RA):c.1844C>T (p.Thr615Ile)23765IL17RAUncertain significance-1RCV001899331; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758995317589953CT17589953-
NM_014339.7(IL17RA):c.1845C>T (p.Thr615=)23765IL17RALikely benign-1RCV002123430; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758995417589954CT17589954-
NM_014339.7(IL17RA):c.1846G>A (p.Gly616Ser)23765IL17RAUncertain significance-1RCV001897786; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758995517589955GA17589955-
NM_014339.7(IL17RA):c.1848C>T (p.Gly616=)23765IL17RALikely benign-1RCV002103539; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758995717589957CT17589957-
NM_014339.7(IL17RA):c.1858C>T (p.Arg620Trp)23765IL17RAUncertain significancers772665587RCV001350795; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758996717589967CT17589967-
NM_014339.7(IL17RA):c.1864_1876del (p.Pro622fs)23765IL17RAUncertain significancers1601350285RCV000810129; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758997017589982GGCGCCCCTGGTGCG22:g.17589970_17589982del-
NM_014339.7(IL17RA):c.1862C>A (p.Ala621Glu)23765IL17RAUncertain significance-1RCV002016691; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221758997117589971CA17589971-
NM_014339.7(IL17RA):c.1897C>G (p.Leu633Val)23765IL17RALikely benignrs200880853RCV000653460; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759000617590006CG22:g.17590006C>GClinGen:CA10086878C3151402 613953 Immunodeficiency 51;
NM_014339.7(IL17RA):c.1903A>G (p.Ile635Val)23765IL17RAUncertain significancers2061428011RCV001218601; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759001217590012AG22:g.17590012A>G-
NM_014339.7(IL17RA):c.1907A>G (p.Asp636Gly)23765IL17RAUncertain significancers868771675RCV001330552; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759001617590016AG17590016-
NM_014339.7(IL17RA):c.1918G>A (p.Gly640Arg)23765IL17RAUncertain significancers1221696207RCV000653451; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759002717590027GA22:g.17590027G>AClinGen:CA410219464C3151402 613953 Immunodeficiency 51;
NM_014339.7(IL17RA):c.1919G>A (p.Gly640Glu)23765IL17RAUncertain significancers761619526RCV001137050; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759002817590028GA22:g.17590028G>A-
NM_014339.7(IL17RA):c.1920G>A (p.Gly640=)23765IL17RALikely benign-1RCV001421847; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759002917590029GA17590029-
NM_014339.7(IL17RA):c.1921G>C (p.Glu641Gln)23765IL17RAUncertain significancers1453480856RCV001319191; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759003017590030GC17590030-
NM_014339.7(IL17RA):c.1925A>G (p.Glu642Gly)23765IL17RAUncertain significance-1RCV001967082; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759003417590034AG17590034-
NM_014339.7(IL17RA):c.1928G>A (p.Gly643Glu)23765IL17RAUncertain significancers559058243RCV001137051; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759003717590037GA22:g.17590037G>A-
NM_014339.7(IL17RA):c.1931G>C (p.Gly644Ala)23765IL17RAUncertain significancers749845273RCV001137052; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759004017590040GC22:g.17590040G>C-
NM_014339.7(IL17RA):c.1934C>T (p.Ala645Val)23765IL17RAUncertain significancers755655195RCV001061183; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759004317590043CT22:g.17590043C>T-
NM_014339.7(IL17RA):c.1951G>A (p.Glu651Lys)23765IL17RAUncertain significancers753549556RCV000653454; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759006017590060GA22:g.17590060G>AClinGen:CA10086884C3151402 613953 Immunodeficiency 51;
NM_014339.7(IL17RA):c.1952A>C (p.Glu651Ala)23765IL17RAUncertain significancers2061428420RCV001233035; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759006117590061AC22:g.17590061A>C-
NM_014339.7(IL17RA):c.1954C>A (p.Pro652Thr)23765IL17RAUncertain significance-1RCV001971946; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759006317590063CA17590063-
NM_014339.7(IL17RA):c.1959C>T (p.His653=)23765IL17RALikely benign-1RCV001506074; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759006817590068CT17590068-
NM_014339.7(IL17RA):c.1970G>A (p.Arg657Gln)23765IL17RAUncertain significancers1341181529RCV001316209; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759007917590079GA17590079-
NM_014339.7(IL17RA):c.1972G>T (p.Gly658Cys)23765IL17RAUncertain significance-1RCV001998104; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759008117590081GT17590081-
NM_014339.7(IL17RA):c.1974T>C (p.Gly658=)23765IL17RALikely benign-1RCV001475727; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759008317590083TC17590083-
NM_014339.7(IL17RA):c.1979C>T (p.Pro660Leu)23765IL17RAUncertain significance-1RCV001369464; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759008817590088CT17590088-
NM_014339.7(IL17RA):c.1986G>A (p.Pro662=)23765IL17RAUncertain significancers990617336RCV001137053; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759009517590095GA22:g.17590095G>A-
NM_014339.7(IL17RA):c.1992C>T (p.Pro664=)23765IL17RALikely benign-1RCV001418165; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759010117590101CT17590101-
NM_014339.7(IL17RA):c.2000C>G (p.Thr667Ser)23765IL17RAUncertain significance-1RCV001930751; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759010917590109CG17590109-
NM_014339.7(IL17RA):c.2008C>T (p.Leu670Phe)23765IL17RAUncertain significancers2061428792RCV001309922; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759011717590117CT17590117-
NM_014339.7(IL17RA):c.2010C>T (p.Leu670=)23765IL17RALikely benign-1RCV002078205; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759011917590119CT17590119-
NM_014339.7(IL17RA):c.2015C>G (p.Ala672Gly)23765IL17RAUncertain significance-1RCV002025510; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759012417590124CG17590124-
NM_014339.7(IL17RA):c.2031G>T (p.Leu677=)23765IL17RALikely benign-1RCV001446610; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759014017590140GT17590140-
NM_014339.7(IL17RA):c.2038G>T (p.Ala680Ser)23765IL17RAUncertain significancers181468995RCV000337950; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759014717590147GTNC_000022.10:g.17590147G>TClinGen:CA10086889CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.2055C>T (p.Pro685=)23765IL17RALikely benign-1RCV002097413; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759016417590164CT17590164-
NM_014339.7(IL17RA):c.2071G>A (p.Ala691Thr)23765IL17RABenignrs41323645RCV000385365|RCV001513309; NMedGen:CN239217|MONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759018017590180GANC_000022.10:g.17590180G>AClinGen:CA10086895CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.2076C>T (p.Val692=)23765IL17RALikely benignrs529543548RCV000911219; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759018517590185CT22:g.17590185C>T-
NM_014339.7(IL17RA):c.2077C>T (p.Arg693Trp)23765IL17RAUncertain significancers767291636RCV000653452; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759018617590186CT22:g.17590186C>TClinGen:CA10086897C3151402 613953 Immunodeficiency 51;
NM_014339.7(IL17RA):c.2084C>T (p.Ala695Val)23765IL17RAUncertain significancers765911585RCV001043404; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759019317590193CT22:g.17590193C>T-
NM_014339.7(IL17RA):c.2086C>A (p.Leu696Met)23765IL17RAUncertain significancers886057204RCV000818166; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759019517590195CANC_000022.10:g.17590195C>AClinGen:CA10653142CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.2087T>G (p.Leu696Arg)23765IL17RAUncertain significancers753376068RCV000653450; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759019617590196TG22:g.17590196T>GClinGen:CA10086901C3151402 613953 Immunodeficiency 51;
NM_014339.7(IL17RA):c.2090C>T (p.Ala697Val)23765IL17RAUncertain significance-1RCV001952970; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759019917590199CT17590199-
NM_014339.7(IL17RA):c.2099G>A (p.Gly700Asp)23765IL17RAUncertain significance-1RCV001913344; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759020817590208GA17590208-
NM_014339.7(IL17RA):c.2100C>T (p.Gly700=)23765IL17RAUncertain significance-1RCV002022204; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759020917590209CT17590209-
NM_014339.7(IL17RA):c.2111C>T (p.Pro704Leu)23765IL17RAUncertain significancers747597787RCV000804903; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759022017590220CT22:g.17590220C>T-
NM_014339.7(IL17RA):c.2115G>A (p.Leu705=)23765IL17RALikely benign-1RCV001474443; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759022417590224GA17590224-
NM_014339.7(IL17RA):c.2125C>A (p.Pro709Thr)23765IL17RAUncertain significancers2061429644RCV001345145; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759023417590234CA17590234-
NM_014339.7(IL17RA):c.2126C>T (p.Pro709Leu)23765IL17RAUncertain significancers757383824RCV001247819; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759023517590235CT22:g.17590235C>T-
NM_014339.7(IL17RA):c.2127G>A (p.Pro709=)23765IL17RALikely benign-1RCV002195551; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759023617590236GA17590236-
NM_014339.7(IL17RA):c.2128G>A (p.Gly710Ser)23765IL17RAUncertain significancers1223546319RCV000704154; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759023717590237GA22:g.17590237G>A-C3151402 613953 Immunodeficiency 51;
NM_014339.7(IL17RA):c.2131G>A (p.Ala711Thr)23765IL17RAUncertain significancers1361983195RCV001054874; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759024017590240GA22:g.17590240G>A-
NM_014339.7(IL17RA):c.2144G>A (p.Ser715Asn)23765IL17RAUncertain significancers747892404RCV000696236; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759025317590253GA22:g.17590253G>A-C3151402 613953 Immunodeficiency 51;
NM_014339.7(IL17RA):c.2146G>A (p.Val716Ile)23765IL17RAUncertain significancers771961316RCV001325576; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759025517590255GA17590255-
NM_014339.7(IL17RA):c.2159C>T (p.Pro720Leu)23765IL17RAUncertain significance-1RCV001900950; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759026817590268CT17590268-
NM_014339.7(IL17RA):c.2160C>T (p.Pro720=)23765IL17RABenignrs4819555RCV000350688|RCV000455657|RCV001718722|RCV001510217; NMedGen:CN239217|MedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759026917590269CTNC_000022.10:g.17590269C>TClinGen:CA10086922CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.2160C>G (p.Pro720=)23765IL17RALikely benign-1RCV001452224; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759026917590269CG17590269-
NM_014339.7(IL17RA):c.2161G>A (p.Val721Met)23765IL17RAUncertain significancers369516280RCV001064076; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759027017590270GA22:g.17590270G>A-
NM_014339.7(IL17RA):c.2165A>G (p.Asp722Gly)23765IL17RAUncertain significancers1220150798RCV001205106; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759027417590274AG22:g.17590274A>G-
NM_014339.7(IL17RA):c.2170G>A (p.Glu724Lys)23765IL17RAUncertain significance-1RCV001368712; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759027917590279GA17590279-
NM_014339.7(IL17RA):c.2176T>G (p.Ser726Ala)23765IL17RAUncertain significancers145526959RCV001214639; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759028517590285TG22:g.17590285T>G-
NM_014339.7(IL17RA):c.2177C>T (p.Ser726Leu)23765IL17RAUncertain significancers756332306RCV000693665; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759028617590286CT22:g.17590286C>TClinGen:CA10086928CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.2178G>T (p.Ser726=)23765IL17RAUncertain significancers1261613548RCV001139300; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759028717590287GT22:g.17590287G>T-
NM_014339.7(IL17RA):c.2181C>T (p.Pro727=)23765IL17RALikely benign-1RCV001399328; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759029017590290CT17590290-
NM_014339.7(IL17RA):c.2186G>A (p.Gly729Asp)23765IL17RAUncertain significancers2061430229RCV001307445; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759029517590295GA17590295-
NM_014339.7(IL17RA):c.2188A>G (p.Ser730Gly)23765IL17RAUncertain significance-1RCV001591693; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759029717590297AG17590297-
NM_014339.7(IL17RA):c.2194del (p.Thr732fs)23765IL17RAUncertain significancers2061430300RCV001209049; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759030317590303CAC22:g.17590303_17590303del-
NM_014339.7(IL17RA):c.2198C>G (p.Pro733Arg)23765IL17RAUncertain significancers41358047RCV000653448; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759030717590307CG22:g.17590307C>GClinGen:CA10086933C3151402 613953 Immunodeficiency 51;
NM_014339.7(IL17RA):c.2200A>G (p.Met734Val)23765IL17RAUncertain significancers746817140RCV001351959; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759030917590309AG17590309-
NM_014339.7(IL17RA):c.2203G>A (p.Ala735Thr)23765IL17RAUncertain significance-1RCV002040538; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759031217590312GA17590312-
NM_014339.7(IL17RA):c.2214CCT[1] (p.Leu740del)23765IL17RAUncertain significancers759229877RCV000797040; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759032317590325ACCTA22:g.17590323_17590325del-
NM_014339.7(IL17RA):c.2215C>G (p.Leu739Val)23765IL17RAUncertain significancers774973347RCV001299199; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759032417590324CG17590324-
NM_014339.7(IL17RA):c.2221C>A (p.Pro741Thr)23765IL17RAUncertain significancers1245969526RCV000821783; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759033017590330CA22:g.17590330C>A-
NM_014339.7(IL17RA):c.2229C>G (p.Asp743Glu)23765IL17RAUncertain significance-1RCV002001525; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759033817590338CG17590338-
NM_014339.7(IL17RA):c.2232G>A (p.Val744=)23765IL17RALikely benign-1RCV001434080; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759034117590341GA17590341-
NM_014339.7(IL17RA):c.2234G>C (p.Arg745Thr)23765IL17RAUncertain significance-1RCV001947872; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759034317590343GC17590343-
NM_014339.7(IL17RA):c.2239C>A (p.His747Asn)23765IL17RAUncertain significancers753883526RCV000653453; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759034817590348CA22:g.17590348C>AClinGen:CA410221447C3151402 613953 Immunodeficiency 51;
NM_014339.7(IL17RA):c.2241C>T (p.His747=)23765IL17RALikely benign-1RCV001461535; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759035017590350CT17590350-
NM_014339.7(IL17RA):c.2242C>T (p.Leu748Phe)23765IL17RAUncertain significancers1444953023RCV001236354|RCV001760249; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334|MedGen:CN517202221759035117590351CT22:g.17590351C>T-
NM_014339.7(IL17RA):c.2244C>T (p.Leu748=)23765IL17RALikely benign-1RCV001471249; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759035317590353CT17590353-
NM_014339.7(IL17RA):c.2245G>A (p.Glu749Lys)23765IL17RAUncertain significancers779004550RCV000307280; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759035417590354GA22:g.17590354G>AClinGen:CA10086951CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.2258T>G (p.Leu753Arg)23765IL17RAUncertain significance-1RCV001934066; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759036717590367TG17590367-
NM_014339.7(IL17RA):c.2264T>C (p.Leu755Pro)23765IL17RALikely benignrs574409116RCV000967720; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759037317590373TC22:g.17590373T>C-
NM_014339.7(IL17RA):c.2268C>T (p.Phe756=)23765IL17RALikely benignrs113571926RCV000546045; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759037717590377CTNC_000022.10:g.17590377C>TClinGen:CA10086956C3151402 613953 Immunodeficiency 51;
NM_014339.7(IL17RA):c.2268C>A (p.Phe756Leu)23765IL17RAUncertain significancers113571926RCV001234732; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759037717590377CA22:g.17590377C>A-
NM_014339.7(IL17RA):c.2274G>C (p.Gln758His)23765IL17RAUncertain significancers1260284396RCV001218432; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759038317590383GC22:g.17590383G>C-
NM_014339.7(IL17RA):c.2295G>A (p.Gln765=)23765IL17RABenignrs41482444RCV000557593; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759040417590404GA22:g.17590404G>AClinGen:CA10086962CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.2296G>A (p.Gly766Arg)23765IL17RAUncertain significancers779762104RCV001035310; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759040517590405GA22:g.17590405G>A-
NM_014339.7(IL17RA):c.2297G>A (p.Gly766Glu)23765IL17RAUncertain significancers1450910603RCV001324645; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759040617590406GA17590406-
NM_014339.7(IL17RA):c.2300G>A (p.Gly767Asp)23765IL17RAUncertain significancers1568924302RCV001063944; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759040917590409GA22:g.17590409G>A-
NM_014339.7(IL17RA):c.2317A>G (p.Met773Val)23765IL17RAUncertain significancers776536038RCV001215516; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759042617590426AG22:g.17590426A>G-
NM_014339.7(IL17RA):c.2318T>C (p.Met773Thr)23765IL17RAUncertain significancers577326347RCV001223163; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759042717590427TC22:g.17590427T>C-
NM_014339.7(IL17RA):c.2322C>G (p.Val774=)23765IL17RALikely benign-1RCV001459220; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759043117590431CG17590431-
NM_014339.7(IL17RA):c.2332C>T (p.Pro778Ser)23765IL17RAUncertain significancers147554210RCV000653444; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759044117590441CT22:g.17590441C>TClinGen:CA10086972C3151402 613953 Immunodeficiency 51;
NM_014339.7(IL17RA):c.2340G>A (p.Thr780=)23765IL17RALikely benign-1RCV002161767; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759044917590449GA17590449-
NM_014339.7(IL17RA):c.2346C>T (p.Tyr782=)23765IL17RALikely benign-1RCV002210004; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759045517590455CT17590455-
NM_014339.7(IL17RA):c.2361G>A (p.Arg787=)23765IL17RALikely benign-1RCV001499366; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759047017590470GA17590470-
NM_014339.7(IL17RA):c.2389A>G (p.Ile797Val)23765IL17RABenignrs74827998RCV000908815; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759049817590498AG22:g.17590498A>G-
NM_014339.7(IL17RA):c.2391C>T (p.Ile797=)23765IL17RALikely benign-1RCV001405056; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759050017590500CT17590500-
NM_014339.7(IL17RA):c.2403C>G (p.Ser801=)23765IL17RALikely benign-1RCV001465775; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759051217590512CG17590512-
NM_014339.7(IL17RA):c.2406G>A (p.Pro802=)23765IL17RABenignrs41356751RCV000529088; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759051517590515GANC_000022.10:g.17590515G>AClinGen:CA10086983C3151402 613953 Immunodeficiency 51;
NM_014339.7(IL17RA):c.2409G>C (p.Gln803His)23765IL17RAUncertain significancers1365038211RCV001052138; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759051817590518GC22:g.17590518G>C-
NM_014339.7(IL17RA):c.2431_2439del (p.Met811_Glu813del)23765IL17RAUncertain significancers749121666RCV001209388; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759053617590544CGGAAATGGAC22:g.17590536_17590544del-
NM_014339.7(IL17RA):c.2428G>A (p.Glu810Lys)23765IL17RAUncertain significancers1601351180RCV000795140; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759053717590537GA22:g.17590537G>A-
NM_014339.7(IL17RA):c.2437GAAGAGGAG[3] (p.Glu816_Glu818dup)23765IL17RAUncertain significance-1RCV001372641; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759054117590542TTGGAGGAAGA17590541-
NM_014339.7(IL17RA):c.2437GAAGAGGAG[1] (p.Glu816_Glu818del)23765IL17RALikely benignrs551742239RCV000546398|RCV001729641; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334|MedGen:CN517202221759054217590550TGGAGGAAGATNC_000022.10:g.17590546GAAGAGGAG[1]ClinGen:CA10086990C3151402 613953 Immunodeficiency 51;
NM_014339.7(IL17RA):c.2440G>A (p.Glu814Lys)23765IL17RAUncertain significancers758565677RCV000823573; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759054917590549GA22:g.17590549G>A-
NM_014339.7(IL17RA):c.2441A>G (p.Glu814Gly)23765IL17RAUncertain significance-1RCV001359575; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759055017590550AG17590550-
NM_014339.7(IL17RA):c.2443G>A (p.Glu815Lys)23765IL17RAUncertain significance-1RCV001944126; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759055217590552GA17590552-
NM_014339.7(IL17RA):c.2446G>A (p.Glu816Lys)23765IL17RAUncertain significance-1RCV001914615; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759055517590555GA17590555-
NM_014339.7(IL17RA):c.2456A>G (p.Gln819Arg)23765IL17RAUncertain significance-1RCV001369796; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759056517590565AG17590565-
NM_014339.7(IL17RA):c.2462C>T (p.Pro821Leu)23765IL17RAUncertain significance-1RCV001938472; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759057117590571CT17590571-
NM_014339.7(IL17RA):c.2466G>A (p.Gly822=)23765IL17RAConflicting interpretations of pathogenicityrs373070776RCV000898296; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759057517590575GA22:g.17590575G>AClinGen:CA10086997CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.2471C>T (p.Pro824Leu)23765IL17RAUncertain significance-1RCV001942634; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759058017590580CT17590580-
NM_014339.7(IL17RA):c.2472G>C (p.Pro824=)23765IL17RALikely benign-1RCV002091421; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759058117590581GC17590581-
NM_014339.7(IL17RA):c.2472G>A (p.Pro824=)23765IL17RALikely benign-1RCV002189262; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759058117590581GA17590581-
NM_014339.7(IL17RA):c.2476C>G (p.Leu826Val)23765IL17RAUncertain significancers1568924494RCV000693207; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759058517590585CGNC_000022.10:g.17590585C>G-C3151402 613953 Immunodeficiency 51;
NM_014339.7(IL17RA):c.2476C>T (p.Leu826=)23765IL17RALikely benignrs1568924494RCV001419893|RCV000980473; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334|MedGen:CN517202221759058517590585CT22:g.17590585C>T-
NM_014339.7(IL17RA):c.2478G>A (p.Leu826=)23765IL17RALikely benign-1RCV002132969; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759058717590587GA17590587-
NM_014339.7(IL17RA):c.2483T>A (p.Leu828His)23765IL17RAUncertain significancers373598318RCV000811821; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759059217590592TA22:g.17590592T>A-
NM_014339.7(IL17RA):c.2486C>T (p.Ser829Phe)23765IL17RAUncertain significancers2061432498RCV001064312; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759059517590595CT22:g.17590595C>T-
NM_014339.7(IL17RA):c.2487T>C (p.Ser829=)23765IL17RALikely benign-1RCV002169339; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759059617590596TC17590596-
NM_014339.7(IL17RA):c.2490C>T (p.Pro830=)23765IL17RABenign/Likely benignrs3804060RCV000310633|RCV000558804; NMedGen:CN239217|MONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759059917590599CT22:g.17590599C>TClinGen:CA10087003CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.2507T>C (p.Leu836Pro)23765IL17RAUncertain significance-1RCV001903692; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759061617590616TC17590616-
NM_014339.7(IL17RA):c.2522G>A (p.Arg841Gln)23765IL17RAUncertain significancers906456948RCV001040185; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759063117590631GA22:g.17590631G>A-
NM_014339.7(IL17RA):c.2541G>A (p.Gln847=)23765IL17RALikely benignrs372715033RCV000914889; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759065017590650GA22:g.17590650G>A-
NM_014339.7(IL17RA):c.2553C>A (p.Asn851Lys)23765IL17RAUncertain significancers1281144372RCV000692392; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759066217590662CA22:g.17590662C>A-C3151402 613953 Immunodeficiency 51;
NM_014339.7(IL17RA):c.2556G>C (p.Ser852=)23765IL17RALikely benign-1RCV001404469; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759066517590665GC17590665-
NM_014339.7(IL17RA):c.2556G>T (p.Ser852=)23765IL17RALikely benign-1RCV002150594; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759066517590665GT17590665-
NM_014339.7(IL17RA):c.2557G>A (p.Gly853Ser)23765IL17RAUncertain significance-1RCV001996863; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759066617590666GA17590666-
NM_014339.7(IL17RA):c.2568G>A (p.Thr856=)23765IL17RALikely benign-1RCV002191202; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759067717590677GA17590677-
NM_014339.7(IL17RA):c.2587G>A (p.Gly863Arg)23765IL17RAUncertain significancers778995730RCV001070418; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759069617590696GA22:g.17590696G>A-
NM_014339.7(IL17RA):c.2596G>A (p.Ala866Thr)23765IL17RAUncertain significancers752247864RCV001245695; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759070517590705GA22:g.17590705G>A-
NM_014339.7(IL17RA):c.*58G>A23765IL17RAUncertain significancers886057205RCV000266278; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759076817590768GA22:g.17590768G>AClinGen:CA10644980CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*211A>G23765IL17RAUncertain significancers886057207RCV000259832; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759092117590921AG22:g.17590921A>GClinGen:CA10653770CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*238G>C23765IL17RABenignrs143922111RCV000317376; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759094817590948GC22:g.17590948G>CClinGen:CA10653771CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*249A>C23765IL17RABenignrs5994164RCV000374421; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759095917590959AC22:g.17590959A>CClinGen:CA10653772CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*320A>G23765IL17RALikely benignrs577387326RCV001137171; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759103017591030AG22:g.17591030A>G-
NM_014339.7(IL17RA):c.*352G>A23765IL17RAUncertain significancers754263270RCV000263454; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759106217591062GANC_000022.10:g.17591062G>AClinGen:CA10653143CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*399C>T23765IL17RALikely benignrs12157751RCV001137172; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759110917591109CT22:g.17591109C>T-
NM_014339.7(IL17RA):c.*414A>G23765IL17RAUncertain significancers886057208RCV000387203; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759112417591124AG22:g.17591124A>GClinGen:CA10644981CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*494A>G23765IL17RAUncertain significancers1289621476RCV001139410; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759120417591204AG22:g.17591204A>G-
NM_014339.7(IL17RA):c.*626C>T23765IL17RAUncertain significancers972148608RCV001139411; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759133617591336CT22:g.17591336C>T-
NM_014339.7(IL17RA):c.*627G>A23765IL17RAUncertain significancers771009907RCV001139412; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759133717591337GA22:g.17591337G>A-
NM_014339.7(IL17RA):c.*643A>T23765IL17RAUncertain significancers1194255362RCV001139413; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759135317591353AT22:g.17591353A>T-
NM_014339.7(IL17RA):c.*665G>A23765IL17RAUncertain significancers1272634665RCV001142038; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759137517591375GA22:g.17591375G>A-
NM_014339.7(IL17RA):c.*803G>A23765IL17RABenignrs12158721RCV001142039; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759151317591513GA22:g.17591513G>A-
NM_014339.7(IL17RA):c.*821C>T23765IL17RAUncertain significancers181804525RCV000341264; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759153117591531CTNC_000022.10:g.17591531C>TClinGen:CA10653148CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*832G>T23765IL17RAUncertain significancers1382022057RCV001142040; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759154217591542GT22:g.17591542G>T-
NM_014339.7(IL17RA):c.*900G>A23765IL17RAUncertain significancers1327480980RCV001142041; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759161017591610GA22:g.17591610G>A-
NM_014339.7(IL17RA):c.*973A>G23765IL17RAUncertain significancers747949566RCV000394590; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759168317591683AGNC_000022.10:g.17591683A>GClinGen:CA10650800CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*1066C>T23765IL17RAUncertain significancers75870648RCV000261923; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759177617591776CTNC_000022.10:g.17591776C>TClinGen:CA10653790CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*1067G>T23765IL17RAUncertain significancers866985543RCV001143843; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759177717591777GT22:g.17591777G>T-
NM_014339.7(IL17RA):c.*1077C>T23765IL17RAUncertain significancers964969985RCV001143844; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759178717591787CT22:g.17591787C>T-
NM_014339.7(IL17RA):c.*1085A>C23765IL17RAUncertain significancers2061439839RCV001143845; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759179517591795AC22:g.17591795A>C-
NM_014339.7(IL17RA):c.*1090G>C23765IL17RAUncertain significancers886057214RCV000367072; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759180017591800GCNC_000022.10:g.17591800G>CClinGen:CA10653153CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*1093T>C23765IL17RAUncertain significancers886057215RCV000275018; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759180317591803TCNC_000022.10:g.17591803T>CClinGen:CA10644987CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*1161T>G23765IL17RAUncertain significancers541762208RCV001137280; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759187117591871TG22:g.17591871T>G-
NM_014339.7(IL17RA):c.*1194C>T23765IL17RAUncertain significancers2061440264RCV001137281; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759190417591904CT22:g.17591904C>T-
NM_014339.7(IL17RA):c.*1320A>G23765IL17RAUncertain significancers886057216RCV000269177; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759203017592030AGNC_000022.10:g.17592030A>GClinGen:CA10653791CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*1338G>A23765IL17RALikely benignrs192058258RCV001139530; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759204817592048GA22:g.17592048G>A-
NM_014339.7(IL17RA):c.*1373C>T23765IL17RAUncertain significancers2061441307RCV001139531; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759208317592083CT22:g.17592083C>T-
NM_014339.7(IL17RA):c.*1379A>T23765IL17RABenignrs5992627RCV000326689; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759208917592089ATNC_000022.10:g.17592089A>TClinGen:CA10653154CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*1431A>G23765IL17RAUncertain significancers886057217RCV000383566; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759214117592141AGNC_000022.10:g.17592141A>GClinGen:CA10653792CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*1480G>A23765IL17RAUncertain significancers182884770RCV000291647; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759219017592190GANC_000022.10:g.17592190G>AClinGen:CA10653797CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*1526G>A23765IL17RAUncertain significancers372204111RCV001140295; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759223617592236GA22:g.17592236G>A-
NM_014339.7(IL17RA):c.*1641C>T23765IL17RAUncertain significancers886057218RCV000320956; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759235117592351CTNC_000022.10:g.17592351C>TClinGen:CA10650802CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*1686G>A23765IL17RALikely benignrs144428545RCV000377950; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759239617592396GANC_000022.10:g.17592396G>AClinGen:CA10650806CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*1826A>G23765IL17RAUncertain significancers886057219RCV000279596; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759253617592536AGNC_000022.10:g.17592536A>GClinGen:CA10653155CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*1861G>A23765IL17RAUncertain significancers886057220RCV000334629; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759257117592571GANC_000022.10:g.17592571G>AClinGen:CA10644990CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*2066G>C23765IL17RABenignrs375958748RCV000404661; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759277617592776GCNC_000022.10:g.17592776G>CClinGen:CA10653156CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*2111C>T23765IL17RABenignrs114684847RCV001142130; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759282117592821CT22:g.17592821C>T-
NM_014339.7(IL17RA):c.*2112C>T23765IL17RABenignrs12159073RCV001142131; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759282217592822CT22:g.17592822C>T-
NM_014339.7(IL17RA):c.*2128A>G23765IL17RAUncertain significancers1164039756RCV001142132; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759283817592838AG22:g.17592838A>G-
NM_014339.7(IL17RA):c.*2141C>T23765IL17RAUncertain significancers550573977RCV000340346; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759285117592851CTNC_000022.10:g.17592851C>TClinGen:CA10653158CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*2163G>C23765IL17RABenignrs543545127RCV000397750; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759287317592873GCNC_000022.10:g.17592873G>CClinGen:CA10653159CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*2291C>T23765IL17RAUncertain significancers533866564RCV001137396; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759300117593001CT22:g.17593001C>T-
NM_014339.7(IL17RA):c.*2329G>A23765IL17RAUncertain significancers1056127571RCV001137397; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759303917593039GA22:g.17593039G>A-
NM_014339.7(IL17RA):c.*2344C>G23765IL17RAUncertain significancers4563337RCV001137398; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759305417593054CG22:g.17593054C>G-
NM_014339.7(IL17RA):c.*2512C>A23765IL17RAUncertain significancers539337199RCV000330543; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759322217593222CA22:g.17593222C>AClinGen:CA10653801CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*2566C>T23765IL17RAUncertain significancers886057221RCV000357322; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759327617593276CT22:g.17593276C>TClinGen:CA10653160CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*2591C>T23765IL17RAUncertain significancers775318044RCV000317846; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759330117593301CT22:g.17593301C>TClinGen:CA10645002CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*2603C>T23765IL17RALikely benignrs192250812RCV001139632; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759331317593313CT22:g.17593313C>T-
NM_014339.7(IL17RA):c.*2703G>A23765IL17RAUncertain significancers189556719RCV000287386; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759341317593413GA22:g.17593413G>AClinGen:CA10653161CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*2844A>G23765IL17RAUncertain significancers144892452RCV000347726; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759355417593554AG22:g.17593554A>GClinGen:CA10645009CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*2859C>T23765IL17RAUncertain significancers562668645RCV000404798; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759356917593569CT22:g.17593569C>TClinGen:CA10650811CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*2963C>T23765IL17RAUncertain significancers886057224RCV000289590; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759367317593673CT22:g.17593673C>TClinGen:CA10653163CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*2986G>A23765IL17RAUncertain significancers941175830RCV001140394; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759369617593696GA22:g.17593696G>A-
NM_014339.7(IL17RA):c.*3024G>A23765IL17RAUncertain significancers1311790630RCV001142251; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759373417593734GA22:g.17593734G>A-
NM_014339.7(IL17RA):c.*3058G>C23765IL17RAUncertain significancers570509509RCV001142252; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759376817593768GC22:g.17593768G>C-
NM_014339.7(IL17RA):c.*3060A>G23765IL17RABenignrs12157837RCV000405443; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759377017593770AG22:g.17593770A>GClinGen:CA10650814CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*3071A>G23765IL17RAUncertain significancers759654015RCV001142253; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759378117593781AG22:g.17593781A>G-
NM_014339.7(IL17RA):c.*3093T>C23765IL17RAUncertain significancers755858124RCV001142254; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759380317593803TC22:g.17593803T>C-
NM_014339.7(IL17RA):c.*3127G>A23765IL17RAUncertain significancers753591654RCV001142255; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759383717593837GA22:g.17593837G>A-
NM_014339.7(IL17RA):c.*3175T>C23765IL17RAUncertain significancers569490500RCV001137513; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759388517593885TC22:g.17593885T>C-
NM_014339.7(IL17RA):c.*3187T>G23765IL17RALikely benignrs536506632RCV000376436; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759389717593897TGNC_000022.10:g.17593897T>GClinGen:CA10653806CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*3523C>T23765IL17RAUncertain significancers886057230RCV000352282; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759423317594233CTNC_000022.10:g.17594233C>TClinGen:CA10653820CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*3533C>T23765IL17RAUncertain significancers879082395RCV001139721; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759424317594243CT22:g.17594243C>T-
NM_014339.7(IL17RA):c.*3617T>C23765IL17RAUncertain significancers1054721085RCV001139722; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759432717594327TC22:g.17594327T>C-
NM_014339.7(IL17RA):c.*3624G>A23765IL17RABenignrs563135481RCV001139723; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759433417594334GA22:g.17594334G>A-
NM_014339.7(IL17RA):c.*3667C>T23765IL17RAUncertain significancers886057231RCV000292732; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759437717594377CTNC_000022.10:g.17594377C>TClinGen:CA10650819CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*3708G>A23765IL17RAUncertain significancers74634517RCV001140499; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759441817594418GA22:g.17594418G>A-
NM_014339.7(IL17RA):c.*3708G>T23765IL17RAUncertain significancers74634517RCV001140500; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759441817594418GT22:g.17594418G>T-
NM_014339.7(IL17RA):c.*3734C>A23765IL17RAUncertain significancers768197387RCV000338410; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759444417594444CANC_000022.10:g.17594444C>AClinGen:CA10645020CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*3734C>T23765IL17RAUncertain significancers768197387RCV001140501; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759444417594444CT22:g.17594444C>T-
NM_014339.7(IL17RA):c.*3823C>G23765IL17RAUncertain significancers774888622RCV001142346; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759453317594533CG22:g.17594533C>G-
NM_014339.7(IL17RA):c.*3837C>G23765IL17RAUncertain significancers886057232RCV000334700; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759454717594547CGNC_000022.10:g.17594547C>GClinGen:CA10645021CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*3865C>T23765IL17RAUncertain significancers559104346RCV000393445; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759457517594575CTNC_000022.10:g.17594575C>TClinGen:CA10653823CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*3869G>A23765IL17RAUncertain significancers907407230RCV001142347; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759457917594579GA22:g.17594579G>A-
NM_014339.7(IL17RA):c.*3913C>G23765IL17RAUncertain significancers11702918RCV000304211; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759462317594623CGNC_000022.10:g.17594623C>GClinGen:CA10645022CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*3943G>A23765IL17RAUncertain significancers1229647331RCV001137602; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759465317594653GA22:g.17594653G>A-
NM_014339.7(IL17RA):c.*3969G>T23765IL17RAUncertain significancers886057233RCV000309913; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759467917594679GTNC_000022.10:g.17594679G>TClinGen:CA10653824CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*3975G>T23765IL17RAUncertain significancers184570264RCV001137603; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759468517594685GT22:g.17594685G>T-
NM_014339.7(IL17RA):c.*3976G>A23765IL17RABenignrs576803215RCV000364706; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759468617594686GA22:g.17594686G>AClinGen:CA10653177CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*4002C>T23765IL17RAUncertain significancers1285572932RCV001139827; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759471217594712CT22:g.17594712C>T-
NM_014339.7(IL17RA):c.*4003G>T23765IL17RALikely benignrs143888540RCV001139828; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759471317594713GT22:g.17594713G>T-
NM_014339.7(IL17RA):c.*4004C>T23765IL17RALikely benignrs150231194RCV000388847; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759471417594714CT22:g.17594714C>TClinGen:CA10653180CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*4056A>T23765IL17RAUncertain significancers779043954RCV000330921; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759476617594766AT22:g.17594766A>TClinGen:CA10653828CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*4124G>T23765IL17RALikely benignrs138712036RCV001140607; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759483417594834GT22:g.17594834G>T-
NM_014339.7(IL17RA):c.*4197A>G23765IL17RALikely benignrs149359202RCV001140608; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759490717594907AG22:g.17594907A>G-
NM_014339.7(IL17RA):c.*4239A>G23765IL17RAUncertain significancers572377283RCV001142470; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759494917594949AG22:g.17594949A>G-
NM_014339.7(IL17RA):c.*4352A>G23765IL17RAUncertain significancers1011624912RCV001142471; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759506217595062AG22:g.17595062A>G-
NM_014339.7(IL17RA):c.*4359T>C23765IL17RAUncertain significancers573003907RCV000279114; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759506917595069TC22:g.17595069T>CClinGen:CA10645029CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*4404C>T23765IL17RAUncertain significancers558883229RCV001142472; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759511417595114CT22:g.17595114C>T-
NM_014339.7(IL17RA):c.*4509A>G23765IL17RAUncertain significancers886057234RCV000303871; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759521917595219AG22:g.17595219A>GClinGen:CA10645037CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*4516C>T23765IL17RAUncertain significancers180834857RCV000339543; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759522617595226CT22:g.17595226C>TClinGen:CA10645038CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*4649G>T23765IL17RAUncertain significancers886057235RCV000405039; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759535917595359GT22:g.17595359G>TClinGen:CA10645039CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*4667A>G23765IL17RAUncertain significancers2061458764RCV001137722; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759537717595377AG22:g.17595377A>G-
NM_014339.7(IL17RA):c.*4791C>T23765IL17RAUncertain significancers986018820RCV001139944; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759550117595501CT22:g.17595501C>T-
NM_014339.7(IL17RA):c.*4798C>T23765IL17RAUncertain significancers1478354859RCV001139945; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759550817595508CT22:g.17595508C>T-
NM_014339.7(IL17RA):c.*4827A>G23765IL17RAUncertain significancers886057238RCV000315418; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759553717595537AG22:g.17595537A>GClinGen:CA10653185CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*4849C>G23765IL17RAUncertain significancers886057239RCV000369979; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759555917595559CG22:g.17595559C>GClinGen:CA10645043CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*4878G>C23765IL17RAUncertain significancers1285493774RCV001139946; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759558817595588GC22:g.17595588G>C-
NM_014339.7(IL17RA):c.*4947G>A23765IL17RAUncertain significancers994588098RCV001139947; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759565717595657GA22:g.17595657G>A-
NM_014339.7(IL17RA):c.*5036C>T23765IL17RABenignrs1003945RCV000319246; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759574617595746CTNC_000022.10:g.17595746C>TClinGen:CA10653187CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*5038A>T23765IL17RAUncertain significancers531901217RCV001140705; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759574817595748AT22:g.17595748A>T-
NM_014339.7(IL17RA):c.*5050G>A23765IL17RAUncertain significancers886057240RCV000355342; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759576017595760GANC_000022.10:g.17595760G>AClinGen:CA10653834CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*5117G>A23765IL17RAUncertain significancers1225025974RCV001140706; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759582717595827GA22:g.17595827G>A-
NM_014339.7(IL17RA):c.*5156A>G23765IL17RAUncertain significancers930099196RCV001140707; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759586617595866AG22:g.17595866A>G-
NM_014339.7(IL17RA):c.*5164C>T23765IL17RAUncertain significancers754485568RCV000315858; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759587417595874CTNC_000022.10:g.17595874C>TClinGen:CA10650840CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*5256C>T23765IL17RABenignrs1003944RCV000321603; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759596617595966CTNC_000022.10:g.17595966C>TClinGen:CA10650841CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*5270C>T23765IL17RABenignrs1003943RCV000376206; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759598017595980CTNC_000022.10:g.17595980C>TClinGen:CA10653838CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*5480T>A23765IL17RAUncertain significancers556640863RCV000403044; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759619017596190TANC_000022.10:g.17596190T>AClinGen:CA10653188CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*5659G>A23765IL17RABenignrs7289055RCV000406661; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759636917596369GANC_000022.10:g.17596369G>AClinGen:CA10653840CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*5660G>A23765IL17RAUncertain significancers1226203860RCV001140069; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759637017596370GA22:g.17596370G>A-
NM_014339.7(IL17RA):c.*5677C>A23765IL17RALikely benignrs559845151RCV000312588; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759638717596387CANC_000022.10:g.17596387C>AClinGen:CA10653189CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*5778A>G23765IL17RAUncertain significancers886057242RCV000322961; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759648817596488AGNC_000022.10:g.17596488A>GClinGen:CA10653842CN239217 Familial Candidiasis, Recessive;
NM_014339.7(IL17RA):c.*5797A>C23765IL17RAUncertain significancers1468149711RCV001140832; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759650717596507AC22:g.17596507A>C-
NM_014339.7(IL17RA):c.*5855A>G23765IL17RAUncertain significancers886057243RCV000264335; NMONDO:MONDO:0013500,MedGen:C4310803,OMIM:613953, Orphanet:1334221759656517596565AG22:g.17596565A>GClinGen:CA10653844CN239217 Familial Candidiasis, Recessive;
MSeqDR Portal