MSeqDR Mitochondrial Disease Portal

*:HP: HPO terms, UMDF: 1= Disease, ND: NAMDC terms.
  Most Studied  CPEO, Complex I Deficiency, COXPD1, Leigh, LHON, MELAS, MERRF, Myopathy, SANDO
Disease Browser
Parent Node:
Intellectual Disability (D008607)
..Starting node

       Child Nodes:

 Sister Nodes: 
..expand15q24 Microdeletion (C579849)
..expand16p11.2 Deletion Syndrome (C579850)
..expandAbsent Eyebrows and Eyelashes with Mental Retardation (C563111)
..expandAcrodysostosis (C538179)
..expandAgonadism, XY, with Mental Retardation, Short Stature, Retarded Bone Age, and Multiple Extragenital Malformations (C563429)
..expandAICAR Transformylase Inosine Monophosphate Cyclohydrolase Deficiency (C563876)
..expandAkesson syndrome (C535610)
..expandAl Gazali Aziz Salem syndrome (C535613)
..expandAL-RAQAD SYNDROME (OMIM:616459)
..expandAlaninuria with Microcephaly, Dwarfism, Enamel Hypoplasia, and Diabetes Mellitus (C565968)
..expandALAZAMI SYNDROME (OMIM:615071)
..expandAlopecia contractures dwarfism mental retardation (C537051)
..expandAlopecia epilepsy oligophrenia syndrome of Moynahan (C537052)
..expandAlopecia, epilepsy, pyorrhea, mental subnormality (C537057)
..expandAlopecia, Neurologic Defects, and Endocrinopathy Syndrome (C567425)
..expandAlopecia-Mental Retardation Syndrome 1 (C565965)
..expandAlopecia-Mental Retardation Syndrome 2 (C563668)
..expandAlopecia-Mental Retardation Syndrome with Convulsions and Hypergonadotropic Hypogonadism (C563370)
..expandAlpha-Thalassemia Mental Retardation Syndrome, Deletion-Type (C563050)
..expandAlport Syndrome, Mental Retardation, Midface Hypoplasia, and Elliptocytosis (C564570)
..expandAmino Aciduria with Mental Deficiency, Dwarfism, Muscular Dystrophy, Osteoporosis, and Acidosis (C565960)
..expandAmyloidosis of Gingiva and Conjunctiva, with Mental Retardation (C565958)
..expandAmyotrophic Dystonic Paraplegia (C566292)
..expandAnemia, Congenital Hypoplastic, with Multiple Congenital Anomalies-Mental Retardation Syndrome (C565796)
..expandAniridia cerebellar ataxia mental deficiency (C536370)
..expandAnsell Bywaters Elderking syndrome (C537773)
..expandAortic arch anomaly with peculiar facies and mental retardation (C537785)
..expandAphalangia, Partial, with Syndactyly and Duplication of Metatarsal IV (C563942)
..expandArachnodactyly ataxia cataract aminoaciduria mental retardation (C537424)
..expandArginine:Glycine Amidinotransferase Deficiency (C567192)  LSDB  L: 00444;
..expandArthrogryposis, distal, with hypopituitarism, mental retardation, and facial anomalies (C535385)
..expandArthrogryposis, Distal, with Mental Retardation and Characteristic Facies (C565940)
..expandAU-KLINE SYNDROME (OMIM:616580)
..expandAughton syndrome (C538269)
..expandAural Atresia, Multiple Congenital Anomalies, and Mental Retardation (C565923)
..expandBaraitser Rodeck Garner syndrome (C537906)
..expandBattaglia Neri syndrome (C537662)
..expandBehr syndrome (C537669)
..expandBellini Chiumello Rimoldi syndrome (C535652)
..expandBiemond syndrome II (C565902)
..expandBirk-Barel Mental Retardation Dysmorphism Syndrome (C567357)
..expandBlepharophimosis syndrome Ohdo type (C536232)
..expandBlepharophimosis with Facial and Genital Anomalies and Mental Retardation (C565797)
..expandBohring syndrome (C537419)
..expandBoudhina Yedes Khiari syndrome (C537939)
..expandBrain Anomalies, Retardation, Ectodermal Dysplasia, Skeletal Malformations, Hirschsprung Disease, Ear-Eye Anomalies, Cleft Palate-Cryptorchidism, And (C564519)
..expandBrunner Syndrome (C563156)
..expandBullous Dystrophy, Hereditary Macular Type (C563065)
..expandCAHMR syndrome (C537959)
..expandCamera Marugo Cohen syndrome (C537964)
..expandCantalamessa Baldini Ambrosi syndrome (C537981)
..expandCantu Sanchez-Corona Fragoso syndrome (C535571)
..expandCartwright Nelson Fryns syndrome (C535917)
..expandCataract, Congenital, with Mental Impairment and Dentate Gyrus Atrophy (C564353)
..expandCataracts, ataxia, short stature, and mental retardation (C535345)
..expandCataracts, Congenital, with Sensorineural Deafness, Down Syndrome-Like Facial Appearance, Short Stature, and Mental Retardation (C563390)
..expandCephalin Lipidosis (C565872)
..expandCerebellar Ataxia, Mental Retardation, And Dysequilibrium Syndrome 2 (C567656)
..expandCerebellar Ataxia, Mental Retardation, And Dysequilibrium Syndrome 3 (C567690)
..expandCerebral Cavernous Malformations 2 (C566394)
..expandCerebral Cavernous Malformations 3 (C566393)
..expandCerebrocostomandibular Syndrome (C562538)
..expandCerebrofaciothoracic Dysplasia (C565862)
..expandCerebrooculofacioskeletal Syndrome 2 (C565185)
..expandCerebrooculofacioskeletal Syndrome 4 (C565184)
..expandCerebrooculonasal Syndrome (C565313)
..expandChoroid plexus calcification with mental retardation (C535357)
..expandChromosome 15q13.3 Microdeletion Syndrome (C567439)
..expandChromosome 15q26-Qter Deletion Syndrome (C567232)
..expandChromosome 17q21.31 Deletion Syndrome (C566476)
..expandChromosome 18 Pericentric Inversion (C563734)
..expandChromosome 1q21.1 Duplication Syndrome (C567290)
..expandChromosome 1q43-Q44 Deletion Syndrome (C567346)
..expandChromosome 2q31.2 Deletion Syndrome (C567344)
..expandChromosome 2q32-Q33 Deletion Syndrome (C567350)
..expandChromosome 3q29 Deletion Syndrome (C567184)
..expandChromosome Xq28 Duplication Syndrome (C567580)
..expandChudley-Rozdilsky syndrome (C535458)
..expandCleft Palate, Isolated, And Mental Retardation (C566991)
..expandCoffin syndrome 1 (C536435)
..expandCoffin-Siris syndrome (C536436)
..expandCohen syndrome (C536438)
..expandColoboma, cleft lip-palate and mental retardation syndrome (C535971)
..expandColoboma, Uveal, with Cleft Lip and Palate and Mental Retardation (C565173)
..expandColoboma-Obesity-Hypogenitalism-Mental Retardation Syndrome (C566623)
..expandConvulsive Disorder, Familial, with Prenatal or Early Onset (C565678)
..expandCorpus Callosum, Agenesis of, with Mental Retardation, Ocular Coloboma, and Micrognathia (C564509)
..expandCortical Blindness, Retardation, and Postaxial Polydactyly (C565674)
..expandCraniofaciofrontodigital Syndrome (C567298)
..expandCraniosynostosis Mental Retardation Clefting Syndrome (C565663)
..expandCraniosynostosis-Mental Retardation Syndrome of Lin and Gettig (C565664)
..expandCree Mental Retardation Syndrome (C564654)
..expandCri-du-Chat Syndrome (D003410) Child6
..expandCryohydrocytosis, Stomatin-Deficient, with Mental Retardation, Seizures, Cataracts, and Massive Hepatosplenomegaly (C563840)
..expandCubitus Valgus with Mental Retardation and Unusual Facies (C564510)
..expandCuratolo Cilio Pessagno syndrome (C536701)
..expandCutis Verticis Gyrata and Mental Deficiency (C565661)
..expandCystic Fibrosis with Helicobacter Pylori Gastritis, Megaloblastic Anemia, and Subnormal Mentality (C565658)
..expandDavis Lafer syndrome (C535989)
..expandDe Barsy syndrome (C535990)
..expandDe Lange Syndrome (D003635) Child1
..expandDe Sanctis-Cacchione syndrome (C535992)
..expandDeafness, Cochlear, with Myopia and Intellectual Impairment (C565645)
..expandDeafness, congenital onychodystrophy, recessive form (C538204)
..expandDevriendt syndrome (C535947)
..expandDiabetes Insipidus, Nephrogenic, with Mental Retardation and Intracerebral Calcification (C565632)
..expandDicarboxylicaminoaciduria (C536171)
..expandDigitorenocerebral Syndrome (C563052)
..expandDislocated Elbows, Bowed Tibias, Scoliosis, Deafness, Cataract, Microcephaly, And Mental Retardation (C566408)
..expandDown Syndrome (D004314) Child6
..expandDubowitz syndrome (C535718)
..expandDuker Weiss Siber syndrome (C535719)
..expandDuplication 15q11-q13 Syndrome (C557830)
..expandDwarfism, Low-Birth-Weight Type, with Unresponsiveness to Growth Hormone (C565615)
..expandDyggve-Melchior-Clausen syndrome (C535726)
..expandDysequilibrium syndrome (C535731)
..expandDysmyelination With Jaundice (C565610)
..expandEctodermal dysplasia mental retardation syndactyly (C538018)
..expandEctodermal Dysplasia, Hypohidrotic, with Hypothyroidism and Agenesis of the Corpus Callosum (C565605)
..expandElliott Ludman Teebi syndrome (C536204)
..expandEmanuel syndrome (C535733)
..expandEmphysema, Congenital, With Deafness, Penoscrotal Web, And Mental Retardation (C566519)
..expandEncephalopathy with Intracranial Calcification, Growth Hormone Deficiency, Microcephaly, and Retinal Degeneration (C565594)
..expandEpidermolysis bullosa, late-onset localized junctional, with mental retardation (C535492)
..expandEpilepsy telangiectasia (C535497)
..expandEpilepsy, Female-Restricted, with Mental Retardation (C564715)
..expandEpilepsy, Photogenic, with Spastic Diplegia and Mental Retardation (C565587)
..expandFacial Abnormalities, Kyphoscoliosis, and Mental Retardation (C565580)
..expandFaciocardiomelic Syndrome (C567176)
..expandFallot complex with severe mental and growth retardation (C536608)
..expandFeingold Trainer syndrome (C536179)
..expandFg Syndrome 5 (C564480)
..expandFibromatosis, Gingival, with Hypertrichosis and Mental Retardation (C565331)
..expandFilippi syndrome (C538152)
..expandFine-Lubinsky syndrome (C537933)
..expandFitzsimmons Walson Mellor syndrome (C537937)
..expandFitzsimmons-McLachlan-Gilbert syndrome (C537058)
..expandFountain syndrome (C537270)
..expandFryns-Aftimos Syndrome (C565258)
..expandGarret Tripp syndrome (C535646)
..expandGenitopatellar Syndrome (C565255)
..expandGoniodysgenesis-Mental Retardation-Short Stature Syndrome (C564214)
..expandGrowth and Developmental Retardation, Ocular Ptosis, Cardiac Defect, and Anal Atresia (C565755)
..expandGrowth and mental retardation, mandibulofacial dysostosis, microcephaly, and cleft palate (C537405)
..expandGrowth Deficiency and Mental Retardation with Facial Dysmorphism (C565358)
..expandGrowth Failure, Microcephaly, Mental Retardation, Cataracts, Large Joint Contractures, Osteoporosis, Cortical Dysplasia, and Cerebellar Atrophy (C564264)
..expandGrowth mental deficiency syndrome of Myhre (C537620)
..expandGurrieri Sammito Bellussi syndrome (C537625)
..expandHair defect with photosensitivity and mental retardation (C537628)
..expandHall Riggs mental retardation syndrome (C535623)
..expandHarrod Doman Keele syndrome (C535635)
..expandHaspeslagh Fryns Muelenaere syndrome (C535844)
..expandHittner Hirsch Kreh syndrome (C538323)
..expandHoloprosencephaly, Ectrodactyly, and Bilateral Cleft Lip-Palate (C564484)
..expandHooft disease (C535329)
..expandHordnes Engebretsen Knudtson syndrome (C536067)
..expandHoyeraal Hreidarsson syndrome (C536068)
..expandHunter-McAlpine syndrome (C536072)
..expandHydronephrosis, Congenital, with Cleft Palate, Characteristic Facies, Hypotonia, and Mental Retardation (C565736)
..expandHydroxylysinuria (C565502)
..expandHyperleucine-Isoleucinemia (C562674)
..expandHyperlysinemia Due To Defect In Lysine Transport Into Mitochondria (C565499)
..expandHyperphosphatasia with Mental Retardation (C565495) Child2
..expandHypertelorism, Severe, With Midface Prominence, Myopia, Mental Retardation, And Bone Fragility (C566988)
..expandHypertrichosis, hyperkeratosis, mental retardation, and distinctive facial features (C538391)
..expandHyperuricemia, Infantile, with Abnormal Behavior and Normal Hypoxanthine Guanine Phosphoribosyltransferase (C565489)
..expandHypogonadism with Low-Grade Mental Deficiency and Microcephaly (C565482)
..expandHypogonadism, Male, With Mental Retardation And Skeletal Anomalies (C564406)
..expandHypoparathyroidism-retardation-dysmorphism syndrome (C537157)
..expandHypospadias-Mental Retardation Syndrome (C563067)
..expandHypotonia-Cystinuria Syndrome (C564710)  LSDB  L: 00416;
..expandIchthyosis and male hypogonadism (C537365)
..expandIchthyosis, mental retardation, dwarfism, and renal impairment (C536274)
..expandIchthyosis-Mental Retardation Syndrome with Large Keratohyalin Granules in the Skin (C563402)
..expandIndolylacroyl Glycinuria with Mental Retardation (C565466)
..expandIris Coloboma with Ptosis, Hypertelorism, and Mental Retardation (C565462)
..expandJagell Holmgren Hofer syndrome (C537364)
..expandJohanson Blizzard syndrome (C535880)
..expandJoubert Syndrome 7 (C566916)
..expandJoubert Syndrome 9 (C567364)
..expandKahrizi Syndrome (C567196)
..expandKaler Garrity Stern syndrome (C537706)
..expandKapur Toriello syndrome (C537008)
..expandKarandikar Maria Kamble syndrome (C537009)
..expandKatsantoni Papadakou Lagoyanni syndrome (C537012)
..expandKaufman oculocerebrofacial syndrome (C537013)
..expandKBG syndrome (C537015)
..expandKleefstra Syndrome (C563043)
..expandKoone Rizzo Elias syndrome (C537023)
..expandKosztolanyi syndrome (C537024)
..expandKozlowski Ouvrier syndrome (C537508)
..expandKozlowski Rafinski Klicharska syndrome (C537509)
..expandKozlowski-Krajewska syndrome (C537615)
..expandKuzniecky syndrome (C538091)
..expandLambert syndrome (C538396)
..expandLenz Majewski hyperostotic dwarfism (C537115)
..expandLeukomelanoderma, Infantilism, Mental Retardation, Hypodontia, Hypotrichosis (C565440)
..expandLight Fixation Seizure Syndrome (C566367)
..expandLimb Defects, Distal Transverse, with Mental Retardation and Spasticity (C565438)
..expandLipodystrophy, Generalized, with Mental Retardation, Deafness, Short Stature, and Slender Bones (C564283)
..expandLissencephaly 3 (C566908)
..expandLowry Maclean syndrome (C537037)
..expandLowry Wood syndrome (C537038)
..expandLubani Al Saleh Teebi syndrome (C537039)
..expandLynch Lee Murday syndrome (C537713)
..expandMacrogyria, pseudobulbar palsy and mental retardation (C537722)
..expandMacrosomia obesity macrocephaly ocular abnormalities (C535812)
..expandMale pseudohermaphroditism-mental retardation syndrome, Verloes type (C535693)
..expandMandibulofacial Dysostosis with Mental Deficiency (C565420)
..expandMarfanoid Mental Retardation Syndrome, Autosomal (C565410)
..expandMarinesco-Sjogren-like syndrome (MSLS) (C535913)
..expandMartin-Probst Deafness-Mental Retardation Syndrome (C564495)
..expandMartsolf syndrome (C536028)
..expandMASA (Mental Retardation, Aphasia, Shuffling Gait, Adducted Thumbs) Syndrome (C536029)
..expandMcDonough syndrome (C538158)
..expandMEND SYNDROME (OMIM:300960)
..expandMental and Growth Retardation with Amblyopia (C563591)
..expandMental Retardation associated with Psoriasis (C564107)
..expandMental retardation Mietens Weber type (C537444)
..expandMental retardation Smith Fineman Myers type (C537445)
..expandMental retardation spasticity ectrodactyly (C537446)
..expandMental retardation syndrome, Belgian type (C537447)
..expandMental Retardation with Optic Atrophy, Facial Dysmorphism, Microcephaly, and Short Stature (C563810)
..expandMental Retardation with Spastic Paraplegia (C564099)
..expandMental retardation Wolff type (C537448)
..expandMental Retardation, Autosomal Dominant 1 (C566947)
..expandMental Retardation, Autosomal Dominant 3 (C567241)
..expandMental Retardation, Autosomal Dominant 4 (C567240)
..expandMental Retardation, Autosomal Dominant 5 (C567234)
..expandMental Retardation, Autosomal Recessive 1 (C565406)
..expandMental Retardation, Autosomal Recessive 10 (C567013)
..expandMental Retardation, Autosomal Recessive 11 (C567012)
..expandMental Retardation, Autosomal Recessive 12 (C567019)
..expandMental Retardation, Autosomal Recessive 13 (C567714)
..expandMental Retardation, Autosomal Recessive 2 (C564404)
..expandMental Retardation, Autosomal Recessive 3 (C563929)
..expandMental Retardation, Autosomal Recessive 4 (C567008)
..expandMental Retardation, Autosomal Recessive 5 (C567018)
..expandMental Retardation, Autosomal Recessive 6 (C567017)
..expandMental Retardation, Autosomal Recessive 7 (C567016)
..expandMental Retardation, Autosomal Recessive 8 (C567015)
..expandMental Retardation, Autosomal Recessive 9 (C567014)
..expandMental Retardation, Buenos Aires Type (C563095)
..expandMental Retardation, Fra12a Type (C566980)
..expandMental Retardation, Joint Hypermobility, And Skin Laxity, With Or Without Metabolic Abnormalities (C567209)
..expandMental retardation, keratoconus, febrile seizures, and sinoatrial block (C537452)
..expandMental retardation, macrocephaly, short stature and craniofacial dysmorphism (C537453)
..expandMental Retardation, Microcephaly, Epilepsy, And Coarse Face (C563342)
..expandMental Retardation, Microcephaly, Growth Retardation, Joint Contractures, and Facial Dysmorphism (C565246)
..expandMental Retardation, Severe, With Spasticity And Pigmentary Tapetoretinal Degeneration (C566429)
..expandMental Retardation, Short Stature, Facial Anomalies, and Joint Dislocations (C565248)
..expandMental Retardation, Skeletal Dysplasia, and Abducens Palsy (C564101)
..expandMental Retardation, X-Linked (D038901) Child134  LSDB C:4
..expandMental Retardation, X-Linked, Syndromic 12 (C564106)
..expandMental Retardation, X-Linked, Syndromic, Christianson Type (C567484)
..expandMental Retardation, X-Linked, Syndromic, Turner Type (C567476)
..expandMental Retardation, X-Linked, Syndromic, Zdhhc9-Related (C567586)
..expandMental Retardation, X-Linked, With Panhypopituitarism (C567485)
..expandMental Retardation, X-Linked, Znf711-Related (C567583)
..expandMetaphyseal Dysostosis, Mental Retardation, and Conductive Deafness (C565396)
..expandMethionine Malabsorption Syndrome (C562682)
..expandMicrocephalic primordial dwarfism Toriello type (C537321)
..expandMicrocephaly cervical spine fusion anomalies (C537325)
..expandMicrocephaly deafness syndrome (C537326)
..expandMicrocephaly seizures mental retardation heart disorders (C537544)
..expandMicrocephaly sparse hair mental retardation seizures (C537545)
..expandMicrocephaly with Mental Retardation and Digital Anomalies (C567101)
..expandMicrocephaly, corpus callosum dysgenesis and cleft lip-palate (C537547)
..expandMicrocephaly, Facial Abnormalities, Micromelia, and Mental Retardation (C566361)
..expandMicrocephaly, Macrotia, And Mental Retardation (C566525)
..expandMicrophthalmia and mental deficiency (C537462)
..expandMirhosseini-Holmes-Walton syndrome (C538367)
..expandMohr-Tranebjaerg syndrome (C535808)  LSDB  L: 00113;
..expandMollica Pavone Antener syndrome (C535809)
..expandMOMES Syndrome (C564660)
..expandMorillo-Cucci Passarge syndrome (C536983)
..expandMORM syndrome (C536984)
..expandMowat-Wilson syndrome (C536990)
..expandMuscular Dystrophy, Congenital, associated with Calf Hypertrophy, Microcephaly, and Severe Mental Retardation (C565506)
..expandMuscular Dystrophy, Congenital, plus Mental Retardation (C565505)
..expandMuscular Dystrophy, Congenital, Type 1D (C563844)
..expandMyotonia with Skeletal Abnormalities and Mental Retardation (C564967)
..expandN syndrome (C536108)
..expandNakamura Osame syndrome (C538335)
..expandNeuhauser syndrome (C536143)
..expandNeurofaciodigitorenal syndrome (C537388)
..expandNeurologic Disease, Infantile Multisystem, with Osseous Fragility (C564954)
..expandNF1 Microdeletion Syndrome (C563524)
..expandNF1 Microduplication Syndrome (C567173)
..expandNicolaides Baraitser syndrome (C536116)
..expandOculodigitoesophagoduodenal syndrome (C537734)
..expandOliver Syndrome (C564931)
..expandOliver-McFarlane syndrome (C536554)
..expandOnychotrichodysplasia and neutropenia (C537752)
..expandOphthalmoplegia, Progressive, with Scrotal Tongue and Mental Deficiency (C563498)
..expandOpitz trigonocephaly syndrome (C537418)
..expandOsteolysis syndrome recessive (C536052)
..expandPalant cleft palate syndrome (C538102)
..expandPallister W syndrome (C538106)
..expandParastremmatic dwarfism (C537172)
..expandParkinsonism, early onset with mental retardation (C537179)
..expandPashayan syndrome (C536303)
..expandPatella hypoplasia mental retardation (C536308)
..expandPavone Fiumara Rizzo syndrome (C536313)
..expandPerisylvian syndrome (C536658)
..expandPerniola Krajewska Carnevale syndrome (C536660)
..expandPfeiffer Kapferer syndrome (C537887)
..expandPfeiffer Mayer syndrome (C537888)
..expandPfeiffer Tietze Welte syndrome (C537891)
..expandPilotto syndrome (C537400)
..expandPitt-Hopkins syndrome (C537403)
..expandPiussan Lenaerts Mathieu syndrome (C537511)
..expandPrader-Willi Syndrome (D011218) Child2
..expandPrimrose syndrome (C536420)
..expandProlonged Bleeding Time, Brachydactyly, and Mental Retardation (C564207)
..expandProud Syndrome (C563110)
..expandPrune Belly Syndrome with Pulmonic Stenosis, Mental Retardation, and Deafness (C562894)
..expandPseudoaminopterin syndrome (C535823)
..expandPseudouridinuria and Mental Defect (C564864)
..expandPterygium colli mental retardation digital anomalies (C535831)
..expandQazi Markouizos syndrome (C536259)
..expandRadioulnar synostosis retinal pigment abnormalities (C536270)
..expandRamon Syndrome (C535285)
..expandRamos Arroyo Clark syndrome (C535286)
..expandReardon Wilson Cavanagh syndrome (C535295)
..expandRenal Tubular Acidosis, Proximal, With Ocular Abnormalities And Mental Retardation (C567038)
..expandRetinitis Pigmentosa, Deafness, Mental Retardation, and Hypogonadism (C564841)
..expandRichards-Rundle syndrome (C535674)
..expandRobin Sequence with Distinctive Facial Appearance and Brachydactyly (C563880)
..expandRolandic Epilepsy, Mental Retardation, And Speech Dyspraxia, Autosomal Dominant (C563392)
..expandRolandic Epilepsy, Mental Retardation, and Speech Dyspraxia, X-Linked (C564467)
..expandRubinstein-Taybi Syndrome (D012415) Child2
..expandRud Syndrome (C535878)
..expandRuzicka Goerz Anton syndrome (C537192)
..expandSammartino De Crecchio Syndrome (C537229)
..expandSao Paulo MCA-MR Syndrome (C563119)
..expandScaphocephaly, Maxillary Retrusion, And Mental Retardation (C566511)
..expandSCARF syndrome (C536625)
..expandSchinzel-Giedion syndrome (C536632)
..expandSchofer Beetz Bohl syndrome (C535949)
..expandScholte syndrome (C536638)
..expandSchrander-Stumpel Theunissen Hulsmans syndrome (C536639)
..expandSclerosing bone dysplasia mental retardation (C537523)
..expandScott Bryant Graham syndrome (C537528)
..expandSeckel Syndrome 3 (C563881)
..expandSECKEL SYNDROME 4 (OMIM:613676)
..expandSeemanova Lesny syndrome (C537536)
..expandSeSAME syndrome (C557674)
..expandShort Stature, Mental Retardation, Callosal Agenesis, Heminasal Hypoplasia, Microphthalmia, And Atypical Clefting (C566989)
..expandSimpson-Golabi-Behmel syndrome (C537340)
..expandSingh Chhaparwal Dhanda syndrome (C537341)
..expandSkeletal Defects, Genital Hypoplasia, And Mental Retardation (C567306)
..expandSketetal dysplasia coarse facies mental retardation (C536671)
..expandSpastic Ataxia (C564815)
..expandSpastic diplegia infantile type (C537481)
..expandSpastic paraplegia 14, autosomal recessive (C537486)
..expandSpastic Paraplegia 18, Autosomal Recessive (C567628)
..expandSpastic Paraplegia 32, Autosomal Recessive (C566983)
..expandSpastic paraplegia epilepsy mental retardation (C536869)
..expandSpastic Paraplegia, Ataxia, And Mental Retardation (C564378)
..expandSpastic Paraplegia, Sensorineural Deafness, Mental Retardation, And Progressive Nephropathy (C566682)
..expandSpastic Paresis, Glaucoma, and Mental Retardation (C564809)
..expandSpastic Quadriplegia, Retinitis Pigmentosa, and Mental Retardation (C564808)
..expandSpinal Muscular Atrophy with Mental Retardation (C564807)
..expandSpinal Muscular Atrophy with Microcephaly and Mental Subnormality (C564806)
..expandSpondyloepimetaphyseal dysplasia, Genevieve type (C535785)
..expandSpondyloepiphyseal Dysplasia Tarda with Mental Retardation (C564796)
..expandSpondyloepiphyseal Dysplasia With Coronal Craniosynostosis, Cataracts, Cleft Palate, And Mental Retardation (C566515)
..expandStevenson-Carey Syndrome (C567446)
..expandSucrosuria, Hiatus Hernia and Mental Retardation (C564792)
..expandSUPERNUMERARY DER(22)t(8 (OMIM:613700)
..expandTamari Goodman syndrome (C536896)
..expandTemple-Baraitser Syndrome (C567516)
..expandTemtamy preaxial brachydactyly syndrome (C536958)
..expandTENORIO SYNDROME (OMIM:616260)
..expandTetrasomy X (C536502)
..expandTonoki syndrome (C536967)
..expandTrichodental syndrome (C536551)
..expandTrisomy 13 Syndrome (D000073839)
..expandTryptophanuria With Dwarfism (C562658)
..expandTsukahara Syndrome (C566376)
..expandUlna hypoplasia with mental retardation (C536934)
..expandUlnar Hypoplasia with Mental Retardation (C564757)
..expandUpton Young syndrome (C536473)
..expandVan Bogaert-Hozay syndrome (C536526)
..expandVan Den Bosch Syndrome (C563129)
..expandVan Maldergem Wetzburger Verloes syndrome (C536530)
..expandVasquez Hurst Sotos syndrome (C536533)
..expandVerloes Gillerot Fryns syndrome (C536539)
..expandViljoen Kallis Voges syndrome (C536349)
..expandVitiligo, Progressive, with Mental Retardation and Urethral Duplication (C564739)
..expandVolcke Soekarman syndrome (C537718)
..expandWAGR Syndrome (D017624) Child2
..expandWalker Dyson syndrome (C536568)
..expandWarburg Sjo Fledelius syndrome (C536681)
..expandWarburton Anyane Yeboa syndrome (C536682)
..expandWiedemann Grosse Dibbern syndrome (C536704)
..expandWiedemann Oldigs Oppermann syndrome (C536705)
..expandWilliams Syndrome (D018980) Child1
..expandWinship Viljoen Leary syndrome (C536711)
..expandWoodhouse Sakati syndrome (C536742)
..expandWorster Drought syndrome (C536747)
..expandXIA-GIBBS SYNDROME (OMIM:615829)
..expandYorifuji Okuno syndrome (C536714)
..expandYoung Hughes syndrome (C536715)
..expandYoung Simpson syndrome (C536717)
..expandZazam Sheriff Phillips syndrome (C536723)
..expandZechi-Ceide Syndrome (C567865)
..expandZerres Rietschel Majewski syndrome (C536724)
..expandZlotogora-Ogur syndrome (C536726)
..expandZTTK SYNDROME (OMIM:617140)
..expandZunich neuroectodermal syndrome (C536729)

Human Disease MESH is developed by UMLS.
Further data from MedGen, OMIM,ClinVar, CTD
Term ID:7664
Alternative IDs:DO:DOID:0070073
TreeNumbers:C10.597.606.360/616977 |C23.888.592.604.646/616977 |F03.625.539/616977
Slim Mappings:Mental disorder|Nervous system disease|Signs and symptoms
Reference: MedGen: 616977
MeSH: 616977
OMIM: 616977;
Genes: RYR1;
1 HP:0000006Autosomal dominant inheritance
2 HP:0003593Infantile onset
3 HP:0001999Abnormal facial shape
4 HP:0000739Anxiety
NAMDC:  Anxiety
5 HP:0000729Autistic behavior
6 HP:0002059Cerebral atrophyHP:0040283
7 HP:0002019Constipation
8 HP:0011968Feeding difficulties
9 HP:0002020Gastroesophageal reflux
10 HP:0001290Generalized hypotonia
11 HP:0001263Global developmental delay
NAMDC:  Mental retardation
12 HP:0001263Global developmental delay
NAMDC:  Delayed development (evidence of at least one of A through F)
13 HP:0000752Hyperactivity
14 HP:0002079Hypoplasia of the corpus callosumHP:0040283
15 HP:0100710Impulsivity
16 HP:0001249Intellectual disability
17 HP:0000252MicrocephalyHP:0040283
18 HP:0000160Narrow mouth
19 HP:0000426Prominent nasal bridge
20 HP:0001250Seizures
NAMDC:  Seizures
21 HP:0001182Tapered finger
22 HP:0000431Wide nasal bridge
Disease Causing ClinVar Variants
NM_006734.4(HIVEP2):c.7310A>C (p.Asp2437Ala)3097HIVEP2Uncertain significance-1RCV001198763; NMONDO:MONDO:0014858,MedGen:C4310771,OMIM:6169776143074275143074275TG6:g.143074275T>G-
NM_006734.4(HIVEP2):c.6964C>T (p.Gln2322Ter)3097HIVEP2Pathogenicrs1554274371RCV000624266|RCV001265397; NMeSH:D030342,MedGen:C0950123|MONDO:MONDO:0014858,MedGen:C4310771,OMIM:6169776143074621143074621GA6:g.143074621G>AClinGen:CA365941355
NM_006734.4(HIVEP2):c.6698G>A (p.Gly2233Glu)3097HIVEP2Uncertain significance-1RCV001265391; NMONDO:MONDO:0014858,MedGen:C4310771,OMIM:6169776143074887143074887CT6:g.143074887C>T-
NM_006734.4(HIVEP2):c.6667C>T (p.Arg2223Ter)3097HIVEP2Pathogenicrs1562493608RCV000760589|RCV001265394; NMedGen:CN517202|MONDO:MONDO:0014858,MedGen:C4310771,OMIM:6169776143074918143074918GA6:g.143074918G>A-
NM_006734.4(HIVEP2):c.6475G>T (p.Gly2159Ter)3097HIVEP2Pathogenicrs761993070RCV000225138; NMONDO:MONDO:0014858,MedGen:C4310771,OMIM:6169776143080950143080950CA6:g.143080950C>AClinGen:CA358397,OMIM:143054.0004
NM_006734.4(HIVEP2):c.5935C>T (p.Arg1979Ter)3097HIVEP2Pathogenicrs1554275163RCV000627217|RCV000852329|RCV001265390; NMedGen:CN517202|MedGen:CN128785|MONDO:MONDO:0014858,MedGen:C4310771,OMIM:6169776143081490143081490GA6:g.143081490G>AClinGen:CA365888263
NM_006734.4(HIVEP2):c.5900del (p.Ser1967fs)3097HIVEP2Pathogenicrs1064796034RCV000484419|RCV001265253; NMedGen:CN517202|MONDO:MONDO:0014858,MedGen:C4310771,OMIM:6169776143081525143081525CGC6:g.143081525_143081525delClinGen:CA16618248CN517202 not provided;
NM_006734.4(HIVEP2):c.5737del (p.Asp1913fs)3097HIVEP2Pathogenicrs878853251RCV000225131; NMONDO:MONDO:0014858,MedGen:C4310771,OMIM:6169776143081688143081688TCT6:g.143081688_143081688delClinGen:CA10581566,OMIM:143054.0001
NM_006734.4(HIVEP2):c.5686C>T (p.Gln1896Ter)3097HIVEP2Pathogenic-1RCV001265252; NMONDO:MONDO:0014858,MedGen:C4310771,OMIM:6169776143081739143081739GA6:g.143081739G>A-
NM_006734.4(HIVEP2):c.5620+1GT[2]3097HIVEP2Likely pathogenic-1RCV001265143; NMONDO:MONDO:0014858,MedGen:C4310771,OMIM:6169776143082595143082596TACT6:g.143082595_143082596del-
NM_006734.4(HIVEP2):c.5614dup (p.Glu1872fs)3097HIVEP2Pathogenicrs869312844RCV000210364|RCV000225303; NMedGen:CN517202|MONDO:MONDO:0014858,MedGen:C4310771,OMIM:6169776143082606143082607TTC6:g.143082606_143082607insCClinGen:CA358391,OMIM:143054.0006
NM_006734.4(HIVEP2):c.4781T>A (p.Leu1594Gln)3097HIVEP2Uncertain significance-1RCV001199115; NMONDO:MONDO:0014858,MedGen:C4310771,OMIM:6169776143091095143091095AT6:g.143091095A>T-
NM_006734.4(HIVEP2):c.4144G>A (p.Ala1382Thr)3097HIVEP2Uncertain significance-1RCV001265393; NMONDO:MONDO:0014858,MedGen:C4310771,OMIM:6169776143091732143091732CT6:g.143091732C>T-
NM_006734.4(HIVEP2):c.3742C>T (p.Gln1248Ter)3097HIVEP2Pathogenicrs1562505335RCV000760623|RCV001265392; NMedGen:CN517202|MONDO:MONDO:0014858,MedGen:C4310771,OMIM:6169776143092134143092134GA6:g.143092134G>A-
NM_006734.4(HIVEP2):c.3730A>G (p.Lys1244Glu)3097HIVEP2Uncertain significance-1RCV001198508; NMONDO:MONDO:0014858,MedGen:C4310771,OMIM:6169776143092146143092146TC6:g.143092146T>C-
NM_006734.4(HIVEP2):c.3556C>T (p.Gln1186Ter)3097HIVEP2Pathogenicrs878853269RCV000225329; NMONDO:MONDO:0014858,MedGen:C4310771,OMIM:6169776143092320143092320GA6:g.143092320G>AClinGen:CA10581567,OMIM:143054.0003
NM_006734.4(HIVEP2):c.3461_3492dup (p.Glu1165fs)3097HIVEP2Pathogenicrs1562505675RCV000760261; NMONDO:MONDO:0014858,MedGen:C4310771,OMIM:6169776143092383143092384CCCTGACTGTCCATGTGCATGATCTGTGGCTGGG6:g.143092383_143092384insCTGACTGTCCATGTGCATGATCTGTGGCTGGG-
NM_006734.4(HIVEP2):c.3064C>T (p.His1022Tyr)3097HIVEP2Uncertain significance-1RCV001262608; NMONDO:MONDO:0014858,MedGen:C4310771,OMIM:6169776143092812143092812GA6:g.143092812G>A-
NM_006734.4(HIVEP2):c.2905C>T (p.Gln969Ter)3097HIVEP2Pathogenicrs869312842RCV000210362|RCV001265398; NMedGen:CN517202|MONDO:MONDO:0014858,MedGen:C4310771,OMIM:6169776143092971143092971GA6:g.143092971G>AClinGen:CA358389CN517202 not provided;
NM_006734.4(HIVEP2):c.2857G>T (p.Glu953Ter)3097HIVEP2Pathogenicrs869312843RCV000225219; NMONDO:MONDO:0014858,MedGen:C4310771,OMIM:6169776143093019143093019CA6:g.143093019C>AClinGen:CA358406,OMIM:143054.0005
NM_006734.4(HIVEP2):c.2827C>T (p.Arg943Ter)3097HIVEP2Pathogenicrs869312841RCV000225218|RCV001092448; NMONDO:MONDO:0014858,MedGen:C4310771,OMIM:616977|MedGen:CN5172026143093049143093049GA6:g.143093049G>AClinGen:CA358404,OMIM:143054.0002C4310771 616977 Mental retardation, autosomal dominant 43;
NM_006734.4(HIVEP2):c.1505C>G (p.Ser502Cys)3097HIVEP2Uncertain significance-1RCV001196367; NMONDO:MONDO:0014858,MedGen:C4310771,OMIM:6169776143094371143094371GC6:g.143094371G>C-
NM_006734.4(HIVEP2):c.1339C>T (p.Arg447Cys)3097HIVEP2Likely benign-1RCV001262633; NMONDO:MONDO:0014858,MedGen:C4310771,OMIM:6169776143094537143094537GA6:g.143094537G>A-
NM_006734.4(HIVEP2):c.1189G>T (p.Asp397Tyr)3097HIVEP2Likely pathogenicrs869312847RCV000210365|RCV000509366|RCV001265396; NMedGen:CN517202||MONDO:MONDO:0014858,MedGen:C4310771,OMIM:6169776143094687143094687CA6:g.143094687C>AClinGen:CA358392
NM_006734.4(HIVEP2):c.601C>A (p.Pro201Thr)3097HIVEP2Uncertain significance-1RCV001197149; NMONDO:MONDO:0014858,MedGen:C4310771,OMIM:6169776143095275143095275GT6:g.143095275G>T-
MSeqDR Portal