MSeqDR Mitochondrial Disease Portal


 
*:HP: HPO terms, UMDF: 1= Disease, ND: NAMDC terms.
  Most Studied  CPEO, Complex I Deficiency, COXPD1, Leigh, LHON, MELAS, MERRF, Myopathy, SANDO
Disease Browser
Parent Node:
expand
Cowden-Like Syndrome (C567337)
Parent Node:
expand
Diseases (C)
..Starting node
..expand
COWDEN SYNDROME 6 (OMIM:615109)

       Child Nodes:



 Sister Nodes: 
..expand3-METHYLGLUTACONIC ACIDURIA WITH CATARACTS, NEUROLOGIC INVOLVEMENT, AND NEUTROPENIA (OMIM:616271)
..expand3-METHYLGLUTACONIC ACIDURIA WITH DEAFNESS, ENCEPHALOPATHY, AND LEIGH-LIKE SYNDROME (OMIM:614739)  LSDB  L: 00484;
..expand3-METHYLGLUTACONIC ACIDURIA, TYPE VIII (OMIM:617248)
..expandAARSKOG SYNDROME, AUTOSOMAL DOMINANT (OMIM:100050)
..expandABDOMINAL OBESITY-METABOLIC SYNDROME 1 (OMIM:605552)
..expandABDOMINAL OBESITY-METABOLIC SYNDROME 3 (OMIM:615812)
..expandACROMESOMELIC DYSPLASIA, HUNTER-THOMPSON TYPE (OMIM:201250)
..expandALACRIMA, ACHALASIA, AND MENTAL RETARDATION SYNDROME (OMIM:615510)
..expandANEMIA, NONSPHEROCYTIC HEMOLYTIC, DUE TO G6PD DEFICIENCY (OMIM:300908)
..expandAnimal Diseases (D000820) Child139
..expandARTHROGRYPOSIS MULTIPLEX CONGENITA, NEUROGENIC, WITH MYELIN DEFECT (OMIM:617468)
..expandASPLENIA, ISOLATED CONGENITAL (OMIM:271400)
..expandATRIAL SEPTAL DEFECT 7 WITH OR WITHOUT ATRIOVENTRICULAR CONDUCTION DEFECTS (OMIM:108900)
..expandAXENFELD-RIEGER SYNDROME, TYPE 1 (OMIM:180500)
..expandAXENFELD-RIEGER SYNDROME, TYPE 2 (OMIM:601499)
..expandAXENFELD-RIEGER SYNDROME, TYPE 3 (OMIM:602482)
..expandB-CELL EXPANSION WITH NFKB AND T-CELL ANERGY (OMIM:616452)
..expandBacterial Infections and Mycoses (D001423) Child620
..expandBARAITSER-WINTER SYNDROME 1 (OMIM:243310)
..expandBARAITSER-WINTER SYNDROME 2 (OMIM:614583)
..expandBRACHYDACTYLY, TYPE E1 (OMIM:113300)
..expandBREASTS AND/OR NIPPLES, APLASIA OR HYPOPLASIA OF, 2 (OMIM:616001)
..expandCAPILLARY MALFORMATIONS, CONGENITAL (OMIM:163000)
..expandCardiovascular Diseases (D002318) Child1025  LSDB C:12
..expandCATEL-MANZKE SYNDROME (OMIM:616145)
..expandCEREBELLAR ATROPHY, VISUAL IMPAIRMENT, AND PSYCHOMOTOR RETARDATION (OMIM:616875)
..expandCHARCOT-MARIE-TOOTH DISEASE, AXONAL, WITH VOCAL CORD PARESIS, AUTOSOMAL RECESSIVE (OMIM:607706)
..expandChemically-Induced Disorders (D064419) Child111  LSDB C:1
..expandCHROMOSOME 13q14 DELETION SYNDROME (OMIM:613884)
..expandCHROMOSOME 16p12.1 DELETION SYNDROME, 520-KB (OMIM:136570)
..expandCHROMOSOME 17p13.1 DELETION SYNDROME (OMIM:613776)
..expandCHROMOSOME 8q21.11 DELETION SYNDROME (OMIM:614230)
..expandCOENZYME Q10 DEFICIENCY, PRIMARY, 1 (OMIM:607426)  LSDB  L: 00090;
..expandCOENZYME Q10 DEFICIENCY, PRIMARY, 2 (OMIM:614651)  LSDB  L: 00446;
..expandCOENZYME Q10 DEFICIENCY, PRIMARY, 3 (OMIM:614652)  LSDB  L: 00447;
..expandCOENZYME Q10 DEFICIENCY, PRIMARY, 4 (OMIM:612016)  LSDB  L: 00443;
..expandCOENZYME Q10 DEFICIENCY, PRIMARY, 5 (OMIM:614654)  LSDB  L: 00448;
..expandCOENZYME Q10 DEFICIENCY, PRIMARY, 6 (OMIM:614650)  LSDB  L: 00480;
..expandCOENZYME Q10 DEFICIENCY, PRIMARY, 7 (OMIM:616276)  LSDB  L: 00639;
..expandCOENZYME Q10 DEFICIENCY, PRIMARY, 8 (OMIM:616733)  LSDB  L: 00640;
..expandCongenital, Hereditary, and Neonatal Diseases and Abnormalities (D009358) Child4904  LSDB C:68
..expandCONOTRUNCAL HEART MALFORMATIONS (OMIM:217095)
..expandCOUSIN SYNDROME (OMIM:260660)
..expandCOWDEN SYNDROME 4 (OMIM:615107)
..expandCOWDEN SYNDROME 5 (OMIM:615108)
..expandCOWDEN SYNDROME 6 (OMIM:615109)
..expandCOWDEN SYNDROME 7 (OMIM:616858)
..expandCRANIOFACIAL ANOMALIES AND ANTERIOR SEGMENT DYSGENESIS SYNDROME (OMIM:614195)
..expandCUTIS LAXA, AUTOSOMAL RECESSIVE, TYPE IA (OMIM:219100)
..expandCUTIS LAXA, AUTOSOMAL RECESSIVE, TYPE IB (OMIM:614437)
..expandCUTIS LAXA, AUTOSOMAL RECESSIVE, TYPE IIC (OMIM:617402)
..expandCUTIS LAXA, AUTOSOMAL RECESSIVE, TYPE IID (OMIM:617403)
..expandCUTIS LAXA, AUTOSOMAL RECESSIVE, TYPE IIIA (OMIM:219150)
..expandCUTIS LAXA, AUTOSOMAL RECESSIVE, TYPE IIIB (OMIM:614438)
..expandD-BIFUNCTIONAL PROTEIN DEFICIENCY (OMIM:261515)
..expandDEAFNESS, AUTOSOMAL RECESSIVE 101 (OMIM:615837)
..expandDEAFNESS, AUTOSOMAL RECESSIVE 18A (OMIM:602092)
..expandDEAFNESS, AUTOSOMAL RECESSIVE 26, MODIFIER OF (OMIM:605429)
..expandDEAFNESS, AUTOSOMAL RECESSIVE 36, WITH OR WITHOUT VESTIBULAR INVOLVEMENT;DFNB36 DEAFNESS, AUTOSOMAL DOMINANT, WITHOUT VESTIBULAR INVOLVEMENT, (OMIM:609006)
..expandDEAFNESS, AUTOSOMAL RECESSIVE 8 (OMIM:601072)
..expandDigestive System Diseases (D004066) Child640  LSDB C:9
..expandDisorders of Environmental Origin (D007280) Child4
..expandDYSKERATOSIS CONGENITA, AUTOSOMAL DOMINANT 2 (OMIM:613989)
..expandDYSKERATOSIS CONGENITA, AUTOSOMAL DOMINANT 3 (OMIM:613990)
..expandDYSKERATOSIS CONGENITA, AUTOSOMAL DOMINANT 6 (OMIM:616553)
..expandDYSKERATOSIS CONGENITA, AUTOSOMAL RECESSIVE 2 (OMIM:613987)
..expandDYSKERATOSIS CONGENITA, AUTOSOMAL RECESSIVE 3 (OMIM:613988)
..expandDYSKERATOSIS CONGENITA, AUTOSOMAL RECESSIVE 5 (OMIM:615190)
..expandDYSKERATOSIS CONGENITA, AUTOSOMAL RECESSIVE 6 (OMIM:616353)
..expandECTOPIA LENTIS 1, ISOLATED, AUTOSOMAL DOMINANT (OMIM:129600)
..expandECTOPIA LENTIS 2, ISOLATED, AUTOSOMAL RECESSIVE (OMIM:225100)
..expandEHLERS-DANLOS SYNDROME, KYPHOSCOLIOTIC TYPE, 2 (OMIM:614557)
..expandEndocrine System Diseases (D004700) Child742  LSDB C:3
..expandEye Diseases (D005128) Child1278  LSDB C:19
..expandFemale Urogenital Diseases and Pregnancy Complications (D005261) Child962  LSDB C:4
..expandGLUT1 DEFICIENCY SYNDROME 2 (OMIM:612126)
..expandGOITER, MULTINODULAR 1, WITH OR WITHOUT SERTOLI-LEYDIG CELL TUMORS (OMIM:138800)
..expandGREENBERG DYSPLASIA (OMIM:215140)
..expandHemic and Lymphatic Diseases (D006425) Child790  LSDB C:1
..expandHYDROPS, LACTIC ACIDOSIS, AND SIDEROBLASTIC ANEMIA (OMIM:617021)
..expandHYPERMANGANESEMIA WITH DYSTONIA 1 (OMIM:613280)
..expandHYPERMANGANESEMIA WITH DYSTONIA 2 (OMIM:617013)
..expandHYPERMETHIONINEMIA DUE TO ADENOSINE KINASE DEFICIENCY (OMIM:614300)
..expandHYPERPHOSPHATASIA WITH MENTAL RETARDATION SYNDROME 3 (OMIM:614207)
..expandHYPERPIGMENTATION WITH OR WITHOUT HYPOPIGMENTATION, FAMILIAL PROGRESSIVE (OMIM:145250)
..expandHYPOINSULINEMIC HYPOGLYCEMIA WITH HEMIHYPERTROPHY (OMIM:240900)
..expandHYPOTRICHOSIS 2 (OMIM:146520)
..expandHYPOTRICHOSIS-LYMPHEDEMA-TELANGIECTASIA-RENAL DEFECT SYNDROME (OMIM:137940)
..expandImmune System Diseases (D007154) Child597  LSDB C:2
..expandIMMUNODEFICIENCY-CENTROMERIC INSTABILITY-FACIAL ANOMALIES SYNDROME 1 (OMIM:242860)
..expandIMMUNODEFICIENCY-CENTROMERIC INSTABILITY-FACIAL ANOMALIES SYNDROME 2 (OMIM:614069)
..expandIMMUNODEFICIENCY-CENTROMERIC INSTABILITY-FACIAL ANOMALIES SYNDROME 3 (OMIM:616910)
..expandIMMUNODEFICIENCY-CENTROMERIC INSTABILITY-FACIAL ANOMALIES SYNDROME 4 (OMIM:616911)
..expandKERATOSIS PILARIS ATROPHICANS (OMIM:604093)
..expandKLIPPEL-FEIL SYNDROME 3, AUTOSOMAL DOMINANT (OMIM:613702)
..expandL-FERRITIN DEFICIENCY (OMIM:615604)
..expandLISSENCEPHALY 7 WITH CEREBELLAR HYPOPLASIA (OMIM:616342)
..expandLOEYS-DIETZ SYNDROME 2 (OMIM:610168)
..expandMACULAR DEGENERATION, X-LINKED ATROPHIC (OMIM:300834)
..expandMale Urogenital Diseases (D052801) Child765  LSDB C:4
..expandMAYER-ROKITANSKY-KUSTER-HAUSER SYNDROME (OMIM:277000)
..expandMEGALENCEPHALIC LEUKOENCEPHALOPATHY WITH SUBCORTICAL CYSTS 2B, REMITTING, WITH OR WITHOUT MENTAL RETARDATION (OMIM:613926)
..expandMEGALOBLASTIC ANEMIA 1 (OMIM:261100)
..expandMELANOMA, CUTANEOUS MALIGNANT, SUSCEPTIBILITY TO, 1 (OMIM:155600)
..expandMELANOMA, CUTANEOUS MALIGNANT, SUSCEPTIBILITY TO, 10 (OMIM:615848)
..expandMELANOMA, CUTANEOUS MALIGNANT, SUSCEPTIBILITY TO, 2 (OMIM:155601)
..expandMELANOMA, CUTANEOUS MALIGNANT, SUSCEPTIBILITY TO, 3 (OMIM:609048)
..expandMELANOMA, CUTANEOUS MALIGNANT, SUSCEPTIBILITY TO, 4 (OMIM:608035)
..expandMELANOMA, CUTANEOUS MALIGNANT, SUSCEPTIBILITY TO, 5 (OMIM:613099)
..expandMELANOMA, CUTANEOUS MALIGNANT, SUSCEPTIBILITY TO, 6 (OMIM:613972)
..expandMELANOMA, CUTANEOUS MALIGNANT, SUSCEPTIBILITY TO, 7 (OMIM:612263)
..expandMELANOMA, CUTANEOUS MALIGNANT, SUSCEPTIBILITY TO, 8 (OMIM:614456)
..expandMELANOMA, CUTANEOUS MALIGNANT, SUSCEPTIBILITY TO, 9 (OMIM:615134)
..expandMental Disorders (D001523) Child1080  LSDB C:11
..expandMENTAL RETARDATION, X-LINKED, SYNDROMIC, CABEZAS TYPE (OMIM:300354)
..expandMETHYLMALONIC ACIDURIA, TRANSIENT, DUE TO TRANSCOBALAMIN RECEPTOR DEFECT (OMIM:613646)
..expandMICROCEPHALY WITH OR WITHOUT CHORIORETINOPATHY, LYMPHEDEMA, OR MENTAL RETARDATION (OMIM:152950)
..expandMICROCEPHALY, PROGRESSIVE, WITH SEIZURES AND CEREBRAL AND CEREBELLAR ATROPHY (OMIM:615760)
..expandMICROCORNEA, MYOPIC CHORIORETINAL ATROPHY, AND TELECANTHUS (OMIM:615458)
..expandMICROSPHEROPHAKIA AND/OR MEGALOCORNEA, WITH ECTOPIA LENTIS AND WITH OR WITHOUT SECONDARY GLAUCOMA (OMIM:251750)
..expandMITOCHONDRIAL COMPLEX III DEFICIENCY, NUCLEAR TYPE 1 (OMIM:124000)  LSDB  L: 00017;
..expandMITOCHONDRIAL DNA DEPLETION SYNDROME 1 (MNGIE TYPE) (OMIM:603041)  LSDB  L: 00026;
..expandMITOCHONDRIAL DNA DEPLETION SYNDROME 2 (MYOPATHIC TYPE) (OMIM:609560)  LSDB  L: 00030;
..expandMITOCHONDRIAL DNA DEPLETION SYNDROME 4B (MNGIE TYPE) (OMIM:613662)  LSDB  L: 00033;
..expandMITOCHONDRIAL DNA DEPLETION SYNDROME 7 (HEPATOCEREBRAL TYPE) (OMIM:271245)  LSDB  L: 00036;
..expandMITOCHONDRIAL DNA DEPLETION SYNDROME 9 (ENCEPHALOMYOPATHIC TYPE WITH METHYLMALONIC ACIDURIA) (OMIM:245400)  LSDB  L: 00038;
..expandMUCOLIPIDOSIS II ALPHA/BETA (OMIM:252500)
..expandMUCOLIPIDOSIS III ALPHA/BETA (OMIM:252600)
..expandMULTICENTRIC CARPOTARSAL OSTEOLYSIS SYNDROME (OMIM:166300)
..expandMULTIPLE JOINT DISLOCATIONS, SHORT STATURE, AND CRANIOFACIAL DYSMORPHISM WITH OR WITHOUT CONGENITAL HEART DEFECTS (OMIM:245600)
..expandMULTIPLE MITOCHONDRIAL DYSFUNCTIONS SYNDROME 2 WITH HYPERGLYCINEMIA (OMIM:614299)  LSDB  L: 00044;
..expandMULTIPLE PTERYGIUM SYNDROME, LETHAL TYPE (OMIM:253290)
..expandMULTIPLE SYNOSTOSES SYNDROME 1 (OMIM:186500)
..expandMusculoskeletal Diseases (D009140) Child2320  LSDB C:37
..expandMYCOBACTERIUM TUBERCULOSIS, SUSCEPTIBILITY TO (OMIM:607948)
..expandMYCOBACTERIUM TUBERCULOSIS, SUSCEPTIBILITY TO, 1 (OMIM:607949)
..expandMYCOBACTERIUM TUBERCULOSIS, SUSCEPTIBILITY TO, 2 (OMIM:611046)
..expandMYCOBACTERIUM TUBERCULOSIS, SUSCEPTIBILITY TO, 3 (OMIM:612929)
..expandMYCOBACTERIUM TUBERCULOSIS, SUSCEPTIBILITY TO, X-LINKED (OMIM:300259)
..expandMYOPATHY DUE TO MYOADENYLATE DEAMINASE DEFICIENCY (OMIM:615511)
..expandMYOPATHY, MYOFIBRILLAR, FATAL INFANTILE HYPERTONIC, ALPHA-B CRYSTALLIN-RELATED (OMIM:613869)
..expandMYOPATHY, SPHEROID BODY (OMIM:182920)
..expandMYOPATHY, VACUOLAR, WITH CASQ1 AGGREGATES (OMIM:616231)
..expandNAIL DISORDER, NONSYNDROMIC CONGENITAL, 3 (OMIM:151600)
..expandNEMALINE MYOPATHY 3;NEM3 MYOPATHY, ACTIN, CONGENITAL, WITH EXCESS OF THIN MYOFILAMENTS, (OMIM:161800)
..expandNeoplasms (D009369) Child1125  LSDB C:1
..expandNEPHROTIC SYNDROME, TYPE 5, WITH OR WITHOUT OCULAR ABNORMALITIES (OMIM:614199)
..expandNervous System Diseases (D009422) Child3641  LSDB C:86
..expandNESTOR-GUILLERMO PROGERIA SYNDROME (OMIM:614008)
..expandNEURODEGENERATION WITH BRAIN IRON ACCUMULATION 2A (OMIM:256600)
..expandNEURODEGENERATION WITH BRAIN IRON ACCUMULATION 4 (OMIM:614298)  LSDB  L: 00422;
..expandNEURODEGENERATION WITH BRAIN IRON ACCUMULATION 5 (OMIM:300894)
..expandNEURODEGENERATION WITH BRAIN IRON ACCUMULATION 6 (OMIM:615643)
..expandNOONAN SYNDROME-LIKE DISORDER WITH LOOSE ANAGEN HAIR 1 (OMIM:607721)
..expandNOONAN SYNDROME-LIKE DISORDER WITH OR WITHOUT JUVENILE MYELOMONOCYTIC LEUKEMIA (OMIM:613563)
..expandNutritional and Metabolic Diseases (D009750) Child1518  LSDB C:92
..expandOccupational Diseases (D009784) Child28
..expandOGDEN SYNDROME (OMIM:300855)
..expandOtorhinolaryngologic Diseases (D010038) Child602  LSDB C:11
..expandOTOSPONDYLOMEGAEPIPHYSEAL DYSPLASIA, AUTOSOMAL RECESSIVE (OMIM:215150)
..expandPALMOPLANTAR KERATODERMA AND WOOLLY HAIR (OMIM:616099)
..expandPALMOPLANTAR KERATODERMA, NONEPIDERMOLYTIC, FOCAL 1 (OMIM:613000)
..expandPALMOPLANTAR KERATODERMA, NONEPIDERMOLYTIC, FOCAL 2 (OMIM:616400)
..expandPALMOPLANTAR KERATODERMA, NONEPIDERMOLYTIC, FOCAL OR DIFFUSE (OMIM:615735)
..expandParasitic Diseases (D010272) Child178
..expandPathological Conditions, Signs and Symptoms (D013568) Child3149  LSDB C:40
..expandPITT-HOPKINS-LIKE SYNDROME 2 (OMIM:614325)
..expandPOLYDACTYLY, PREAXIAL II (OMIM:174500)
..expandPONTOCEREBELLAR HYPOPLASIA, TYPE 10 (OMIM:615803)
..expandPONTOCEREBELLAR HYPOPLASIA, TYPE 1B (OMIM:614678)
..expandPONTOCEREBELLAR HYPOPLASIA, TYPE 1C (OMIM:616081)
..expandPONTOCEREBELLAR HYPOPLASIA, TYPE 2D (OMIM:613811)
..expandPONTOCEREBELLAR HYPOPLASIA, TYPE 2E (OMIM:615851)
..expandPONTOCEREBELLAR HYPOPLASIA, TYPE 2F (OMIM:617026)
..expandPONTOCEREBELLAR HYPOPLASIA, TYPE 4 (OMIM:225753)
..expandPONTOCEREBELLAR HYPOPLASIA, TYPE 7 (OMIM:614969)
..expandPONTOCEREBELLAR HYPOPLASIA, TYPE 8 (OMIM:614961)
..expandPONTOCEREBELLAR HYPOPLASIA, TYPE 9 (OMIM:615809)
..expandPROGRESSIVE FAMILIAL HEART BLOCK, TYPE IA (OMIM:113900)
..expandPSEUDO-TORCH SYNDROME 1 (OMIM:251290)
..expandPSEUDOHYPOPARATHYROIDISM, TYPE IA (OMIM:103580)
..expandRENAL TUBULAR DYSGENESIS (OMIM:267430)
..expandRespiratory Tract Diseases (D012140) Child422
..expandSCAPULOPERONEAL MYOPATHY, MYH7-RELATED (OMIM:181430)
..expandSHORT STATURE AND ADVANCED BONE AGE, WITH OR WITHOUT EARLY-ONSET OSTEOARTHRITIS AND/OR OSTEOCHONDRITIS DISSECANS (OMIM:165800)
..expandSkin and Connective Tissue Diseases (D017437) Child1491  LSDB C:2
..expandSPASTIC ATAXIA 4, AUTOSOMAL RECESSIVE (OMIM:613672)  LSDB  L: 00083;
..expandSPASTIC ATAXIA 5, AUTOSOMAL RECESSIVE (OMIM:614487)
..expandSPLIT-HAND/FOOT MALFORMATION 3 (OMIM:246560)
..expandSPONDYLOEPIMETAPHYSEAL DYSPLASIA WITH JOINT LAXITY, TYPE 1, WITH OR WITHOUT FRACTURES (OMIM:271640)
..expandSPONDYLOEPIPHYSEAL DYSPLASIA WITH CONGENITAL JOINT DISLOCATIONS (OMIM:143095)
..expandStomatognathic Diseases (D009057) Child594
..expandTHROMBOCYTOPENIA, ANEMIA, AND MYELOFIBROSIS (OMIM:617441)
..expandTHROMBOPHILIA DUE TO PROTEIN C DEFICIENCY, AUTOSOMAL RECESSIVE (OMIM:612304)
..expandVAN DER WOUDE SYNDROME 1, MODIFIER OF (OMIM:604547)
..expandVENTRICULAR TACHYCARDIA, CATECHOLAMINERGIC POLYMORPHIC, 1, WITH OR WITHOUT ATRIAL DYSFUNCTION AND/OR DILATED CARDIOMYOPATHY (OMIM:604772)
..expandVENTRICULAR TACHYCARDIA, CATECHOLAMINERGIC POLYMORPHIC, 5, WITH OR WITHOUT MUSCLE WEAKNESS (OMIM:615441)
..expandVirus Diseases (D014777) Child307
..expandVISCERAL MYOPATHY (OMIM:155310)
..expandWAARDENBURG SYNDROME, TYPE 4A (OMIM:277580)
..expandWIEDEMANN-STEINER SYNDROME (OMIM:605130)
..expandWITTEVEEN-KOLK SYNDROME (OMIM:613406)
..expandWOOLLY HAIR, AUTOSOMAL DOMINANT (OMIM:194300)
..expandWounds and Injuries (D014947) Child274
   

Human Disease MESH is developed by UMLS.
Further data from MedGen, OMIM,ClinVar, CTD
Term ID:3101
Name:COWDEN SYNDROME 6
Definition:
Alternative IDs:DO:DOID:6457
ParentIDs:MESH:C567337
TreeNumbers:C04.445.435/C567337/615109 |C04.651.435/C567337/615109 |C04.700.435/C567337/615109 |C16.320.700.435/C567337/615109 |C18.452.660/C567337/615109
Synonyms:CWS6
Slim Mappings:Cancer|Genetic disease (inborn)|Metabolic disease
Reference: MedGen: 615109
MeSH: 615109
OMIM: 615109;
MSeqDR LSDB:  
Genes: AKT1;
Phenotypes
1 HP:0000006Autosomal dominant inheritance
2 HP:0003581Adult onset
3 HP:0001626Abnormality of the cardiovascular system
NAMDC:  Cardiac:Maybe HP:0001626
4 HP:0001102Angioid streaks of the fundus
5 HP:0003002Breast carcinoma
6 HP:0000518Cataract
NAMDC:  Cataracts
7 HP:0002253Colonic diverticula
8 HP:0010619Fibroadenoma of the breast
9 HP:0000221Furrowed tongue
10 HP:0000853Goiter
11 HP:0000771Gynecomastia
12 HP:0004390Hamartomatous polyposis
13 HP:0000365Hearing impairment
14 HP:0000218High palate
15 HP:0000034Hydrocele testis
16 HP:0000836Hyperthyroidism
17 HP:0000327Hypoplasia of the maxilla
18 HP:0000821Hypothyroidism
NAMDC:  Hypothyroidism
19 HP:0001249Intellectual disabilityHP:0040284
20 HP:0001256Intellectual disability, mildHP:0040284
21 HP:0002080Intention tremor
22 HP:0002808Kyphosis
23 HP:0002858Meningioma
24 HP:0000347Micrognathia
25 HP:0000545Myopia
26 HP:0000160Narrow mouth
27 HP:0000138Ovarian cyst
28 HP:0000972Palmoplantar hyperkeratosis
29 HP:0000767Pectus excavatum
30 HP:0004481Progressive macrocephaly
31 HP:0002650Scoliosis
32 HP:0001250Seizures
NAMDC:  Seizures
33 HP:0010609Skin tags
34 HP:0001031Subcutaneous lipoma
35 HP:0000854Thyroid adenoma
36 HP:0100646Thyroiditis
37 HP:0006740Transitional cell carcinoma of the bladder
38 HP:0012871Varicocele
Disease Causing ClinVar Variants
Variation_NameGeneIDGeneSymbolClinicalSignificancedbSNPRCVaccessionTestedInGTRPhenotypeIDsChromosomeStartStopHGVS_cHGVS_pHGVS_gOtherIDsDisease_ClinVar
NM_001382430.1(AKT1):c.1440C>G (p.Ala480=)207AKT1Uncertain significancers1892307322RCV001307428; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105236681105236681GC105236681-
NM_001382430.1(AKT1):c.1437G>A (p.Thr479=)207AKT1Likely benign-1RCV001458272; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105236684105236684CT105236684-
NM_001382430.1(AKT1):c.1437G>T (p.Thr479=)207AKT1Likely benign-1RCV002182997; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105236684105236684CA105236684-
NM_001382430.1(AKT1):c.1436C>T (p.Thr479Met)207AKT1Uncertain significancers201291259RCV001303882; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105236685105236685GA105236685-
NM_001382430.1(AKT1):c.1432G>A (p.Gly478Ser)207AKT1Uncertain significancers1205616929RCV000697095; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105236689105236689CT14:g.105236689C>T-C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.1431C>T (p.Ser477=)207AKT1Likely benignrs200213561RCV000233871; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105236690105236690GA14:g.105236690G>AClinGen:CA7374435C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.1419C>G (p.Ser473=)207AKT1Likely benign-1RCV001495006; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105236702105236702GC105236702-
NM_001382430.1(AKT1):c.1416C>T (p.Phe472=)207AKT1Likely benignrs184263655RCV000867671; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105236705105236705GA14:g.105236705G>A-
NM_001382430.1(AKT1):c.1394G>A (p.Arg465His)207AKT1Uncertain significancers113547523RCV000205643|RCV001762445; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:201|MONDO:MONDO:0016419,MedGen:C0346153,OMIM:114480, Orphanet:22753514105236727105236727CT14:g.105236727C>TClinGen:CA349773C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.1393C>T (p.Arg465Cys)207AKT1Uncertain significancers770370100RCV001317986; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105236728105236728GA105236728-
NM_001382430.1(AKT1):c.1390G>A (p.Glu464Lys)207AKT1Uncertain significancers745803788RCV000709350; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105236731105236731CT14:g.105236731C>T-C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.1389C>T (p.Ser463=)207AKT1Benignrs144112075RCV000228204; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105236732105236732GA14:g.105236732G>AClinGen:CA7374442C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.1383G>A (p.Val461=)207AKT1Likely benign-1RCV002215400; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105236738105236738CT105236738-
NM_001382430.1(AKT1):c.1380T>C (p.Cys460=)207AKT1Likely benignrs139394285RCV000234633; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105236741105236741AG14:g.105236741A>GClinGen:CA7374446C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.1373T>C (p.Met458Thr)207AKT1Uncertain significancers587778018RCV000119958|RCV000464381; NMedGen:CN169374|MONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105236748105236748AG14:g.105236748A>GClinGen:CA156572C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.1372A>G (p.Met458Val)207AKT1Uncertain significancers1360782672RCV001344733; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105236749105236749TC105236749-
NM_001382430.1(AKT1):c.1364-10A>G207AKT1Likely benignrs755530413RCV000863245; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105236767105236767TC14:g.105236767T>C-
NM_001382430.1(AKT1):c.1364-11del207AKT1Benign-1RCV002116054; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105236768105236768TAT105236767-
NM_001382430.1(AKT1):c.1363+12C>T207AKT1Benign-1RCV002124628; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105237070105237070GA105237070-
NM_001382430.1(AKT1):c.1363+9C>T207AKT1Likely benignrs926451222RCV000871984|RCV001437154; NMedGen:CN517202|MONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105237073105237073GA14:g.105237073G>A-
NM_001382430.1(AKT1):c.1361A>G (p.Gln454Arg)207AKT1Uncertain significancers759702315RCV000651046; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105237084105237084TC14:g.105237084T>CClinGen:CA7374469C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.1351C>T (p.Pro451Ser)207AKT1Uncertain significancers1892340313RCV001333360; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105237094105237094GA105237094-
NM_001382430.1(AKT1):c.1341C>A (p.Ile447=)207AKT1Likely benignrs1060504820RCV000476055|RCV001469687; NMedGen:CN517202|MONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105237104105237104GTNC_000014.8:g.105237104G>TClinGen:CA16614104C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.1338G>T (p.Met446Ile)207AKT1Uncertain significance-1RCV001899979; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105237107105237107CA105237107-
NM_001382430.1(AKT1):c.1329G>A (p.Thr443=)207AKT1Likely benignrs376893212RCV000230643; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105237116105237116CT14:g.105237116C>TClinGen:CA7374475C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.1320G>T (p.Glu440Asp)207AKT1Uncertain significancers1159942120RCV000538250; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105237125105237125CA14:g.105237125C>AClinGen:CA391214538C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.1303A>C (p.Thr435Pro)207AKT1Pathogenicrs397514645RCV000033178; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105237142105237142TG14:g.105237142T>GClinGen:CA130755,UniProtKB:P31749#VAR_069792,OMIM:164730.0003C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.1293G>A (p.Ser431=)207AKT1Likely benignrs750104452RCV000651063; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105237152105237152CT14:g.105237152C>TClinGen:CA7374477C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.1290G>A (p.Thr430=)207AKT1Likely benignrs779447501RCV000651050; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105237155105237155CT14:g.105237155C>TClinGen:CA7374479C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.1289C>T (p.Thr430Met)207AKT1Uncertain significancers749186394RCV001058485; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105237156105237156GA14:g.105237156G>A-
NM_001382430.1(AKT1):c.1278G>A (p.Lys426=)207AKT1Likely benignrs1595239120RCV000936124|RCV001401971; NMedGen:CN517202|MONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105237167105237167CT14:g.105237167C>T-
NM_001382430.1(AKT1):c.1277A>C (p.Lys426Thr)207AKT1Uncertain significancers1892344387RCV001316009; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105237168105237168TG105237168-
NM_001382430.1(AKT1):c.1261C>T (p.Leu421Phe)207AKT1Uncertain significancers1566815164RCV000690076; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105237184105237184GA14:g.105237184G>A-C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.1261-10A>C207AKT1Likely benign-1RCV001468805; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105237194105237194TG105237194-
NM_001382430.1(AKT1):c.1261-18G>A207AKT1Likely benign-1RCV002113869; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105237202105237202CT105237202-
NM_001382430.1(AKT1):c.1261-19C>T207AKT1Likely benign-1RCV002095250; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105237203105237203GA105237203-
NM_001382430.1(AKT1):c.1261-20C>T207AKT1Likely benign-1RCV002185701; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105237204105237204GA105237204-
NM_001382430.1(AKT1):c.1260+18A>G207AKT1Likely benign-1RCV002156893; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105238684105238684TC105238684-
NM_001382430.1(AKT1):c.1260+16G>A207AKT1Likely benign-1RCV002141735; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105238686105238686CT105238686-
NM_001382430.1(AKT1):c.1260+15C>T207AKT1Likely benign-1RCV002106752; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105238687105238687GA105238687-
NM_001382430.1(AKT1):c.1260+12C>T207AKT1Benign-1RCV002197734; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105238690105238690GA105238690-
NM_001382430.1(AKT1):c.1260+5G>A207AKT1Uncertain significancers760365810RCV001051127; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105238697105238697CT14:g.105238697C>T-
NM_001382430.1(AKT1):c.1260+4C>T207AKT1Uncertain significancers765999603RCV000469569; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105238698105238698GANC_000014.8:g.105238698G>AClinGen:CA7374515C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.1260+1G>C207AKT1Uncertain significancers112117625RCV001321935; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105238701105238701CG105238701-
NM_001382430.1(AKT1):c.1251C>T (p.Tyr417=)207AKT1Benign/Likely benignrs139297659RCV000205490|RCV000503783|RCV001582715; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:201|MedGen:CN169374|MedGen:CN51720214105238711105238711GANC_000014.8:g.105238711G>AClinGen:CA349643C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.1248G>A (p.Val416=)207AKT1Likely benign-1RCV001453389; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105238714105238714CT105238714-
NM_001382430.1(AKT1):c.1245C>G (p.His415Gln)207AKT1Uncertain significance-1RCV001916189; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105238717105238717GC105238717-
NM_001382430.1(AKT1):c.1245C>T (p.His415=)207AKT1Likely benign-1RCV002162137; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105238717105238717GA105238717-
NM_001382430.1(AKT1):c.1243C>T (p.His415Tyr)207AKT1Uncertain significance-1RCV001969832; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105238719105238719GA105238719-
NM_001382430.1(AKT1):c.1242G>C (p.Gln414His)207AKT1Uncertain significancers1555383354RCV000525815; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105238720105238720CG14:g.105238720C>GClinGen:CA391216125C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.1234G>A (p.Val412Met)207AKT1Uncertain significancers1444891733RCV001222243; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105238728105238728CT14:g.105238728C>T-
NM_001382430.1(AKT1):c.1233C>T (p.Ile411=)207AKT1Likely benignrs375901448RCV000227810; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105238729105238729GANC_000014.8:g.105238729G>AClinGen:CA7374521C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.1228G>A (p.Gly410Ser)207AKT1Uncertain significancers146483593RCV000232840; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105238734105238734CT14:g.105238734C>TClinGen:CA7374522C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.1227C>T (p.Ala409=)207AKT1Likely benignrs141303557RCV000231388; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105238735105238735GA14:g.105238735G>AClinGen:CA7374523C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.1216C>T (p.Arg406Cys)207AKT1Uncertain significancers749544983RCV001217031; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105238746105238746GA14:g.105238746G>A-
NM_001382430.1(AKT1):c.1206C>T (p.Ile402=)207AKT1Likely benign-1RCV002189145; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105238756105238756GA105238756-
NM_001382430.1(AKT1):c.1198A>G (p.Lys400Glu)207AKT1Uncertain significancers773607483RCV000822640|RCV001766745; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:201|MONDO:MONDO:0016419,MedGen:C0346153,OMIM:114480, Orphanet:22753514105238764105238764TC14:g.105238764T>C-
NM_001382430.1(AKT1):c.1195G>A (p.Ala399Thr)207AKT1Uncertain significancers188580689RCV000792970; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105238767105238767CT14:g.105238767C>T-
NM_001382430.1(AKT1):c.1194C>T (p.Asp398=)207AKT1Likely benignrs151254374RCV000542011|RCV001000136; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:201|MedGen:CN16937414105238768105238768GA14:g.105238768G>AClinGen:CA7374530C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.1191G>T (p.Glu397Asp)207AKT1Uncertain significancers1334042967RCV000525011; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105238771105238771CA14:g.105238771C>AClinGen:CA391216366C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.1189G>C (p.Glu397Gln)207AKT1Uncertain significancers531850885RCV001210615; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105238773105238773CG14:g.105238773C>G-
NM_001382430.1(AKT1):c.1189G>A (p.Glu397Lys)207AKT1Uncertain significance-1RCV001927750; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105238773105238773CT105238773-
NM_001382430.1(AKT1):c.1188C>T (p.Ser396=)207AKT1Likely benignrs911689817RCV000950956|RCV001462135; NMedGen:CN517202|MONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105238774105238774GA14:g.105238774G>A-
NM_001382430.1(AKT1):c.1179C>T (p.Gly393=)207AKT1Benign/Likely benignrs11555434RCV000227423|RCV001561098; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:201|MedGen:CN51720214105238783105238783GANC_000014.8:g.105238783G>AClinGen:CA7374533C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.1176T>C (p.Leu392=)207AKT1Likely benign-1RCV001432748; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105238786105238786AG105238786-
NM_001382430.1(AKT1):c.1173G>A (p.Arg391=)207AKT1Uncertain significancers889505130RCV001295011; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105238789105238789CT105238789-
NM_001382430.1(AKT1):c.1173-6C>G207AKT1Uncertain significancers1036107517RCV001300248; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105238795105238795GC105238795-
NM_001382430.1(AKT1):c.1172+16C>G207AKT1Likely benign-1RCV002149673; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239199105239199GC105239199-
NM_001382430.1(AKT1):c.1172+10G>A207AKT1Likely benignrs200702576RCV000870315|RCV001441652; NMedGen:CN517202|MONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239205105239205CT14:g.105239205C>T-
NM_001382430.1(AKT1):c.1172+9C>T207AKT1Likely benignrs529348439RCV000871617; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239206105239206GA14:g.105239206G>A-
NM_001382430.1(AKT1):c.1172+9C>A207AKT1Likely benign-1RCV001433902; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239206105239206GT105239206-
NM_001382430.1(AKT1):c.1172+7G>A207AKT1Likely benign-1RCV002077968; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239208105239208CT105239208-
NM_001382430.1(AKT1):c.1172+5G>A207AKT1Uncertain significancers751392710RCV001230619; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239210105239210CT14:g.105239210C>T-
NM_001382430.1(AKT1):c.1172+4A>C207AKT1Likely benignrs1319947920RCV000989266; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239211105239211TG14:g.105239211T>G-
NM_001382430.1(AKT1):c.1166A>C (p.Lys389Thr)207AKT1Uncertain significance-1RCV001903640; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239221105239221TG105239221-
NM_001382430.1(AKT1):c.1161C>T (p.Asp387=)207AKT1Likely benignrs1309319250RCV000941132; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239226105239226GA14:g.105239226G>A-
NM_001382430.1(AKT1):c.1159G>A (p.Asp387Asn)207AKT1Uncertain significancers1566816289RCV000699382; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239228105239228CTNC_000014.8:g.105239228C>T-C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.1149G>A (p.Leu383=)207AKT1Likely benign-1RCV001489235; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239238105239238CT105239238-
NM_001382430.1(AKT1):c.1146G>A (p.Gly382=)207AKT1Likely benign-1RCV001480676; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239241105239241CT105239241-
NM_001382430.1(AKT1):c.1134C>T (p.Ser378=)207AKT1Likely benignrs369527283RCV000651056; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239253105239253GANC_000014.8:g.105239253G>AClinGen:CA7374562C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.1130A>G (p.Lys377Arg)207AKT1Uncertain significancers1480573852RCV001323953; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239257105239257TC105239257-
NM_001382430.1(AKT1):c.1122C>T (p.Pro374=)207AKT1Likely benignrs374865919RCV000866850; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239265105239265GA14:g.105239265G>A-
NM_001382430.1(AKT1):c.1119T>A (p.Gly373=)207AKT1Likely benign-1RCV001437294; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239268105239268AT105239268-
NM_001382430.1(AKT1):c.1113G>C (p.Thr371=)207AKT1Likely benign-1RCV001434939; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239274105239274CG105239274-
NM_001382430.1(AKT1):c.1113G>A (p.Thr371=)207AKT1Likely benign-1RCV001448246; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239274105239274CT105239274-
NM_001382430.1(AKT1):c.1112C>A (p.Thr371Lys)207AKT1Uncertain significancers781388586RCV000817003; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239275105239275GT14:g.105239275G>T-
NM_001382430.1(AKT1):c.1112C>T (p.Thr371Met)207AKT1Uncertain significancers781388586RCV001043127; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239275105239275GA14:g.105239275G>A-
NM_001382430.1(AKT1):c.1109G>A (p.Arg370His)207AKT1Uncertain significancers746272761RCV000706299; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239278105239278CT14:g.105239278C>T-C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.1108C>T (p.Arg370Cys)207AKT1Uncertain significancers549370342RCV001045694; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239279105239279GA14:g.105239279G>A-
NM_001382430.1(AKT1):c.1107G>A (p.Pro369=)207AKT1Likely benignrs150399268RCV000867928; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239280105239280CT14:g.105239280C>T-
NM_001382430.1(AKT1):c.1107G>C (p.Pro369=)207AKT1Likely benign-1RCV001471878; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239280105239280CG105239280-
NM_001382430.1(AKT1):c.1104C>T (p.Phe368=)207AKT1Likely benignrs1595241867RCV000929778|RCV001401529; NMedGen:CN517202|MONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239283105239283GA14:g.105239283G>A-
NM_001382430.1(AKT1):c.1099C>A (p.Arg367Ser)207AKT1Uncertain significancers762705090RCV000651045; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239288105239288GTNC_000014.8:g.105239288G>TClinGen:CA7374571C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.1099C>T (p.Arg367Cys)207AKT1Uncertain significancers762705090RCV000815958; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239288105239288GA14:g.105239288G>A-
NM_001382430.1(AKT1):c.1097T>C (p.Ile366Thr)207AKT1Uncertain significancers1892477463RCV001302477; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239290105239290AG105239290-
NM_001382430.1(AKT1):c.1092G>A (p.Glu364=)207AKT1Uncertain significance-1RCV001947554; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239295105239295CT105239295-
NM_001382430.1(AKT1):c.1088T>C (p.Met363Thr)207AKT1Uncertain significancers1892478123RCV001298901; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239299105239299AG105239299-
NM_001382430.1(AKT1):c.1086C>T (p.Leu362=)207AKT1Likely benign-1RCV002122460; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239301105239301GA105239301-
NM_001382430.1(AKT1):c.1083C>T (p.Ile361=)207AKT1Likely benign-1RCV001471896; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239304105239304GA105239304-
NM_001382430.1(AKT1):c.1080C>T (p.Leu360=)207AKT1Likely benign-1RCV001399644; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239307105239307GA105239307-
NM_001382430.1(AKT1):c.1053C>T (p.Asn351=)207AKT1Likely benignrs376942361RCV000864249; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239334105239334GA14:g.105239334G>A-
NM_001382430.1(AKT1):c.1038C>T (p.Arg346=)207AKT1Likely benignrs1060504819RCV000471407|RCV001446090; NMedGen:CN517202|MONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239349105239349GANC_000014.8:g.105239349G>AClinGen:CA16614106C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.1037G>A (p.Arg346His)207AKT1Uncertain significance-1RCV001934070; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239350105239350CT105239350-
NM_001382430.1(AKT1):c.1036C>T (p.Arg346Cys)207AKT1Uncertain significance-1RCV001887310; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239351105239351GA105239351-
NM_001382430.1(AKT1):c.1032C>T (p.Cys344=)207AKT1Benignrs56289559RCV000233578|RCV001795366|RCV001795367; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:201|MedGen:CN517202|MedGen:CN16937414105239355105239355GA14:g.105239355G>AClinGen:CA7374578C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.1020C>T (p.Tyr340=)207AKT1Benign/Likely benignrs144088506RCV000229592|RCV001579879|RCV001762535|RCV001727648; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:201|MedGen:CN169374|MONDO:MONDO:0016419,MedGen:C0346153,OMIM:114480, Orphanet:227535|MedGen:CN51720214105239367105239367GA14:g.105239367G>AClinGen:CA7374579C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.1011G>A (p.Val337=)207AKT1Likely benign-1RCV001467575; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239376105239376CT105239376-
NM_001382430.1(AKT1):c.1009G>A (p.Val337Met)207AKT1Uncertain significance-1RCV002000995; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239378105239378CT105239378-
NM_001382430.1(AKT1):c.1008C>T (p.Gly336=)207AKT1Uncertain significancers1489572550RCV001219427; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239379105239379GA14:g.105239379G>A-
NM_001382430.1(AKT1):c.1005G>A (p.Leu335=)207AKT1Uncertain significancers758651475RCV001049600; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239382105239382CT14:g.105239382C>T-
NM_001382430.1(AKT1):c.985G>A (p.Ala329Thr)207AKT1Uncertain significance-1RCV001874962; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239402105239402CT105239402-
NM_001382430.1(AKT1):c.983G>A (p.Arg328His)207AKT1Uncertain significancers1892486033RCV001342867; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239404105239404CT105239404-
NM_001382430.1(AKT1):c.978C>T (p.Tyr326=)207AKT1Likely benign-1RCV001440303; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239409105239409GA105239409-
NM_001382430.1(AKT1):c.960G>A (p.Val320=)207AKT1Likely benignrs1595242097RCV000980224|RCV001394099; NMedGen:CN517202|MONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239427105239427CT14:g.105239427C>T-
NM_001382430.1(AKT1):c.958-6G>A207AKT1Benignrs199770031RCV000232103; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239435105239435CTNC_000014.8:g.105239435C>TClinGen:CA7374586C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.958-7C>T207AKT1Benignrs369048965RCV000203797; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239436105239436GA14:g.105239436G>AClinGen:CA348072C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.958-7C>G207AKT1Likely benign-1RCV002210142; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239436105239436GC105239436-
NM_001382430.1(AKT1):c.957+18G>A207AKT1Benign-1RCV002192433; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239570105239570CT105239570-
NM_001382430.1(AKT1):c.957+17C>T207AKT1Likely benign-1RCV002208854; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239571105239571GA105239571-
NM_001382430.1(AKT1):c.957+15T>C207AKT1Likely benign-1RCV002151671; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239573105239573AG105239573-
NM_001382430.1(AKT1):c.957+7G>A207AKT1Likely benign-1RCV001461609; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239581105239581CT105239581-
NM_001382430.1(AKT1):c.957+3G>A207AKT1Conflicting interpretations of pathogenicityrs1219173005RCV000606636|RCV001229553; NMedGen:CN169374|MONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239585105239585CT14:g.105239585C>TClinGen:CA658798276CN169374 not specified;
NM_001382430.1(AKT1):c.957+3G>T207AKT1Uncertain significancers1219173005RCV001351018; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239585105239585CA105239585-
NM_001382430.1(AKT1):c.954C>A (p.Pro318=)207AKT1Uncertain significancers746944273RCV001346452; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239591105239591GT105239591-
NM_001382430.1(AKT1):c.951C>A (p.Ala317=)207AKT1Likely benignrs17846831RCV000534938; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239594105239594GT14:g.105239594G>TClinGen:CA7374611C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.942G>A (p.Glu314=)207AKT1Likely benign-1RCV002125648; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239603105239603CT105239603-
NM_001382430.1(AKT1):c.927T>C (p.Phe309=)207AKT1Likely benign-1RCV001454370; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239618105239618AG105239618-
NM_001382430.1(AKT1):c.917T>C (p.Met306Thr)207AKT1Uncertain significancers1555383471RCV000651043; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239628105239628AGNC_000014.8:g.105239628A>GClinGen:CA391217685C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.916A>G (p.Met306Val)207AKT1Uncertain significancers1892503990RCV001057604; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239629105239629TC14:g.105239629T>C-
NM_001382430.1(AKT1):c.907G>A (p.Gly303Ser)207AKT1Uncertain significancers1360111387RCV000792229; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239638105239638CT14:g.105239638C>T-
NM_001382430.1(AKT1):c.906C>T (p.Asp302=)207AKT1Likely benignrs746001369RCV000651057; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239639105239639GANC_000014.8:g.105239639G>AClinGen:CA7374615C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.879C>T (p.Phe293=)207AKT1Likely benignrs139200289RCV000476034; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239666105239666GANC_000014.8:g.105239666G>AClinGen:CA7374616C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.876C>T (p.Asp292=)207AKT1Likely benignrs761942512RCV000527184; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239669105239669GA14:g.105239669G>AClinGen:CA7374617C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.855C>T (p.Asp285=)207AKT1Likely benignrs149484260RCV000460148; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239690105239690GANC_000014.8:g.105239690G>AClinGen:CA7374619C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.829-4C>T207AKT1Uncertain significancers756663391RCV000822927; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239720105239720GA14:g.105239720G>A-
NM_001382430.1(AKT1):c.829-9T>C207AKT1Likely benign-1RCV002148859; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239725105239725AG105239725-
NM_001382430.1(AKT1):c.828+16_828+18delinsTTT207AKT1Likely benign-1RCV002107605; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239774105239776GCCAAA105239774-
NM_001382430.1(AKT1):c.828+11G>A207AKT1Likely benign-1RCV002194698; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239781105239781CT105239781-
NM_001382430.1(AKT1):c.828+10C>T207AKT1Uncertain significancers370490407RCV000228128; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239782105239782GA14:g.105239782G>AClinGen:CA7374635C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.828+7del207AKT1Likely benignrs1555383494RCV000651049; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239785105239785CAC14:g.105239785_105239785delClinGen:CA658798277C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.828+6C>G207AKT1Uncertain significancers1892515105RCV001215152; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239786105239786GC14:g.105239786G>C-
NM_001382430.1(AKT1):c.828+5G>A207AKT1Uncertain significancers1199214347RCV000697348; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239787105239787CT14:g.105239787C>T-C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.828+5G>C207AKT1Uncertain significancers1199214347RCV000793560; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239787105239787CG14:g.105239787C>G-
NM_001382430.1(AKT1):c.828+4C>T207AKT1Uncertain significancers3730330RCV000460817; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239788105239788GANC_000014.8:g.105239788G>AClinGen:CA7374636C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.822C>T (p.Asp274=)207AKT1Likely benignrs1555383496RCV000551046; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239798105239798GANC_000014.8:g.105239798G>AClinGen:CA488716878C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.818G>A (p.Arg273Gln)207AKT1Uncertain significance-1RCV001917262; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239802105239802CT105239802-
NM_001382430.1(AKT1):c.817C>T (p.Arg273Trp)207AKT1Uncertain significance-1RCV001959429; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239803105239803GA105239803-
NM_001382430.1(AKT1):c.810G>A (p.Val270=)207AKT1Likely benignrs2230508RCV000864482; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239810105239810CT14:g.105239810C>T-
NM_001382430.1(AKT1):c.807C>T (p.Asn269=)207AKT1Benignrs201044857RCV000465624; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239813105239813GANC_000014.8:g.105239813G>AClinGen:CA7374640C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.799G>A (p.Glu267Lys)207AKT1Uncertain significancers1892518022RCV001234146; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239821105239821CT14:g.105239821C>T-
NM_001382430.1(AKT1):c.798G>A (p.Ser266=)207AKT1Uncertain significancers367635775RCV000534158; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239822105239822CT14:g.105239822C>TClinGen:CA7374641C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.797C>T (p.Ser266Leu)207AKT1Uncertain significancers549083521RCV000806321; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239823105239823GA14:g.105239823G>A-
NM_001382430.1(AKT1):c.796T>G (p.Ser266Ala)207AKT1Uncertain significancers1892518764RCV001209400; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239824105239824AC14:g.105239824A>C-
NM_001382430.1(AKT1):c.783G>A (p.Leu261=)207AKT1Likely benignrs143933508RCV000466461; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239837105239837CTNC_000014.8:g.105239837C>TClinGen:CA7374646C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.770T>C (p.Ile257Thr)207AKT1Uncertain significancers1555383511RCV000558043; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239850105239850AGNC_000014.8:g.105239850A>GClinGen:CA391218330C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.763G>A (p.Ala255Thr)207AKT1Uncertain significancers375395037RCV000472766; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239857105239857CTNC_000014.8:g.105239857C>TClinGen:CA7374648C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.751C>T (p.Arg251Cys)207AKT1Uncertain significancers780571834RCV000691797; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239869105239869GANC_000014.8:g.105239869G>A-C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.750C>G (p.Ala250=)207AKT1Likely benign-1RCV001467091; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239870105239870GC105239870-
NM_001382430.1(AKT1):c.749C>T (p.Ala250Val)207AKT1Uncertain significancers1892523027RCV001338158; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239871105239871GA105239871-
NM_001382430.1(AKT1):c.747G>T (p.Arg249=)207AKT1Likely benign-1RCV001441214; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239873105239873CA105239873-
NM_001382430.1(AKT1):c.746G>A (p.Arg249Gln)207AKT1Uncertain significance-1RCV001916750; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239874105239874CT105239874-
NM_001382430.1(AKT1):c.745C>T (p.Arg249Trp)207AKT1Uncertain significancers1458420660RCV000819636; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239875105239875GA14:g.105239875G>A-
NM_001382430.1(AKT1):c.741G>C (p.Glu247Asp)207AKT1Uncertain significance-1RCV001906337; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239879105239879CG105239879-
NM_001382430.1(AKT1):c.738C>T (p.Ser246=)207AKT1Conflicting interpretations of pathogenicityrs368667384RCV000545635|RCV001087620; NMedGen:CN517202|MONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239882105239882GA14:g.105239882G>AClinGen:CA7374653C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.734T>G (p.Phe245Cys)207AKT1Uncertain significance-1RCV001960365; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239886105239886AC105239886-
NM_001382430.1(AKT1):c.727C>T (p.Arg243Cys)207AKT1Uncertain significancers1340970650RCV001231204; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239893105239893GA14:g.105239893G>A-
NM_001382430.1(AKT1):c.726G>A (p.Glu242=)207AKT1Benignrs1130233RCV000597976|RCV000989267|RCV001595023; NMedGen:CN169374|MONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:201|MedGen:CN51720214105239894105239894CT14:g.105239894C>TClinGen:CA7374655CN169374 not specified;
NM_001382430.1(AKT1):c.722G>A (p.Arg241Gln)207AKT1Uncertain significancers1244832277RCV001238573; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239898105239898CT14:g.105239898C>T-
NM_001382430.1(AKT1):c.721C>T (p.Arg241Trp)207AKT1Uncertain significancers768606668RCV000456495; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239899105239899GANC_000014.8:g.105239899G>AClinGen:CA7374656C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.719C>G (p.Ser240Cys)207AKT1Uncertain significancers773520823RCV001340694; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239901105239901GC105239901-
NM_001382430.1(AKT1):c.705G>T (p.Leu235=)207AKT1Likely benignrs769090254RCV000470550; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239915105239915CANC_000014.8:g.105239915C>AClinGen:CA7374658C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.705G>A (p.Leu235=)207AKT1Likely benignrs769090254RCV000651062; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239915105239915CT14:g.105239915C>TClinGen:CA488716620C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.703-4G>A207AKT1Likely benignrs776642823RCV000474658; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239921105239921CTNC_000014.8:g.105239921C>TClinGen:CA7374660C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.703-5C>T207AKT1Likely benignrs377077146RCV000651052|RCV001421498; NMedGen:CN517202|MONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239922105239922GANC_000014.8:g.105239922G>AClinGen:CA7374661C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.703-12C>T207AKT1Likely benign-1RCV002076697; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105239929105239929GA105239929-
NM_001382430.1(AKT1):c.702+18G>A207AKT1Likely benign-1RCV002104385; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105240231105240231CT105240231-
NM_001382430.1(AKT1):c.702+17C>T207AKT1Likely benign-1RCV002213125; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105240232105240232GA105240232-
NM_001382430.1(AKT1):c.696G>A (p.Gly232=)207AKT1Likely benignrs201006619RCV000868751|RCV001421508; NMedGen:CN517202|MONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105240255105240255CT14:g.105240255C>T-
NM_001382430.1(AKT1):c.693C>T (p.Asn231=)207AKT1Likely benignrs767346459RCV000537685; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105240258105240258GA14:g.105240258G>AClinGen:CA7374695C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.692A>G (p.Asn231Ser)207AKT1Uncertain significancers1595243377RCV000818537; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105240259105240259TC14:g.105240259T>C-
NM_001382430.1(AKT1):c.687C>T (p.Tyr229=)207AKT1Likely benignrs769696222RCV000557115; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105240264105240264GA14:g.105240264G>AClinGen:CA7374696C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.684G>A (p.Glu228=)207AKT1Likely benign-1RCV001493990; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105240267105240267CT105240267-
NM_001382430.1(AKT1):c.669C>G (p.Leu223=)207AKT1Likely benignrs376531915RCV000868920|RCV001477223; NMedGen:CN517202|MONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105240282105240282GC14:g.105240282G>C-
NM_001382430.1(AKT1):c.665G>A (p.Arg222His)207AKT1Uncertain significancers369698909RCV001221913; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105240286105240286CT14:g.105240286C>T-
NM_001382430.1(AKT1):c.664C>T (p.Arg222Cys)207AKT1Uncertain significancers551254461RCV001058318; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105240287105240287GA14:g.105240287G>A-
NM_001382430.1(AKT1):c.661G>A (p.Asp221Asn)207AKT1Uncertain significancers762040581RCV001342648; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105240290105240290CT105240290-
NM_001382430.1(AKT1):c.660C>T (p.His220=)207AKT1Likely benignrs141168205RCV000461950; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105240291105240291GANC_000014.8:g.105240291G>AClinGen:CA7374702C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.641A>G (p.Lys214Arg)207AKT1Uncertain significance-1RCV001362182; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105240310105240310TC105240310-
NM_001382430.1(AKT1):c.635C>G (p.Ala212Gly)207AKT1Uncertain significancers1163499100RCV001213499; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105240316105240316GC14:g.105240316G>C-
NM_001382430.1(AKT1):c.634-13C>T207AKT1Likely benign-1RCV002201892; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105240330105240330GA105240330-
NM_001382430.1(AKT1):c.633+15A>G207AKT1Likely benign-1RCV002148716; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105241260105241260TC105241260-
NM_001382430.1(AKT1):c.633+9dup207AKT1Likely benign-1RCV002153967; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105241265105241266TTC105241265-
NM_001382430.1(AKT1):c.633+9G>A207AKT1Likely benign-1RCV001504937; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105241266105241266CT105241266-
NM_001382430.1(AKT1):c.633+7G>T207AKT1Likely benign-1RCV001447735; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105241268105241268CA105241268-
NM_001382430.1(AKT1):c.614C>G (p.Ser205Cys)207AKT1Uncertain significance-1RCV002002022; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105241294105241294GC105241294-
NM_001382430.1(AKT1):c.612C>T (p.Asn204=)207AKT1Likely benignrs1044733473RCV000884027; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105241296105241296GA14:g.105241296G>A-
NM_001382430.1(AKT1):c.606G>A (p.Leu202=)207AKT1Likely benignrs759079296RCV000868290; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105241302105241302CT14:g.105241302C>T-
NM_001382430.1(AKT1):c.604C>T (p.Leu202=)207AKT1Benignrs2230506RCV000471677|RCV001579825|RCV001675908; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:201|MedGen:CN169374|MedGen:CN51720214105241304105241304GANC_000014.8:g.105241304G>AClinGen:CA7374727C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.599G>A (p.Arg200His)207AKT1Uncertain significancers1462219795RCV001062205; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105241309105241309CT14:g.105241309C>T-
NM_001382430.1(AKT1):c.591C>T (p.Thr197=)207AKT1Likely benignrs763782135RCV000875161; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105241317105241317GA14:g.105241317G>A-
NC_000014.8:g.105241336_105241337insCGTCCTGTAAAGCAGGGCTGGGTGAGATGCCACCC207AKT1Uncertain significance-1RCV001969395; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105241336105241337TTCGTCCTGTAAAGCAGGGCTGGGTGAGATGCCACCC105241336-
NM_001382430.1(AKT1):c.570C>T (p.Asp190=)207AKT1Conflicting interpretations of pathogenicityrs780207480RCV000651059; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105241338105241338GANC_000014.8:g.105241338G>AClinGen:CA7374733C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.568-14_568-11dup207AKT1Likely benign-1RCV002105578; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105241350105241351AAGGGC105241350-
NM_001382430.1(AKT1):c.567+19G>T207AKT1Likely benign-1RCV002180413; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105241394105241394CA105241394-
NM_001382430.1(AKT1):c.567+14G>A207AKT1Benign/Likely benign-1RCV001546715|RCV002072003|RCV001579332; NMedGen:CN517202|MONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:201|MedGen:CN16937414105241399105241399CT105241399-
NM_001382430.1(AKT1):c.567+12G>A207AKT1Benign-1RCV002153804; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105241401105241401CT105241401-
NM_001382430.1(AKT1):c.567+9G>A207AKT1Likely benignrs200724383RCV000867862; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105241404105241404CT14:g.105241404C>T-
NM_001382430.1(AKT1):c.567+8C>T207AKT1Likely benignrs752874396RCV000544720; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105241405105241405GA14:g.105241405G>AClinGen:CA7374755C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.567+5G>T207AKT1Uncertain significancers373741434RCV001313177; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105241408105241408CA105241408-
NM_001382430.1(AKT1):c.561G>A (p.Val187=)207AKT1Likely benign-1RCV001460681; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105241419105241419CT105241419-
NM_001382430.1(AKT1):c.558C>T (p.Ile186=)207AKT1Benignrs34670300RCV000456949|RCV001672796|RCV001700192; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:201|MedGen:CN517202|MedGen:CN16937414105241422105241422GANC_000014.8:g.105241422G>AClinGen:CA7374760C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.552A>G (p.Glu184=)207AKT1Likely benign-1RCV001490465; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105241428105241428TC105241428-
NM_001382430.1(AKT1):c.544AAG[1] (p.Lys183del)207AKT1Uncertain significance-1RCV001922155; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105241431105241433CCTTC105241430-
NM_001382430.1(AKT1):c.545A>G (p.Lys182Arg)207AKT1Uncertain significancers1555383695RCV000651044; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105241435105241435TCNC_000014.8:g.105241435T>CClinGen:CA391219354C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.528C>T (p.Tyr176=)207AKT1Likely benignrs1422460834RCV000651058; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105241452105241452GA14:g.105241452G>AClinGen:CA488463776C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.525C>T (p.Tyr175=)207AKT1Likely benignrs774828129RCV000651060; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105241455105241455GANC_000014.8:g.105241455G>AClinGen:CA7374763C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.521G>A (p.Arg174His)207AKT1Uncertain significancers1200003171RCV001225652; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105241459105241459CT14:g.105241459C>T-
NM_001382430.1(AKT1):c.520C>T (p.Arg174Cys)207AKT1Uncertain significancers983007851RCV000532235; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105241460105241460GA14:g.105241460G>AClinGen:CA267349921C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.515C>T (p.Thr172Ile)207AKT1Uncertain significance-1RCV002024871; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105241465105241465GA105241465-
NM_001382430.1(AKT1):c.512C>T (p.Ala171Val)207AKT1Uncertain significancers768070795RCV000792339; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105241468105241468GA14:g.105241468G>A-
NM_001382430.1(AKT1):c.511G>A (p.Ala171Thr)207AKT1Uncertain significance-1RCV001999102; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105241469105241469CT105241469-
NM_001382430.1(AKT1):c.495C>T (p.Ile165=)207AKT1Likely benignrs1161567933RCV000873201|RCV001421970; NMedGen:CN517202|MONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105241485105241485GA14:g.105241485G>A-
NM_001382430.1(AKT1):c.493A>G (p.Ile165Val)207AKT1Uncertain significance-1RCV001933269; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105241487105241487TC105241487-
NM_001382430.1(AKT1):c.483C>T (p.Phe161=)207AKT1Likely benignrs139904675RCV000869154; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105241497105241497GA14:g.105241497G>A-
NM_001382430.1(AKT1):c.468G>A (p.Leu156=)207AKT1Likely benign-1RCV002148582; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105241512105241512CT105241512-
NM_001382430.1(AKT1):c.457C>T (p.Leu153=)207AKT1Likely benignrs149803079RCV000651061; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105241523105241523GANC_000014.8:g.105241523G>AClinGen:CA267349953C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.453G>A (p.Glu151=)207AKT1Likely benignrs765537155RCV000876363; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105241527105241527CT14:g.105241527C>T-
NM_001382430.1(AKT1):c.444C>T (p.Asn148=)207AKT1Likely benign-1RCV001496594; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105241536105241536GA105241536-
NM_001382430.1(AKT1):c.440T>C (p.Met147Thr)207AKT1Uncertain significancers758456890RCV000651047; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105241540105241540AGNC_000014.8:g.105241540A>GClinGen:CA7374773C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.438C>T (p.Thr146=)207AKT1Likely benignrs145780379RCV000458557; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105241542105241542GANC_000014.8:g.105241542G>AClinGen:CA7374774C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.436-3T>C207AKT1Uncertain significancers368553273RCV000695568; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105241547105241547AGNC_000014.8:g.105241547A>G-C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.436-4A>G207AKT1Likely benignrs1060504821RCV000465351|RCV001400573; NMedGen:CN517202|MONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105241548105241548TCNC_000014.8:g.105241548T>CClinGen:CA16614461C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.436-18C>A207AKT1Likely benign-1RCV002137366; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105241562105241562GT105241562-
NM_001382430.1(AKT1):c.435+17C>T207AKT1Likely benign-1RCV002111306; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105241972105241972GA105241972-
NM_001382430.1(AKT1):c.435+10G>T207AKT1Likely benign-1RCV002150732; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105241979105241979CA105241979-
NM_001382430.1(AKT1):c.432C>T (p.Arg144=)207AKT1Benignrs17846825RCV000226398; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105241992105241992GA14:g.105241992G>AClinGen:CA7374800C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.431G>A (p.Arg144His)207AKT1Uncertain significancers1060503071RCV000457583; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105241993105241993CTNC_000014.8:g.105241993C>TClinGen:CA16614120C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.430C>T (p.Arg144Cys)207AKT1Uncertain significancers375990114RCV000704448; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105241994105241994GANC_000014.8:g.105241994G>A-C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.422C>T (p.Pro141Leu)207AKT1Uncertain significance-1RCV001991557; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105242002105242002GA105242002-
NM_001382430.1(AKT1):c.415G>C (p.Ala139Pro)207AKT1Uncertain significancers1566818045RCV001068896; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105242009105242009CG14:g.105242009C>G-
NM_001382430.1(AKT1):c.412C>T (p.Leu138=)207AKT1Likely benign-1RCV001426533; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105242012105242012GA105242012-
NM_001382430.1(AKT1):c.406G>A (p.Val136Met)207AKT1Conflicting interpretations of pathogenicityrs778376616RCV000231420; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105242018105242018CT14:g.105242018C>TClinGen:CA7374803C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.399G>A (p.Glu133=)207AKT1Likely benign-1RCV002084568; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105242025105242025CT105242025-
NM_001382430.1(AKT1):c.394G>A (p.Glu132Lys)207AKT1Uncertain significancers1319030326RCV001068031; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105242030105242030CT14:g.105242030C>T-
NM_001382430.1(AKT1):c.387A>G (p.Ser129=)207AKT1Likely benignrs747700076RCV000873199; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105242037105242037TC14:g.105242037T>C-
NM_001382430.1(AKT1):c.377G>C (p.Ser126Thr)207AKT1Uncertain significancers1892659749RCV001040405; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105242047105242047CG14:g.105242047C>G-
NM_001382430.1(AKT1):c.374C>T (p.Pro125Leu)207AKT1Uncertain significance-1RCV001368107; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105242050105242050GA105242050-
NM_001382430.1(AKT1):c.365C>T (p.Ser122Leu)207AKT1Uncertain significancers746934495RCV001039573; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105242059105242059GA14:g.105242059G>A-
NM_001382430.1(AKT1):c.362G>A (p.Arg121Gln)207AKT1Uncertain significancers1457484217RCV000816394; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105242062105242062CT14:g.105242062C>T-
NM_001382430.1(AKT1):c.362G>T (p.Arg121Leu)207AKT1Uncertain significance-1RCV001955536; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105242062105242062CA105242062-
NM_001382430.1(AKT1):c.361C>T (p.Arg121Trp)207AKT1Uncertain significance-1RCV001898540; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105242063105242063GA105242063-
NM_001382430.1(AKT1):c.357C>T (p.Asp119=)207AKT1Likely benign-1RCV001441320; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105242067105242067GA105242067-
NM_001382430.1(AKT1):c.356A>G (p.Asp119Gly)207AKT1Uncertain significancers1566818099RCV000709351; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105242068105242068TC14:g.105242068T>C-C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.340GAG[5] (p.Glu117dup)207AKT1Uncertain significance-1RCV001918695; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105242072105242073TTCTC105242072-
NM_001382430.1(AKT1):c.340GAG[3] (p.Glu117del)207AKT1Uncertain significancers768025881RCV001056027; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105242073105242075TCTCT14:g.105242073_105242075del-
NM_001382430.1(AKT1):c.351G>A (p.Glu117=)207AKT1Likely benign-1RCV002111823; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105242073105242073CT105242073-
NM_001382430.1(AKT1):c.349G>A (p.Glu117Lys)207AKT1Uncertain significancers776345122RCV001338081; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105242075105242075CT105242075-
NM_001382430.1(AKT1):c.348G>A (p.Glu116=)207AKT1Likely benignrs1595245735RCV000909552|RCV001398818; NMedGen:CN517202|MONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105242076105242076CT14:g.105242076C>T-
NM_001382430.1(AKT1):c.343G>A (p.Glu115Lys)207AKT1Uncertain significance-1RCV001943003; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105242081105242081CT105242081-
NM_001382430.1(AKT1):c.328C>T (p.Leu110Phe)207AKT1Uncertain significance-1RCV002017304; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105242096105242096GA105242096-
NM_001382430.1(AKT1):c.325G>A (p.Gly109Ser)207AKT1Uncertain significancers768800433RCV001230428; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105242099105242099CT14:g.105242099C>T-
NM_001382430.1(AKT1):c.324C>T (p.Asp108=)207AKT1Likely benignrs940028787RCV000951397|RCV001417461; NMedGen:CN517202|MONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105242100105242100GA14:g.105242100G>A-
NM_001382430.1(AKT1):c.318G>C (p.Val106=)207AKT1Likely benign-1RCV002128924; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105242106105242106CG105242106-
NM_001382430.1(AKT1):c.315T>C (p.Thr105=)207AKT1Likely benignrs767715614RCV000228870|RCV001447357; NMedGen:CN517202|MONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105242109105242109AG14:g.105242109A>GClinGen:CA7374815C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.309C>T (p.Ile103=)207AKT1Likely benign-1RCV001459097; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105242115105242115GA105242115-
NM_001382430.1(AKT1):c.303C>T (p.Thr101=)207AKT1Likely benignrs750890213RCV000954343; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105242121105242121GA14:g.105242121G>A-
NM_001382430.1(AKT1):c.294G>A (p.Glu98=)207AKT1Likely benignrs766755485RCV000977825|RCV001430607; NMedGen:CN517202|MONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105242130105242130CT14:g.105242130C>T-
NM_001382430.1(AKT1):c.288-3C>T207AKT1Uncertain significancers61761189RCV000468966; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105242139105242139GANC_000014.8:g.105242139G>AClinGen:CA7374819C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.288-4G>T207AKT1Likely benign-1RCV001478081; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105242140105242140CA105242140-
NM_001382430.1(AKT1):c.288-7_288-5del207AKT1Likely benignrs1206923979RCV000919398|RCV001498892; NMedGen:CN517202|MONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105242141105242143CAGGC14:g.105242141_105242143del-
NM_001382430.1(AKT1):c.288-9_288-8delinsGA207AKT1Uncertain significancers1892668261RCV001209397; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105242144105242145AGTCNC_000014.8:g.105242144_105242145delinsTC-
NM_001382430.1(AKT1):c.288-14C>T207AKT1Benign-1RCV002184250; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105242150105242150GA105242150-
NM_001382430.1(AKT1):c.287+17G>A207AKT1Uncertain significance-1RCV001997449; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105242979105242979CT105242979-
NM_001382430.1(AKT1):c.287+16C>T207AKT1Likely benign-1RCV002216664; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105242980105242980GA105242980-
NM_001382430.1(AKT1):c.287+5G>A207AKT1Uncertain significancers373853807RCV000651048; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105242991105242991CT14:g.105242991C>TClinGen:CA7374844C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.287+4C>T207AKT1Uncertain significancers745831501RCV000473230; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105242992105242992GANC_000014.8:g.105242992G>AClinGen:CA7374846C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.278C>A (p.Pro93His)207AKT1Uncertain significancers1296782302RCV001225813; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105243005105243005GT14:g.105243005G>T-
NM_001382430.1(AKT1):c.267T>C (p.His89=)207AKT1Likely benignrs142646145RCV000474768|RCV001452373; NMedGen:CN517202|MONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105243016105243016AGNC_000014.8:g.105243016A>GClinGen:CA7374848C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.257G>A (p.Arg86His)207AKT1Uncertain significance-1RCV001884797; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105243026105243026CT105243026-
NM_001382430.1(AKT1):c.253G>A (p.Glu85Lys)207AKT1Uncertain significance-1RCV001908908; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105243030105243030CT105243030-
NM_001382430.1(AKT1):c.252C>T (p.Ile84=)207AKT1Likely benign-1RCV001506642; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105243031105243031GA105243031-
NM_001382430.1(AKT1):c.237G>A (p.Gln79=)207AKT1Likely benignrs747020429RCV000861827; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105243046105243046CT14:g.105243046C>T-
NM_001382430.1(AKT1):c.236A>G (p.Gln79Arg)207AKT1Conflicting interpretations of pathogenicityrs1057518602RCV000413604|RCV001851003; NMedGen:CN517202|MONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105243047105243047TC14:g.105243047T>CClinGen:CA16042842CN517202 not provided;
NM_001382430.1(AKT1):c.227G>A (p.Arg76His)207AKT1Uncertain significancers771065764RCV000556163; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105243056105243056CT14:g.105243056C>TClinGen:CA7374853C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.226C>T (p.Arg76Cys)207AKT1Uncertain significance-1RCV002002825; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105243057105243057GA105243057-
NM_001382430.1(AKT1):c.225C>G (p.Ile75Met)207AKT1Uncertain significancers587778019RCV000119960|RCV001854593; NMedGen:CN169374|MONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105243058105243058GC14:g.105243058G>CClinGen:CA156582CN169374 not specified;
NM_001382430.1(AKT1):c.222C>T (p.Ile74=)207AKT1Likely benign-1RCV002142206; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105243061105243061GA105243061-
NM_001382430.1(AKT1):c.206G>A (p.Arg69Gln)207AKT1Uncertain significancers183989506RCV000543771; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105243077105243077CT14:g.105243077C>TClinGen:CA7374855C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.201G>T (p.Arg67=)207AKT1Likely benignrs1452532489RCV000951511|RCV001446133; NMedGen:CN517202|MONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105243082105243082CA14:g.105243082C>A-
NM_001382430.1(AKT1):c.200G>A (p.Arg67Gln)207AKT1Uncertain significance-1RCV001871013; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105243083105243083CT105243083-
NM_001382430.1(AKT1):c.199C>T (p.Arg67Trp)207AKT1Uncertain significancers762559261RCV001054367; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105243084105243084GA14:g.105243084G>A-
NM_001382430.1(AKT1):c.195G>A (p.Thr65=)207AKT1Likely benignrs768384015RCV000651055; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105243088105243088CTNC_000014.8:g.105243088C>TClinGen:CA7374858C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.179G>A (p.Cys60Tyr)207AKT1Uncertain significancers923841704RCV001065500; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105243104105243104CT14:g.105243104C>T-
NM_001382430.1(AKT1):c.176-3C>G207AKT1Uncertain significancers1401652672RCV000792227; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105243110105243110GC14:g.105243110G>C-
NM_001382430.1(AKT1):c.176-4G>A207AKT1Likely benignrs776399604RCV000651051; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105243111105243111CT14:g.105243111C>TClinGen:CA7374862C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.176-5C>T207AKT1Uncertain significancers377076374RCV000706963; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105243112105243112GANC_000014.8:g.105243112G>A-C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.176-5C>A207AKT1Uncertain significancers377076374RCV000709352; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105243112105243112GTNC_000014.8:g.105243112G>T-C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.176-5C>G207AKT1Uncertain significance-1RCV001931974; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105243112105243112GC105243112-
NM_001382430.1(AKT1):c.176-8G>A207AKT1Likely benignrs1060504818RCV000460335; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105243115105243115CTNC_000014.8:g.105243115C>TClinGen:CA16614462C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.176-23_176-17del207AKT1Benign-1RCV002092835; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105243124105243130GCCTCTGTG105243123-
NM_001382430.1(AKT1):c.175+100A>T207AKT1Benignrs2494737RCV000860785|RCV001510588; NMedGen:CN517202|MONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105246325105246325TA14:g.105246325T>A-
NM_001382430.1(AKT1):c.175+18C>T207AKT1Benign-1RCV001700563|RCV002073288; NMedGen:CN169374|MONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105246407105246407GA105246407-
NM_001382430.1(AKT1):c.175+18C>G207AKT1Benign-1RCV002177115; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105246407105246407GC105246407-
NM_001382430.1(AKT1):c.175+16G>C207AKT1Likely benign-1RCV002206793; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105246409105246409CG105246409-
NM_001382430.1(AKT1):c.175+5G>A207AKT1Uncertain significancers754417090RCV000805032; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105246420105246420CT14:g.105246420C>T-
NM_001382430.1(AKT1):c.174G>A (p.Ala58=)207AKT1Uncertain significancers560243859RCV000555260; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105246426105246426CTNC_000014.8:g.105246426C>TClinGen:CA7374890C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.165C>T (p.Phe55=)207AKT1Likely benign-1RCV002073452; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105246435105246435GA105246435-
NM_001382430.1(AKT1):c.143G>A (p.Arg48His)207AKT1Uncertain significancers774836044RCV000695576; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105246457105246457CT14:g.105246457C>T-C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.142C>T (p.Arg48Cys)207AKT1Uncertain significancers374093099RCV000531301; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105246458105246458GA14:g.105246458G>AClinGen:CA7374896C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.138C>A (p.Asp46Glu)207AKT1Conflicting interpretations of pathogenicityrs146875699RCV000119959|RCV000231031; NMedGen:CN169374|MONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105246462105246462GT14:g.105246462G>TClinGen:CA156577C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.132T>C (p.Asp44=)207AKT1Likely benign-1RCV002103923; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105246468105246468AG105246468-
NM_001382430.1(AKT1):c.129G>A (p.Gln43=)207AKT1Likely benign-1RCV002137134; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105246471105246471CT105246471-
NM_001382430.1(AKT1):c.126G>A (p.Pro42=)207AKT1Likely benignrs375645311RCV000476958; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105246474105246474CTNC_000014.8:g.105246474C>TClinGen:CA7374898C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.122G>A (p.Arg41Gln)207AKT1Uncertain significancers766000895RCV001227660; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105246478105246478CT14:g.105246478C>T-
NM_001382430.1(AKT1):c.120G>A (p.Glu40=)207AKT1Likely benignrs370287382RCV000554352; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105246480105246480CTNC_000014.8:g.105246480C>TClinGen:CA7374901C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.117G>A (p.Lys39=)207AKT1Uncertain significancers1595251382RCV000816843; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105246483105246483CT14:g.105246483C>T-
NM_001382430.1(AKT1):c.107T>C (p.Ile36Thr)207AKT1Uncertain significancers758157217RCV000686512; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105246493105246493AG14:g.105246493A>G-C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.106A>G (p.Ile36Val)207AKT1Uncertain significancers781339141RCV000465998; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105246494105246494TCNC_000014.8:g.105246494T>CClinGen:CA7374905C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.101C>A (p.Thr34Asn)207AKT1Uncertain significancers750653493RCV001060365; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105246499105246499GT14:g.105246499G>T-
NM_001382430.1(AKT1):c.87C>G (p.Leu29=)207AKT1Likely benign-1RCV002162401; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105246513105246513GC105246513-
NM_001382430.1(AKT1):c.81C>T (p.Phe27=)207AKT1Likely benignrs749781543RCV000651054; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105246519105246519GANC_000014.8:g.105246519G>AClinGen:CA7374909C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.73C>T (p.Arg25Cys)207AKT1Pathogenicrs397514644RCV000033177; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105246527105246527GA14:g.105246527G>AClinGen:CA130749,UniProtKB:P31749#VAR_069791,OMIM:164730.0002C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.68G>A (p.Arg23Gln)207AKT1Uncertain significancers1892954317RCV001294691; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105246532105246532CT105246532-
NC_000014.8:g.105246550_105246551insC207AKT1Uncertain significance-1RCV002049128; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105246550105246551TTC105246550-
NM_001382430.1(AKT1):c.47-4_47-3del207AKT1Uncertain significancers1892956019RCV001202823; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105246556105246557TACT14:g.105246556_105246557del-
NM_001382430.1(AKT1):c.47-4G>T207AKT1Likely benign-1RCV001417354; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105246557105246557CA105246557-
NM_001382430.1(AKT1):c.47-4G>A207AKT1Likely benign-1RCV001498555; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105246557105246557CT105246557-
NM_001382430.1(AKT1):c.47-4G>C207AKT1Likely benign-1RCV002075605; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105246557105246557CG105246557-
NM_001382430.1(AKT1):c.47-5T>C207AKT1Likely benign-1RCV002141182; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105246558105246558AG105246558-
NM_001382430.1(AKT1):c.47-8G>A207AKT1Likely benign-1RCV002115407; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105246561105246561CT105246561-
NM_001382430.1(AKT1):c.47-9C>T207AKT1Likely benignrs776342530RCV000463511; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105246562105246562GANC_000014.8:g.105246562G>AClinGen:CA7374916C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.47-12G>A207AKT1Benign-1RCV002187578; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105246565105246565CT105246565-
NM_001382430.1(AKT1):c.47-13C>T207AKT1Likely benign-1RCV002095177; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105246566105246566GA105246566-
NM_001382430.1(AKT1):c.46+20G>A207AKT1Likely benign-1RCV002211650; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105258915105258915CT105258915-
NM_001382430.1(AKT1):c.46+19G>A207AKT1Likely benign-1RCV002217382; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105258916105258916CT105258916-
NM_001382430.1(AKT1):c.46+16C>T207AKT1Likely benign-1RCV002131084; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105258919105258919GA105258919-
NM_001382430.1(AKT1):c.46+11G>A207AKT1Likely benign-1RCV002123119; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105258924105258924CT105258924-
NM_001382430.1(AKT1):c.46+10C>T207AKT1Likely benignrs372014221RCV000467155; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105258925105258925GANC_000014.8:g.105258925G>AClinGen:CA7374944C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.46+10C>G207AKT1Likely benignrs372014221RCV000651053; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105258925105258925GCNC_000014.8:g.105258925G>CClinGen:CA658798278C3554519 615109 Cowden syndrome 6;
NC_000014.9:g.(?_104792588)_(104792643_?)dup207AKT1Uncertain significance-1RCV001031617; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105258925105258980nana-1-
NM_001382430.1(AKT1):c.46+9C>T207AKT1Likely benign-1RCV002150095; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105258926105258926GA105258926-
NM_001382430.1(AKT1):c.43C>A (p.Arg15=)207AKT1Likely benign-1RCV001494531; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105258938105258938GT105258938-
NM_001382430.1(AKT1):c.16A>G (p.Ile6Val)207AKT1Uncertain significancers1893685625RCV001306742; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105258965105258965TC105258965-
NM_001382430.1(AKT1):c.10G>A (p.Val4Met)207AKT1Uncertain significancers754031503RCV000472618; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105258971105258971CTNC_000014.8:g.105258971C>TClinGen:CA7374949C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.9C>T (p.Asp3=)207AKT1Likely benignrs56217512RCV000547548; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105258972105258972GANC_000014.8:g.105258972G>AClinGen:CA7374950C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.7G>A (p.Asp3Asn)207AKT1Uncertain significancers140532443RCV000461062; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105258974105258974CTNC_000014.8:g.105258974C>TClinGen:CA7374951C3554519 615109 Cowden syndrome 6;
NM_001382430.1(AKT1):c.6C>T (p.Ser2=)207AKT1Likely benign-1RCV001491311; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105258975105258975GA105258975-
NM_001382430.1(AKT1):c.4A>G (p.Ser2Gly)207AKT1Uncertain significancers1566826869RCV000688933; NMONDO:MONDO:0014048,MedGen:C3554519,OMIM:615109, Orphanet:20114105258977105258977TCNC_000014.8:g.105258977T>C-C3554519 615109 Cowden syndrome 6;
MSeqDR Portal