MSeqDR Mitochondrial Disease Portal


 
*:HP: HPO terms, UMDF: 1= Disease, ND: NAMDC terms.
  Most Studied  CPEO, Complex I Deficiency, COXPD1, Leigh, LHON, MELAS, MERRF, Myopathy, SANDO
Disease Browser
Parent Node:
expand
Abnormalities, Multiple (D000015)
Parent Node:
expand
Chromosome Disorders (D025063)
Parent Node:
expand
Intellectual Disability (D008607)
..Starting node
..expand
De Lange Syndrome (D003635)

       Child Nodes:
........expandBrachmann-De Lange-Like Facial Changes With Microcephaly, Metatarsus Adductus, And Developmental Delay (C566206)



 Sister Nodes: 
..expand15q24 Microdeletion (C579849)
..expand16p11.2 Deletion Syndrome (C579850)
..expandAbsent Eyebrows and Eyelashes with Mental Retardation (C563111)
..expandAcrodysostosis (C538179)
..expandAgonadism, XY, with Mental Retardation, Short Stature, Retarded Bone Age, and Multiple Extragenital Malformations (C563429)
..expandAICAR Transformylase Inosine Monophosphate Cyclohydrolase Deficiency (C563876)
..expandAkesson syndrome (C535610)
..expandAl Gazali Aziz Salem syndrome (C535613)
..expandAL-RAQAD SYNDROME (OMIM:616459)
..expandALACRIMA, ACHALASIA, AND MENTAL RETARDATION SYNDROME (OMIM:615510)
..expandAlaninuria with Microcephaly, Dwarfism, Enamel Hypoplasia, and Diabetes Mellitus (C565968)
..expandALAZAMI SYNDROME (OMIM:615071)
..expandALAZAMI-YUAN SYNDROME (OMIM:617126)
..expandAlopecia contractures dwarfism mental retardation (C537051)
..expandAlopecia epilepsy oligophrenia syndrome of Moynahan (C537052)
..expandAlopecia, epilepsy, pyorrhea, mental subnormality (C537057)
..expandAlopecia, Neurologic Defects, and Endocrinopathy Syndrome (C567425)
..expandAlopecia-Mental Retardation Syndrome 1 (C565965)
..expandAlopecia-Mental Retardation Syndrome 2 (C563668)
..expandALOPECIA-MENTAL RETARDATION SYNDROME 3 (OMIM:613930)
..expandAlopecia-Mental Retardation Syndrome with Convulsions and Hypergonadotropic Hypogonadism (C563370)
..expandAlpha-Thalassemia Mental Retardation Syndrome, Deletion-Type (C563050)
..expandAlport Syndrome, Mental Retardation, Midface Hypoplasia, and Elliptocytosis (C564570)
..expandAmino Aciduria with Mental Deficiency, Dwarfism, Muscular Dystrophy, Osteoporosis, and Acidosis (C565960)
..expandAmyloidosis of Gingiva and Conjunctiva, with Mental Retardation (C565958)
..expandAmyotrophic Dystonic Paraplegia (C566292)
..expandAnemia, Congenital Hypoplastic, with Multiple Congenital Anomalies-Mental Retardation Syndrome (C565796)
..expandAniridia cerebellar ataxia mental deficiency (C536370)
..expandAnsell Bywaters Elderking syndrome (C537773)
..expandAortic arch anomaly with peculiar facies and mental retardation (C537785)
..expandAphalangia, Partial, with Syndactyly and Duplication of Metatarsal IV (C563942)
..expandArachnodactyly ataxia cataract aminoaciduria mental retardation (C537424)
..expandArginine:Glycine Amidinotransferase Deficiency (C567192)  LSDB  L: 00444;
..expandArthrogryposis, distal, with hypopituitarism, mental retardation, and facial anomalies (C535385)
..expandArthrogryposis, Distal, with Mental Retardation and Characteristic Facies (C565940)
..expandARTHROGRYPOSIS, MENTAL RETARDATION, AND SEIZURES (OMIM:615553)
..expandAU-KLINE SYNDROME (OMIM:616580)
..expandAughton syndrome (C538269)
..expandAural Atresia, Multiple Congenital Anomalies, and Mental Retardation (C565923)
..expandBaraitser Rodeck Garner syndrome (C537906)
..expandBASEL-VANAGAITE-SMIRIN-YOSEF SYNDROME (OMIM:616449)
..expandBattaglia Neri syndrome (C537662)
..expandBEAULIEU-BOYCOTT-INNES SYNDROME (OMIM:613680)
..expandBehr syndrome (C537669)
..expandBellini Chiumello Rimoldi syndrome (C535652)
..expandBiemond syndrome II (C565902)
..expandBirk-Barel Mental Retardation Dysmorphism Syndrome (C567357)
..expandBlepharophimosis syndrome Ohdo type (C536232)
..expandBlepharophimosis with Facial and Genital Anomalies and Mental Retardation (C565797)
..expandBohring syndrome (C537419)
..expandBOSCH-BOONSTRA-SCHAAF OPTIC ATROPHY SYNDROME (OMIM:615722)
..expandBoudhina Yedes Khiari syndrome (C537939)
..expandBrain Anomalies, Retardation, Ectodermal Dysplasia, Skeletal Malformations, Hirschsprung Disease, Ear-Eye Anomalies, Cleft Palate-Cryptorchidism, And (C564519)
..expandBRANCHED-CHAIN KETO ACID DEHYDROGENASE KINASE DEFICIENCY (OMIM:614923)
..expandBrunner Syndrome (C563156)
..expandBullous Dystrophy, Hereditary Macular Type (C563065)
..expandCAHMR syndrome (C537959)
..expandCamera Marugo Cohen syndrome (C537964)
..expandCantalamessa Baldini Ambrosi syndrome (C537981)
..expandCantu Sanchez-Corona Fragoso syndrome (C535571)
..expandCartwright Nelson Fryns syndrome (C535917)
..expandCataract, Congenital, with Mental Impairment and Dentate Gyrus Atrophy (C564353)
..expandCataracts, ataxia, short stature, and mental retardation (C535345)
..expandCataracts, Congenital, with Sensorineural Deafness, Down Syndrome-Like Facial Appearance, Short Stature, and Mental Retardation (C563390)
..expandCephalin Lipidosis (C565872)
..expandCerebellar Ataxia, Mental Retardation, And Dysequilibrium Syndrome 2 (C567656)
..expandCerebellar Ataxia, Mental Retardation, And Dysequilibrium Syndrome 3 (C567690)
..expandCEREBELLAR ATAXIA, NONPROGRESSIVE, WITH MENTAL RETARDATION (OMIM:614756)
..expandCEREBELLOFACIODENTAL SYNDROME (OMIM:616202)
..expandCerebral Cavernous Malformations 2 (C566394)
..expandCerebral Cavernous Malformations 3 (C566393)
..expandCerebrocostomandibular Syndrome (C562538)
..expandCerebrofaciothoracic Dysplasia (C565862)
..expandCerebrooculofacioskeletal Syndrome 2 (C565185)
..expandCerebrooculofacioskeletal Syndrome 4 (C565184)
..expandCerebrooculonasal Syndrome (C565313)
..expandChoroid plexus calcification with mental retardation (C535357)
..expandCHROMOSOME 13q14 DELETION SYNDROME (OMIM:613884)
..expandChromosome 15q13.3 Microdeletion Syndrome (C567439)
..expandChromosome 15q26-Qter Deletion Syndrome (C567232)
..expandCHROMOSOME 17p13.1 DELETION SYNDROME (OMIM:613776)
..expandChromosome 17q21.31 Deletion Syndrome (C566476)
..expandChromosome 18 Pericentric Inversion (C563734)
..expandChromosome 1q21.1 Duplication Syndrome (C567290)
..expandChromosome 1q43-Q44 Deletion Syndrome (C567346)
..expandChromosome 2q31.2 Deletion Syndrome (C567344)
..expandChromosome 2q32-Q33 Deletion Syndrome (C567350)
..expandChromosome 3q29 Deletion Syndrome (C567184)
..expandCHROMOSOME 7q11.23 DELETION SYNDROME, DISTAL, 1.2-MB (OMIM:613729)
..expandCHROMOSOME 8q21.11 DELETION SYNDROME (OMIM:614230)
..expandChromosome Xq28 Duplication Syndrome (C567580)
..expandChudley-Rozdilsky syndrome (C535458)
..expandCleft Palate, Isolated, And Mental Retardation (C566991)
..expandCoffin syndrome 1 (C536435)
..expandCoffin-Siris syndrome (C536436)
..expandCohen syndrome (C536438)
..expandColoboma, cleft lip-palate and mental retardation syndrome (C535971)
..expandCOLOBOMA, OCULAR, WITH OR WITHOUT HEARING IMPAIRMENT, CLEFT LIP/PALATE, AND/OR MENTAL RETARDATION (OMIM:120433)
..expandColoboma, Uveal, with Cleft Lip and Palate and Mental Retardation (C565173)
..expandColoboma-Obesity-Hypogenitalism-Mental Retardation Syndrome (C566623)
..expandCONGENITAL HEART DEFECTS, DYSMORPHIC FACIAL FEATURES, AND INTELLECTUAL DEVELOPMENTAL DISORDER (OMIM:617360)
..expandConvulsive Disorder, Familial, with Prenatal or Early Onset (C565678)
..expandCorpus Callosum, Agenesis of, with Mental Retardation, Ocular Coloboma, and Micrognathia (C564509)
..expandCortical Blindness, Retardation, and Postaxial Polydactyly (C565674)
..expandCraniofaciofrontodigital Syndrome (C567298)
..expandCraniosynostosis Mental Retardation Clefting Syndrome (C565663)
..expandCraniosynostosis-Mental Retardation Syndrome of Lin and Gettig (C565664)
..expandCree Mental Retardation Syndrome (C564654)
..expandCri-du-Chat Syndrome (D003410) Child6
..expandCryohydrocytosis, Stomatin-Deficient, with Mental Retardation, Seizures, Cataracts, and Massive Hepatosplenomegaly (C563840)
..expandCubitus Valgus with Mental Retardation and Unusual Facies (C564510)
..expandCuratolo Cilio Pessagno syndrome (C536701)
..expandCutis Verticis Gyrata and Mental Deficiency (C565661)
..expandCystic Fibrosis with Helicobacter Pylori Gastritis, Megaloblastic Anemia, and Subnormal Mentality (C565658)
..expandDavis Lafer syndrome (C535989)
..expandDe Barsy syndrome (C535990)
..expandDe Lange Syndrome (D003635) Child1
..expandDe Sanctis-Cacchione syndrome (C535992)
..expandDeafness, Cochlear, with Myopia and Intellectual Impairment (C565645)
..expandDeafness, congenital onychodystrophy, recessive form (C538204)
..expandDevriendt syndrome (C535947)
..expandDiabetes Insipidus, Nephrogenic, with Mental Retardation and Intracerebral Calcification (C565632)
..expandDicarboxylicaminoaciduria (C536171)
..expandDigitorenocerebral Syndrome (C563052)
..expandDislocated Elbows, Bowed Tibias, Scoliosis, Deafness, Cataract, Microcephaly, And Mental Retardation (C566408)
..expandDown Syndrome (D004314) Child6
..expandDubowitz syndrome (C535718)
..expandDuker Weiss Siber syndrome (C535719)
..expandDuplication 15q11-q13 Syndrome (C557830)
..expandDwarfism, Low-Birth-Weight Type, with Unresponsiveness to Growth Hormone (C565615)
..expandDyggve-Melchior-Clausen syndrome (C535726)
..expandDysequilibrium syndrome (C535731)
..expandDysmyelination With Jaundice (C565610)
..expandEctodermal dysplasia mental retardation syndactyly (C538018)
..expandEctodermal Dysplasia, Hypohidrotic, with Hypothyroidism and Agenesis of the Corpus Callosum (C565605)
..expandElliott Ludman Teebi syndrome (C536204)
..expandEmanuel syndrome (C535733)
..expandEmphysema, Congenital, With Deafness, Penoscrotal Web, And Mental Retardation (C566519)
..expandEncephalopathy with Intracranial Calcification, Growth Hormone Deficiency, Microcephaly, and Retinal Degeneration (C565594)
..expandEpidermolysis bullosa, late-onset localized junctional, with mental retardation (C535492)
..expandEpilepsy telangiectasia (C535497)
..expandEpilepsy, Female-Restricted, with Mental Retardation (C564715)
..expandEPILEPSY, FOCAL, WITH SPEECH DISORDER AND WITH OR WITHOUT MENTAL RETARDATION (OMIM:245570)
..expandEPILEPSY, HEARING LOSS, AND MENTAL RETARDATION SYNDROME (OMIM:616577)
..expandEpilepsy, Photogenic, with Spastic Diplegia and Mental Retardation (C565587)
..expandFacial Abnormalities, Kyphoscoliosis, and Mental Retardation (C565580)
..expandFaciocardiomelic Syndrome (C567176)
..expandFallot complex with severe mental and growth retardation (C536608)
..expandFeingold Trainer syndrome (C536179)
..expandFg Syndrome 5 (C564480)
..expandFibromatosis, Gingival, with Hypertrichosis and Mental Retardation (C565331)
..expandFilippi syndrome (C538152)
..expandFine-Lubinsky syndrome (C537933)
..expandFitzsimmons Walson Mellor syndrome (C537937)
..expandFitzsimmons-McLachlan-Gilbert syndrome (C537058)
..expandFountain syndrome (C537270)
..expandFryns-Aftimos Syndrome (C565258)
..expandGarret Tripp syndrome (C535646)
..expandGenitopatellar Syndrome (C565255)
..expandGoniodysgenesis-Mental Retardation-Short Stature Syndrome (C564214)
..expandGrowth and Developmental Retardation, Ocular Ptosis, Cardiac Defect, and Anal Atresia (C565755)
..expandGrowth and mental retardation, mandibulofacial dysostosis, microcephaly, and cleft palate (C537405)
..expandGrowth Deficiency and Mental Retardation with Facial Dysmorphism (C565358)
..expandGrowth Failure, Microcephaly, Mental Retardation, Cataracts, Large Joint Contractures, Osteoporosis, Cortical Dysplasia, and Cerebellar Atrophy (C564264)
..expandGrowth mental deficiency syndrome of Myhre (C537620)
..expandGROWTH RETARDATION, INTELLECTUAL DEVELOPMENTAL DISORDER, HYPOTONIA, AND HEPATOPATHY (OMIM:617093)
..expandGurrieri Sammito Bellussi syndrome (C537625)
..expandHair defect with photosensitivity and mental retardation (C537628)
..expandHall Riggs mental retardation syndrome (C535623)
..expandHAREL-YOON SYNDROME (OMIM:617183)
..expandHarrod Doman Keele syndrome (C535635)
..expandHaspeslagh Fryns Muelenaere syndrome (C535844)
..expandHELSMOORTEL-VAN DER AA SYNDROME (OMIM:615873)
..expandHittner Hirsch Kreh syndrome (C538323)
..expandHoloprosencephaly, Ectrodactyly, and Bilateral Cleft Lip-Palate (C564484)
..expandHooft disease (C535329)
..expandHordnes Engebretsen Knudtson syndrome (C536067)
..expandHoyeraal Hreidarsson syndrome (C536068)
..expandHunter-McAlpine syndrome (C536072)
..expandHydronephrosis, Congenital, with Cleft Palate, Characteristic Facies, Hypotonia, and Mental Retardation (C565736)
..expandHydroxylysinuria (C565502)
..expandHyperleucine-Isoleucinemia (C562674)
..expandHyperlysinemia Due To Defect In Lysine Transport Into Mitochondria (C565499)
..expandHyperphosphatasia with Mental Retardation (C565495) Child2
..expandHypertelorism, Severe, With Midface Prominence, Myopia, Mental Retardation, And Bone Fragility (C566988)
..expandHypertrichosis, hyperkeratosis, mental retardation, and distinctive facial features (C538391)
..expandHyperuricemia, Infantile, with Abnormal Behavior and Normal Hypoxanthine Guanine Phosphoribosyltransferase (C565489)
..expandHypogonadism with Low-Grade Mental Deficiency and Microcephaly (C565482)
..expandHypogonadism, Male, With Mental Retardation And Skeletal Anomalies (C564406)
..expandHYPOMAGNESEMIA, SEIZURES, AND MENTAL RETARDATION (OMIM:616418)
..expandHypoparathyroidism-retardation-dysmorphism syndrome (C537157)
..expandHypospadias-Mental Retardation Syndrome (C563067)
..expandHypotonia-Cystinuria Syndrome (C564710)  LSDB  L: 00416;
..expandIchthyosis and male hypogonadism (C537365)
..expandIchthyosis, mental retardation, dwarfism, and renal impairment (C536274)
..expandIchthyosis-Mental Retardation Syndrome with Large Keratohyalin Granules in the Skin (C563402)
..expandIndolylacroyl Glycinuria with Mental Retardation (C565466)
..expandINTELLECTUAL DEVELOPMENTAL DISORDER WITH CARDIAC ARRHYTHMIA (OMIM:617173)
..expandINTELLECTUAL DEVELOPMENTAL DISORDER WITH DYSMORPHIC FACIES AND PTOSIS (OMIM:617333)
..expandINTELLECTUAL DEVELOPMENTAL DISORDER WITH DYSMORPHIC FACIES, SEIZURES, AND DISTAL LIMB ANOMALIES (OMIM:617452)
..expandINTELLECTUAL DEVELOPMENTAL DISORDER WITH GASTROINTESTINAL DIFFICULTIES AND HIGH PAIN THRESHOLD (OMIM:617450)
..expandINTELLECTUAL DEVELOPMENTAL DISORDER WITH PERSISTENCE OF FETAL HEMOGLOBIN (OMIM:617101)
..expandIris Coloboma with Ptosis, Hypertelorism, and Mental Retardation (C565462)
..expandJagell Holmgren Hofer syndrome (C537364)
..expandJohanson Blizzard syndrome (C535880)
..expandJoubert Syndrome 7 (C566916)
..expandJoubert Syndrome 9 (C567364)
..expandKahrizi Syndrome (C567196)
..expandKaler Garrity Stern syndrome (C537706)
..expandKapur Toriello syndrome (C537008)
..expandKarandikar Maria Kamble syndrome (C537009)
..expandKatsantoni Papadakou Lagoyanni syndrome (C537012)
..expandKaufman oculocerebrofacial syndrome (C537013)
..expandKBG syndrome (C537015)
..expandKEPPEN-LUBINSKY SYNDROME (OMIM:614098)
..expandKleefstra Syndrome (C563043)
..expandKoone Rizzo Elias syndrome (C537023)
..expandKosztolanyi syndrome (C537024)
..expandKozlowski Ouvrier syndrome (C537508)
..expandKozlowski Rafinski Klicharska syndrome (C537509)
..expandKozlowski-Krajewska syndrome (C537615)
..expandKuzniecky syndrome (C538091)
..expandLAMB-SHAFFER SYNDROME (OMIM:616803)
..expandLambert syndrome (C538396)
..expandLenz Majewski hyperostotic dwarfism (C537115)
..expandLeukomelanoderma, Infantilism, Mental Retardation, Hypodontia, Hypotrichosis (C565440)
..expandLight Fixation Seizure Syndrome (C566367)
..expandLimb Defects, Distal Transverse, with Mental Retardation and Spasticity (C565438)
..expandLipodystrophy, Generalized, with Mental Retardation, Deafness, Short Stature, and Slender Bones (C564283)
..expandLissencephaly 3 (C566908)
..expandLowry Maclean syndrome (C537037)
..expandLowry Wood syndrome (C537038)
..expandLubani Al Saleh Teebi syndrome (C537039)
..expandLUSCAN-LUMISH SYNDROME (OMIM:616831)
..expandLynch Lee Murday syndrome (C537713)
..expandMacrogyria, pseudobulbar palsy and mental retardation (C537722)
..expandMacrosomia obesity macrocephaly ocular abnormalities (C535812)
..expandMale pseudohermaphroditism-mental retardation syndrome, Verloes type (C535693)
..expandMandibulofacial Dysostosis with Mental Deficiency (C565420)
..expandMarfanoid Mental Retardation Syndrome, Autosomal (C565410)
..expandMarinesco-Sjogren-like syndrome (MSLS) (C535913)
..expandMartin-Probst Deafness-Mental Retardation Syndrome (C564495)
..expandMartsolf syndrome (C536028)
..expandMASA (Mental Retardation, Aphasia, Shuffling Gait, Adducted Thumbs) Syndrome (C536029)
..expandMcDonough syndrome (C538158)
..expandMEGALENCEPHALIC LEUKOENCEPHALOPATHY WITH SUBCORTICAL CYSTS 2B, REMITTING, WITH OR WITHOUT MENTAL RETARDATION (OMIM:613926)
..expandMEND SYNDROME (OMIM:300960)
..expandMental and Growth Retardation with Amblyopia (C563591)
..expandMENTAL RETARDATION AND DISTINCTIVE FACIAL FEATURES WITH OR WITHOUT CARDIAC DEFECTS (OMIM:616789)
..expandMental Retardation associated with Psoriasis (C564107)
..expandMental retardation Mietens Weber type (C537444)
..expandMental retardation Smith Fineman Myers type (C537445)
..expandMental retardation spasticity ectrodactyly (C537446)
..expandMental retardation syndrome, Belgian type (C537447)
..expandMENTAL RETARDATION WITH LANGUAGE IMPAIRMENT AND WITH OR WITHOUT AUTISTIC FEATURES (OMIM:613670)
..expandMental Retardation with Optic Atrophy, Facial Dysmorphism, Microcephaly, and Short Stature (C563810)
..expandMental Retardation with Spastic Paraplegia (C564099)
..expandMental retardation Wolff type (C537448)
..expandMENTAL RETARDATION, ANTERIOR MAXILLARY PROTRUSION, AND STRABISMUS (OMIM:613671)
..expandMental Retardation, Autosomal Dominant 1 (C566947)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 10 (OMIM:614256)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 11 (OMIM:614257)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 13 (OMIM:614563)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 18 (OMIM:615074)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 19 (OMIM:615075)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 2 (OMIM:614113)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 20 (OMIM:613443)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 21 (OMIM:615502)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 22 (OMIM:612337)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 23 (OMIM:615761)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 24 (OMIM:615828)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 26 (OMIM:615834)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 27 (OMIM:615866)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 29 (OMIM:616078)
..expandMental Retardation, Autosomal Dominant 3 (C567241)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 30 (OMIM:616083)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 31 (OMIM:616158)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 32 (OMIM:616268)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 33 (OMIM:616311)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 34 (OMIM:616351)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 35 (OMIM:616355)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 36 (OMIM:616362)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 38 (OMIM:616393)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 39 (OMIM:616521)
..expandMental Retardation, Autosomal Dominant 4 (C567240)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 40 (OMIM:616579)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 41 (OMIM:616944)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 42 (OMIM:616973)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 43 (OMIM:616977)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 44 (OMIM:617061)
..expandMental Retardation, Autosomal Dominant 5 (C567234)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 6, WITH OR WITHOUT SEIZURES (OMIM:613970)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 7 (OMIM:614104)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 9 (OMIM:614255)
..expandMental Retardation, Autosomal Recessive 1 (C565406)
..expandMental Retardation, Autosomal Recessive 10 (C567013)
..expandMental Retardation, Autosomal Recessive 11 (C567012)
..expandMental Retardation, Autosomal Recessive 12 (C567019)
..expandMental Retardation, Autosomal Recessive 13 (C567714)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 14 (OMIM:614020)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 15 (OMIM:614202)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 16 (OMIM:614208)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 18 (OMIM:614249)
..expandMental Retardation, Autosomal Recessive 2 (C564404)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 27 (OMIM:614340)
..expandMental Retardation, Autosomal Recessive 3 (C563929)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 34, WITH VARIANT LISSENCEPHALY (OMIM:614499)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 36 (OMIM:615286)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 37 (OMIM:615493)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 38 (OMIM:615516)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 39 (OMIM:615541)
..expandMental Retardation, Autosomal Recessive 4 (C567008)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 40 (OMIM:615599)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 41 (OMIM:615637)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 42 (OMIM:615802)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 43 (OMIM:615817)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 44 (OMIM:615942)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 45 (OMIM:615979)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 46 (OMIM:616116)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 47 (OMIM:616193)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 48 (OMIM:616269)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 49 (OMIM:616281)
..expandMental Retardation, Autosomal Recessive 5 (C567018)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 50 (OMIM:616460)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 51 (OMIM:616739)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 52 (OMIM:616887)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 53 (OMIM:616917)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 54 (OMIM:617028)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 55 (OMIM:617051)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 56 (OMIM:617125)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 57 (OMIM:617188)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 58 (OMIM:617270)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 59 (OMIM:617323)
..expandMental Retardation, Autosomal Recessive 6 (C567017)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 60 (OMIM:617432)
..expandMental Retardation, Autosomal Recessive 7 (C567016)
..expandMental Retardation, Autosomal Recessive 8 (C567015)
..expandMental Retardation, Autosomal Recessive 9 (C567014)
..expandMental Retardation, Buenos Aires Type (C563095)
..expandMental Retardation, Fra12a Type (C566980)
..expandMental Retardation, Joint Hypermobility, And Skin Laxity, With Or Without Metabolic Abnormalities (C567209)
..expandMental retardation, keratoconus, febrile seizures, and sinoatrial block (C537452)
..expandMental retardation, macrocephaly, short stature and craniofacial dysmorphism (C537453)
..expandMental Retardation, Microcephaly, Epilepsy, And Coarse Face (C563342)
..expandMental Retardation, Microcephaly, Growth Retardation, Joint Contractures, and Facial Dysmorphism (C565246)
..expandMental Retardation, Severe, With Spasticity And Pigmentary Tapetoretinal Degeneration (C566429)
..expandMental Retardation, Short Stature, Facial Anomalies, and Joint Dislocations (C565248)
..expandMental Retardation, Skeletal Dysplasia, and Abducens Palsy (C564101)
..expandMental Retardation, X-Linked (D038901) Child134  LSDB C:4
..expandMental Retardation, X-Linked, Syndromic 12 (C564106)
..expandMental Retardation, X-Linked, Syndromic, Christianson Type (C567484)
..expandMental Retardation, X-Linked, Syndromic, Turner Type (C567476)
..expandMental Retardation, X-Linked, Syndromic, Zdhhc9-Related (C567586)
..expandMental Retardation, X-Linked, With Panhypopituitarism (C567485)
..expandMental Retardation, X-Linked, Znf711-Related (C567583)
..expandMetaphyseal Dysostosis, Mental Retardation, and Conductive Deafness (C565396)
..expandMethionine Malabsorption Syndrome (C562682)
..expandMicrocephalic primordial dwarfism Toriello type (C537321)
..expandMicrocephaly cervical spine fusion anomalies (C537325)
..expandMicrocephaly deafness syndrome (C537326)
..expandMicrocephaly seizures mental retardation heart disorders (C537544)
..expandMicrocephaly sparse hair mental retardation seizures (C537545)
..expandMicrocephaly with Mental Retardation and Digital Anomalies (C567101)
..expandMICROCEPHALY WITH OR WITHOUT CHORIORETINOPATHY, LYMPHEDEMA, OR MENTAL RETARDATION (OMIM:152950)
..expandMicrocephaly, corpus callosum dysgenesis and cleft lip-palate (C537547)
..expandMicrocephaly, Facial Abnormalities, Micromelia, and Mental Retardation (C566361)
..expandMicrocephaly, Macrotia, And Mental Retardation (C566525)
..expandMicrophthalmia and mental deficiency (C537462)
..expandMirhosseini-Holmes-Walton syndrome (C538367)
..expandMohr-Tranebjaerg syndrome (C535808)  LSDB  L: 00113;
..expandMollica Pavone Antener syndrome (C535809)
..expandMOMES Syndrome (C564660)
..expandMorillo-Cucci Passarge syndrome (C536983)
..expandMORM syndrome (C536984)
..expandMowat-Wilson syndrome (C536990)
..expandMuscular Dystrophy, Congenital, associated with Calf Hypertrophy, Microcephaly, and Severe Mental Retardation (C565506)
..expandMuscular Dystrophy, Congenital, plus Mental Retardation (C565505)
..expandMuscular Dystrophy, Congenital, Type 1D (C563844)
..expandMUSCULAR DYSTROPHY, CONGENITAL, WITH CATARACTS AND INTELLECTUAL DISABILITY (OMIM:617404)
..expandMUSCULAR DYSTROPHY-DYSTROGLYCANOPATHY (CONGENITAL WITH MENTAL RETARDATION), TYPE B, 1 (OMIM:613155)
..expandMUSCULAR DYSTROPHY-DYSTROGLYCANOPATHY (CONGENITAL WITH MENTAL RETARDATION), TYPE B, 14 (OMIM:615351)
..expandMUSCULAR DYSTROPHY-DYSTROGLYCANOPATHY (CONGENITAL WITH MENTAL RETARDATION), TYPE B, 2 (OMIM:613156)
..expandMUSCULAR DYSTROPHY-DYSTROGLYCANOPATHY (CONGENITAL WITH MENTAL RETARDATION), TYPE B, 3 (OMIM:613151)
..expandMUSCULAR DYSTROPHY-DYSTROGLYCANOPATHY (CONGENITAL WITH MENTAL RETARDATION), TYPE B, 6 (OMIM:608840)
..expandMyotonia with Skeletal Abnormalities and Mental Retardation (C564967)
..expandN syndrome (C536108)
..expandNakamura Osame syndrome (C538335)
..expandNeuhauser syndrome (C536143)
..expandNEURODEVELOPMENTAL DISORDER WITH OR WITHOUT HYPERKINETIC MOVEMENTS AND SEIZURES, AUTOSOMAL DOMINANT (OMIM:614254)
..expandNeurofaciodigitorenal syndrome (C537388)
..expandNeurologic Disease, Infantile Multisystem, with Osseous Fragility (C564954)
..expandNF1 Microdeletion Syndrome (C563524)
..expandNF1 Microduplication Syndrome (C567173)
..expandNicolaides Baraitser syndrome (C536116)
..expandOculodigitoesophagoduodenal syndrome (C537734)
..expandOKUR-CHUNG NEURODEVELOPMENTAL SYNDROME (OMIM:617062)
..expandOliver Syndrome (C564931)
..expandOliver-McFarlane syndrome (C536554)
..expandOnychotrichodysplasia and neutropenia (C537752)
..expandOphthalmoplegia, Progressive, with Scrotal Tongue and Mental Deficiency (C563498)
..expandOpitz trigonocephaly syndrome (C537418)
..expandOPTIC ATROPHY 10 WITH OR WITHOUT ATAXIA, MENTAL RETARDATION, AND SEIZURES (OMIM:616732)
..expandOsteolysis syndrome recessive (C536052)
..expandPACHYGYRIA WITH MENTAL RETARDATION, SEIZURES, AND ARACHNOID CYSTS (OMIM:600176)
..expandPalant cleft palate syndrome (C538102)
..expandPallister W syndrome (C538106)
..expandParastremmatic dwarfism (C537172)
..expandParkinsonism, early onset with mental retardation (C537179)
..expandPashayan syndrome (C536303)
..expandPatella hypoplasia mental retardation (C536308)
..expandPavone Fiumara Rizzo syndrome (C536313)
..expandPerisylvian syndrome (C536658)
..expandPerniola Krajewska Carnevale syndrome (C536660)
..expandPfeiffer Kapferer syndrome (C537887)
..expandPfeiffer Mayer syndrome (C537888)
..expandPfeiffer Tietze Welte syndrome (C537891)
..expandPHOSPHOSERINE PHOSPHATASE DEFICIENCY (OMIM:614023)
..expandPilotto syndrome (C537400)
..expandPitt-Hopkins syndrome (C537403)
..expandPiussan Lenaerts Mathieu syndrome (C537511)
..expandPrader-Willi Syndrome (D011218) Child2
..expandPrimrose syndrome (C536420)
..expandProlonged Bleeding Time, Brachydactyly, and Mental Retardation (C564207)
..expandProud Syndrome (C563110)
..expandPrune Belly Syndrome with Pulmonic Stenosis, Mental Retardation, and Deafness (C562894)
..expandPseudoaminopterin syndrome (C535823)
..expandPseudouridinuria and Mental Defect (C564864)
..expandPterygium colli mental retardation digital anomalies (C535831)
..expandQazi Markouizos syndrome (C536259)
..expandRadioulnar synostosis retinal pigment abnormalities (C536270)
..expandRamon Syndrome (C535285)
..expandRamos Arroyo Clark syndrome (C535286)
..expandReardon Wilson Cavanagh syndrome (C535295)
..expandRenal Tubular Acidosis, Proximal, With Ocular Abnormalities And Mental Retardation (C567038)
..expandRetinitis Pigmentosa, Deafness, Mental Retardation, and Hypogonadism (C564841)
..expandRichards-Rundle syndrome (C535674)
..expandRobin Sequence with Distinctive Facial Appearance and Brachydactyly (C563880)
..expandRolandic Epilepsy, Mental Retardation, And Speech Dyspraxia, Autosomal Dominant (C563392)
..expandRolandic Epilepsy, Mental Retardation, and Speech Dyspraxia, X-Linked (C564467)
..expandRubinstein-Taybi Syndrome (D012415) Child2
..expandRud Syndrome (C535878)
..expandRuzicka Goerz Anton syndrome (C537192)
..expandSammartino De Crecchio Syndrome (C537229)
..expandSao Paulo MCA-MR Syndrome (C563119)
..expandScaphocephaly, Maxillary Retrusion, And Mental Retardation (C566511)
..expandSCARF syndrome (C536625)
..expandSchinzel-Giedion syndrome (C536632)
..expandSchofer Beetz Bohl syndrome (C535949)
..expandScholte syndrome (C536638)
..expandSchrander-Stumpel Theunissen Hulsmans syndrome (C536639)
..expandSclerosing bone dysplasia mental retardation (C537523)
..expandScott Bryant Graham syndrome (C537528)
..expandSeckel Syndrome 3 (C563881)
..expandSECKEL SYNDROME 4 (OMIM:613676)
..expandSeemanova Lesny syndrome (C537536)
..expandSeSAME syndrome (C557674)
..expandShort Stature, Mental Retardation, Callosal Agenesis, Heminasal Hypoplasia, Microphthalmia, And Atypical Clefting (C566989)
..expandSimpson-Golabi-Behmel syndrome (C537340)
..expandSingh Chhaparwal Dhanda syndrome (C537341)
..expandSkeletal Defects, Genital Hypoplasia, And Mental Retardation (C567306)
..expandSketetal dysplasia coarse facies mental retardation (C536671)
..expandSpastic Ataxia (C564815)
..expandSpastic diplegia infantile type (C537481)
..expandSpastic paraplegia 14, autosomal recessive (C537486)
..expandSpastic Paraplegia 18, Autosomal Recessive (C567628)
..expandSpastic Paraplegia 32, Autosomal Recessive (C566983)
..expandSpastic paraplegia epilepsy mental retardation (C536869)
..expandSpastic Paraplegia, Ataxia, And Mental Retardation (C564378)
..expandSpastic Paraplegia, Sensorineural Deafness, Mental Retardation, And Progressive Nephropathy (C566682)
..expandSpastic Paresis, Glaucoma, and Mental Retardation (C564809)
..expandSpastic Quadriplegia, Retinitis Pigmentosa, and Mental Retardation (C564808)
..expandSpinal Muscular Atrophy with Mental Retardation (C564807)
..expandSpinal Muscular Atrophy with Microcephaly and Mental Subnormality (C564806)
..expandSpondyloepimetaphyseal dysplasia, Genevieve type (C535785)
..expandSpondyloepiphyseal Dysplasia Tarda with Mental Retardation (C564796)
..expandSpondyloepiphyseal Dysplasia With Coronal Craniosynostosis, Cataracts, Cleft Palate, And Mental Retardation (C566515)
..expandStevenson-Carey Syndrome (C567446)
..expandSucrosuria, Hiatus Hernia and Mental Retardation (C564792)
..expandSUPERNUMERARY DER(22)t(8 (OMIM:613700)
..expandTAKENOUCHI-KOSAKI SYNDROME (OMIM:616737)
..expandTamari Goodman syndrome (C536896)
..expandTATTON-BROWN-RAHMAN SYNDROME (OMIM:615879)
..expandTemple-Baraitser Syndrome (C567516)
..expandTemtamy preaxial brachydactyly syndrome (C536958)
..expandTENORIO SYNDROME (OMIM:616260)
..expandTetrasomy X (C536502)
..expandTonoki syndrome (C536967)
..expandTrichodental syndrome (C536551)
..expandTRICHOTHIODYSTROPHY 1, PHOTOSENSITIVE (OMIM:601675)
..expandTrisomy 13 Syndrome (D000073839)
..expandTryptophanuria With Dwarfism (C562658)
..expandTsukahara Syndrome (C566376)
..expandUlna hypoplasia with mental retardation (C536934)
..expandUlnar Hypoplasia with Mental Retardation (C564757)
..expandUpton Young syndrome (C536473)
..expandVan Bogaert-Hozay syndrome (C536526)
..expandVan Den Bosch Syndrome (C563129)
..expandVan Maldergem Wetzburger Verloes syndrome (C536530)
..expandVasquez Hurst Sotos syndrome (C536533)
..expandVerloes Gillerot Fryns syndrome (C536539)
..expandViljoen Kallis Voges syndrome (C536349)
..expandVitiligo, Progressive, with Mental Retardation and Urethral Duplication (C564739)
..expandVolcke Soekarman syndrome (C537718)
..expandWAGR Syndrome (D017624) Child2
..expandWalker Dyson syndrome (C536568)
..expandWarburg Sjo Fledelius syndrome (C536681)
..expandWarburton Anyane Yeboa syndrome (C536682)
..expandWiedemann Grosse Dibbern syndrome (C536704)
..expandWiedemann Oldigs Oppermann syndrome (C536705)
..expandWIEDEMANN-STEINER SYNDROME (OMIM:605130)
..expandWilliams Syndrome (D018980) Child1
..expandWinship Viljoen Leary syndrome (C536711)
..expandWoodhouse Sakati syndrome (C536742)
..expandWorster Drought syndrome (C536747)
..expandXIA-GIBBS SYNDROME (OMIM:615829)
..expandYorifuji Okuno syndrome (C536714)
..expandYoung Hughes syndrome (C536715)
..expandYoung Simpson syndrome (C536717)
..expandZazam Sheriff Phillips syndrome (C536723)
..expandZechi-Ceide Syndrome (C567865)
..expandZerres Rietschel Majewski syndrome (C536724)
..expandZlotogora-Ogur syndrome (C536726)
..expandZTTK SYNDROME (OMIM:617140)
..expandZunich neuroectodermal syndrome (C536729)
   

Human Disease MESH is developed by UMLS.
Further data from MedGen, OMIM,ClinVar, CTD
Term ID:3498
Name:De Lange Syndrome
Definition:A syndrome characterized by growth retardation, severe MENTAL RETARDATION, short stature, a low-pitched growling cry, brachycephaly, low-set ears, webbed neck, carp mouth, depressed nasal bridge, bushy eyebrows meeting at the midline, hirsutism, and malformations of the hands. The condition may occur sporadically or be associated with an autosomal dominant pattern of inheritance or duplication of the long arm of chromosome 3. (Menkes, Textbook of Child Neurology, 5th ed, p231)
Alternative IDs:DO:DOID:11725|OMIM:122470|OMIM:300590|OMIM:610759|OMIM:614701
ParentIDs:MESH:D000015|MESH:D008607|MESH:D025063
TreeNumbers:C10.597.606.360.210 |C16.131.077.272 |C16.131.260.210 |C16.320.180.210
Synonyms:Amstelodamensis, Typus Degenerativus |BDLS |Brachmann De Lange Syndrome |Brachmann-De Lange Syndrome |CDL |CDLS |CDLS1 |CdLS2 |CDLS3 |CDLS4 |CdLS, X-Linked |Cornelia De Lange Syndrome |Cornelia de Lange Syndrome 1 |Cornelia de Lange Syndrome 2 |Cornelia de Lange Syndr
Slim Mappings:Congenital abnormality|Genetic disease (inborn)|Nervous system disease
Reference: MedGen: D003635
MeSH: D003635
OMIM: 300590;
MSeqDR LSDB:  
Genes: NIPBL; RAD21; SMC1A; SMC3;
Phenotypes
1 HP:0001423X-linked dominant inheritance
2 HP:0001419X-linked recessive inheritance
3 HP:0000463Anteverted nares
4 HP:0000248Brachycephaly
5 HP:0001156Brachydactyly
6 HP:0030084Clinodactyly
7 HP:0100543Cognitive impairment
NAMDC:  Cognitive delay
8 HP:0000965Cutis marmorata
9 HP:0000494Downslanted palpebral fissures
10 HP:0002714Downturned corners of mouth
11 HP:0002020Gastroesophageal reflux
12 HP:0001263Global developmental delay
NAMDC:  Delayed development (evidence of at least one of A through F)
13 HP:0001263Global developmental delay
NAMDC:  Mental retardation
14 HP:0000218High palate
15 HP:0002553Highly arched eyebrow
16 HP:0001007Hirsutism
17 HP:0001639Hypertrophic cardiomyopathy
NAMDC:  Hypertrophic cardomyopathy
HP:0040283
18 HP:0001249Intellectual disability
19 HP:0001511Intrauterine growth retardation
20 HP:0002996Limited elbow movement
21 HP:0000527Long eyelashes
22 HP:0000294Low anterior hairline
23 HP:0000252Microcephaly
24 HP:0000347Micrognathia
25 HP:0000341Narrow forehead
26 HP:0002465Poor speech
27 HP:0000426Prominent nasal bridge
28 HP:0009623Proximal placement of thumb
29 HP:0000508Ptosis
NAMDC:  Ptosis
30 HP:0001250Seizures
NAMDC:  Seizures
HP:0040283
31 HP:0001773Short foot
32 HP:0000470Short neck
33 HP:0004322Short stature
NAMDC:  Short stature (patient¡¯s height is below the 3rd percentile)
34 HP:0200055Small hand
35 HP:0000319Smooth philtrum
36 HP:0000664Synophrys
37 HP:0000574Thick eyebrow
38 HP:0000219Thin upper lip vermilion
39 HP:0002119Ventriculomegaly
Disease Causing ClinVar Variants
Variation_NameGeneIDGeneSymbolClinicalSignificancedbSNPRCVaccessionTestedInGTRPhenotypeIDsChromosomeStartStopHGVS_cHGVS_pHGVS_gOtherIDsDisease_ClinVar
NC_000023.10:g.(?_53276131)_(53449569_?)dup8243SMC1AUncertain significance-1RCV001032472; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5327613153449569nana-1-
NC_000023.10:g.(?_53349595)_(53410194_?)dup8243SMC1AUncertain significance-1RCV000707763; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5334959553410194nana-C2931498 300551 Mental retardation, X-linked 1;
NC_000023.10:g.(?_53349615)_(53410174_?)dup8243SMC1AUncertain significance-1RCV000708248; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5334961553410174nana-C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_006306.4(SMC1A):c.*5946C>T8243SMC1AUncertain significance-1RCV001166985; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340107853401078GAX:g.53401078G>A-
NM_001281463.1(SMC1A):c.*5915T>C8243SMC1AUncertain significancers1057515951RCV000296125; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340110953401109AGX:g.53401109A>GClinGen:CA10646281CN239271 Cornelia de Lange Syndrome;
NM_006306.4(SMC1A):c.*5855G>T8243SMC1AUncertain significance-1RCV001166986; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340116953401169CAX:g.53401169C>A-
NM_006306.4(SMC1A):c.*5853A>G8243SMC1AUncertain significance-1RCV001166987; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340117153401171TCX:g.53401171T>C-
NM_006306.4(SMC1A):c.*5722A>T8243SMC1AUncertain significance-1RCV001166988; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340130253401302TAX:g.53401302T>A-
NM_001281463.1(SMC1A):c.*5692G>A8243SMC1AUncertain significancers1057515952RCV000343963; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340133253401332CTX:g.53401332C>TClinGen:CA10646283CN239271 Cornelia de Lange Syndrome;
NM_006306.4(SMC1A):c.*5506A>T8243SMC1AUncertain significance-1RCV001166989; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340151853401518TAX:g.53401518T>A-
NM_006306.4(SMC1A):c.*5489G>T8243SMC1AUncertain significance-1RCV001168695; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340153553401535CAX:g.53401535C>A-
NM_001281463.1(SMC1A):c.*5481G>A8243SMC1ABenignrs147896900RCV000401379; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340154353401543CTX:g.53401543C>TClinGen:CA10646292CN239271 Cornelia de Lange Syndrome;
NM_006306.4(SMC1A):c.*5451A>G8243SMC1AUncertain significance-1RCV001168696; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340157353401573TCX:g.53401573T>C-
NM_001281463.1(SMC1A):c.*5444G>A8243SMC1ABenignrs181871602RCV000308965; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340158053401580CTX:g.53401580C>TClinGen:CA10654359CN239271 Cornelia de Lange Syndrome;
NM_006306.4(SMC1A):c.*5443C>G8243SMC1AUncertain significance-1RCV001168697; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340158153401581GCX:g.53401581G>C-
NM_001281463.1(SMC1A):c.*5355G>A8243SMC1AUncertain significancers782143840RCV000407573; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340166953401669CTX:g.53401669C>TClinGen:CA10654360
NM_001281463.1(SMC1A):c.*5352C>T8243SMC1AUncertain significancers1057515953RCV000302908; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340167253401672GAX:g.53401672G>AClinGen:CA10646297
NM_006306.4(SMC1A):c.*5251G>T8243SMC1AUncertain significance-1RCV001169465; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340177353401773CAX:g.53401773C>A-
NM_001281463.1(SMC1A):c.*5197T>C8243SMC1AUncertain significancers782050365RCV000360036; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340182753401827AGX:g.53401827A>GClinGen:CA10646300
NM_006306.4(SMC1A):c.*5051G>T8243SMC1AUncertain significance-1RCV001169466; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340197353401973CAX:g.53401973C>A-
NM_001281463.1(SMC1A):c.*5016T>C8243SMC1ABenignrs17002602RCV000267480; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340200853402008AGX:g.53402008A>GClinGen:CA10653998
NM_006306.4(SMC1A):c.*4998T>C8243SMC1AUncertain significance-1RCV001169467; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340202653402026AGX:g.53402026A>G-
NM_006306.4(SMC1A):c.*4887T>C8243SMC1ABenign-1RCV001169468; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340213753402137AGX:g.53402137A>G-
NM_001281463.1(SMC1A):c.*4581T>C8243SMC1AUncertain significancers1057515955RCV000261703; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340244353402443AGX:g.53402443A>GClinGen:CA10651999
NM_001281463.1(SMC1A):c.*4443G>A8243SMC1AUncertain significancers782630117RCV000319257; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340258153402581CTX:g.53402581C>TClinGen:CA10646307
NM_001281463.1(SMC1A):c.*4382A>G8243SMC1AUncertain significancers906340789RCV000386222; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340264253402642TCX:g.53402642T>CClinGen:CA10652000
NM_006306.4(SMC1A):c.*4367T>C8243SMC1AUncertain significance-1RCV001166523; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340265753402657AGX:g.53402657A>G-
NM_006306.4(SMC1A):c.*4156A>G8243SMC1AUncertain significance-1RCV001166524; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340286853402868TCX:g.53402868T>C-
NM_001281463.1(SMC1A):c.*4087G>A8243SMC1AUncertain significancers1057515957RCV000275366; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340293753402937CTX:g.53402937C>TClinGen:CA10654004
NM_001281463.1(SMC1A):c.*3851A>T8243SMC1ABenignrs782817464RCV000332914; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340317353403173TAX:g.53403173T>AClinGen:CA10654362
NM_001281463.1(SMC1A):c.*3807G>A8243SMC1AUncertain significancers1057515958RCV000288481; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340321753403217CTX:g.53403217C>TClinGen:CA10652002
NM_001281463.1(SMC1A):c.*3777C>G8243SMC1AUncertain significancers41315082RCV000345829; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340324753403247GCX:g.53403247G>CClinGen:CA10646313
NM_001281463.1(SMC1A):c.*3671C>T8243SMC1AUncertain significancers1057515959RCV000384093; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340335353403353GAX:g.53403353G>AClinGen:CA10652005
NM_006306.4(SMC1A):c.*3596C>T8243SMC1AUncertain significance-1RCV001167040; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340342853403428GAX:g.53403428G>A-
NM_006306.4(SMC1A):c.*3484G>A8243SMC1AUncertain significance-1RCV001167041; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340354053403540CTX:g.53403540C>T-
NM_001281463.1(SMC1A):c.*3421G>T8243SMC1ABenignrs41304780RCV000291567; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340360353403603CAX:g.53403603C>AClinGen:CA10646318
NM_006306.4(SMC1A):c.*3392T>C8243SMC1AUncertain significance-1RCV001168753; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340363253403632AGX:g.53403632A>G-
NM_001281463.1(SMC1A):c.*3305A>G8243SMC1AUncertain significancers1057515960RCV000340069; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340371953403719TCX:g.53403719T>CClinGen:CA10654363
NM_006306.4(SMC1A):c.*3087G>A8243SMC1ALikely benign-1RCV001168754; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340393753403937CTX:g.53403937C>T-
NM_006306.4(SMC1A):c.*3025C>T8243SMC1AUncertain significance-1RCV001168755; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340399953403999GAX:g.53403999G>A-
NM_001281463.1(SMC1A):c.*2948G>T8243SMC1AUncertain significancers183355603RCV000304927; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340407653404076CAX:g.53404076C>AClinGen:CA10654364
NM_006306.4(SMC1A):c.*2936C>T8243SMC1AUncertain significance-1RCV001168756; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340408853404088GAX:g.53404088G>A-
NM_001281463.1(SMC1A):c.*2856A>T8243SMC1ABenignrs148128199RCV000343474; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340416853404168TAX:g.53404168T>AClinGen:CA10654365
NM_001281463.1(SMC1A):c.*2663C>T8243SMC1AUncertain significancers1057515961RCV000407953; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340436153404361GAX:g.53404361G>AClinGen:CA10654366
NM_001281463.1(SMC1A):c.*2609A>C8243SMC1AUncertain significancers192734396RCV000298907; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340441553404415TGX:g.53404415T>GClinGen:CA10646323
NM_001281463.1(SMC1A):c.*2490T>C8243SMC1AUncertain significancers1057515962RCV000312235; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340453453404534AGX:g.53404534A>GClinGen:CA10654367
NM_001281463.1(SMC1A):c.*2435T>G8243SMC1AUncertain significancers782650092RCV000369305; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340458953404589ACX:g.53404589A>CClinGen:CA10652007
NM_001281463.1(SMC1A):c.*2423G>A8243SMC1ABenignrs147324052RCV000276889; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340460153404601CTX:g.53404601C>TClinGen:CA10646324
NM_006306.4(SMC1A):c.*2389G>T8243SMC1ABenign-1RCV001165507; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340463553404635CAX:g.53404635C>A-
NM_001281463.1(SMC1A):c.*2225G>A8243SMC1AUncertain significancers1047323522RCV000324908; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340479953404799CTX:g.53404799C>TClinGen:CA10646329
NM_006306.4(SMC1A):c.*2086T>C8243SMC1AUncertain significance-1RCV001165508; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340493853404938AGX:g.53404938A>G-
NM_001281463.1(SMC1A):c.*2050T>C8243SMC1AUncertain significancers1057515964RCV000382092; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340497453404974AGX:g.53404974A>GClinGen:CA10646330CN239271 Cornelia de Lange Syndrome;
NM_006306.4(SMC1A):c.*1967C>T8243SMC1AUncertain significance-1RCV001165509; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340505753405057GAX:g.53405057G>A-
NM_001281463.1(SMC1A):c.*1961C>T8243SMC1AUncertain significancers986586627RCV000271262; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340506353405063GAX:g.53405063G>AClinGen:CA10646336CN239271 Cornelia de Lange Syndrome;
NM_006306.4(SMC1A):c.*1934T>C8243SMC1AUncertain significance-1RCV001167108; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340509053405090AGX:g.53405090A>G-
NM_006306.4(SMC1A):c.*1914A>G8243SMC1AUncertain significance-1RCV001167109; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340511053405110TCX:g.53405110T>C-
NM_001281463.1(SMC1A):c.*1559G>A8243SMC1AUncertain significancers782736361RCV000328546; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340546553405465CTX:g.53405465C>TClinGen:CA10646338CN239271 Cornelia de Lange Syndrome;
NM_006306.4(SMC1A):c.*1542T>C8243SMC1ABenign-1RCV001167110; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340548253405482AGX:g.53405482A>G-
NM_001281463.1(SMC1A):c.*1240A>G8243SMC1AUncertain significancers1057515966RCV000376260; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340578453405784TCX:g.53405784T>CClinGen:CA10652010CN239271 Cornelia de Lange Syndrome;
NM_001281463.1(SMC1A):c.*1239T>C8243SMC1ABenignrs782502306RCV000284258; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340578553405785AGX:g.53405785A>GClinGen:CA10654018CN239271 Cornelia de Lange Syndrome;
NM_006306.4(SMC1A):c.*1040G>A8243SMC1AUncertain significance-1RCV001167111; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340598453405984CTX:g.53405984C>T-
NM_001281463.1(SMC1A):c.*1028C>T8243SMC1AUncertain significancers1057515967RCV000341573; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340599653405996GAX:g.53405996G>AClinGen:CA10654368CN239271 Cornelia de Lange Syndrome;
NM_006306.4(SMC1A):c.*931A>G8243SMC1ABenign-1RCV001167687; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340609353406093TCX:g.53406093T>C-
NM_001281463.1(SMC1A):c.*703G>T8243SMC1AUncertain significancers189126241RCV000278456; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340632153406321CAX:g.53406321C>AClinGen:CA10646343CN239271 Cornelia de Lange Syndrome;
NM_006306.4(SMC1A):c.*675A>G8243SMC1AUncertain significance-1RCV001167688; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340634953406349TCX:g.53406349T>C-
NM_001281463.1(SMC1A):c.*665A>G8243SMC1AUncertain significancers1057515969RCV000335882; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340635953406359TCX:g.53406359T>CClinGen:CA10654024CN239271 Cornelia de Lange Syndrome;
NM_001281463.1(SMC1A):c.*626A>G8243SMC1AUncertain significancers1057515970RCV000399341; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340639853406398TCX:g.53406398T>CClinGen:CA10654027CN239271 Cornelia de Lange Syndrome;
NM_006306.4(SMC1A):c.*578C>T8243SMC1AUncertain significance-1RCV001167689; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340644653406446GAX:g.53406446G>A-
NM_006306.4(SMC1A):c.*488A>G8243SMC1AUncertain significance-1RCV001167690; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340653653406536TCX:g.53406536T>C-
NM_001281463.1(SMC1A):c.*381A>G8243SMC1AUncertain significancers184957599RCV000302165; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340664353406643TCX:g.53406643T>CClinGen:CA10654369CN239271 Cornelia de Lange Syndrome;
NM_001281463.1(SMC1A):c.*41G>A8243SMC1AUncertain significancers782548345RCV000307952; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340698353406983CTX:g.53406983C>TClinGen:CA10420227CN239271 Cornelia de Lange Syndrome;
NC_000023.10:g.(?_53407004)_(53449569_?)dup8243SMC1AUncertain significance-1RCV001032583; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340700453449569nana-1-
NM_001281463.1(SMC1A):c.3597C>T (p.Thr1199=)8243SMC1ALikely benignrs28997583RCV000552905; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340706353407063GAX:g.53407063G>AClinGen:CA10420236
NM_001281463.1(SMC1A):c.3586_3597del (p.Phe1196_Thr1199del)8243SMC1ALikely pathogenicrs1569351341RCV000698600; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340706353407074TGGTGAGGTCGAATX:g.53407063_53407074del-C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_001281463.1(SMC1A):c.3552+7C>T8243SMC1ALikely benignrs782267492RCV000503161|RCV000816440; NMedGen:CN169374|MONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340753453407534GAX:g.53407534G>AClinGen:CA10420254
NM_001281463.1(SMC1A):c.3545A>T (p.Tyr1182Phe)8243SMC1AUncertain significancers781998306RCV000823634; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340754853407548TAX:g.53407548T>A-
NM_001281463.1(SMC1A):c.3526G>C (p.Glu1176Gln)8243SMC1AUncertain significancers782175064RCV000541696; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340756753407567CGX:g.53407567C>GClinGen:CA413241898C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_006306.4(SMC1A):c.3592G>A (p.Glu1198Lys)8243SMC1AConflicting interpretations of pathogenicity-1RCV001194642; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340756753407567CTX:g.53407567C>T-
NM_001281463.1(SMC1A):c.3525C>T (p.Ala1175=)8243SMC1ABenign/Likely benignrs146216425RCV000081385|RCV000639419; NMedGen:CN169374|MONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340756853407568GAX:g.53407568G>AClinGen:CA148481C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_001281463.1(SMC1A):c.3491T>C (p.Val1164Ala)8243SMC1ALikely pathogenicrs587784419RCV000147568; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340760253407602AGX:g.53407602A>GClinGen:CA272578C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_006306.4(SMC1A):c.3549_3552dup (p.Ile1185fs)8243SMC1APathogenicrs863225459RCV000202430|RCV001072125; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199|MedGen:C5393312,OMIM:301044X5340760653407607TTGGCCX:g.53407606_53407607insGGCCClinGen:CA277857,OMIM:300040.0009C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_006306.4(SMC1A):c.3534G>C (p.Ser1178=)8243SMC1AUncertain significance-1RCV001169562; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340762553407625CGX:g.53407625C>G-
NM_001281463.1(SMC1A):c.3441+3G>A8243SMC1AUncertain significancers1556885809RCV000639416; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340793653407936CTX:g.53407936C>TClinGen:CA658799758
NM_006306.4(SMC1A):c.3497A>C (p.Asn1166Thr)8243SMC1APathogenicrs1556885810RCV000995878; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340794953407949TGX:g.53407949T>G-
NM_006306.4(SMC1A):c.3490A>G (p.Asn1164Asp)8243SMC1ALikely pathogenicrs868961188RCV001265654; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340795653407956TCX:g.53407956T>C-
NM_001281463.1(SMC1A):c.3395T>A (p.Val1132Asp)8243SMC1ALikely pathogenicrs1569351534RCV000703292; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340798553407985ATX:g.53407985A>T-
NM_006306.4(SMC1A):c.3460G>A (p.Val1154Ile)8243SMC1AUncertain significance-1RCV001059994; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340798653407986CTX:g.53407986C>T-
NM_001281463.1(SMC1A):c.3384C>T (p.Ala1128=)8243SMC1ABenign/Likely benignrs142611198RCV000147567|RCV000639418|RCV000717906; NMedGen:CN169374|MONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199|MedGen:C2711754X5340799653407996GAX:g.53407996G>AClinGen:CA173515C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_006306.4(SMC1A):c.3438-7C>T8243SMC1ABenignrs782796392RCV000938988; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340801553408015GAX:g.53408015G>A-
NM_001281463.1(SMC1A):c.3324C>T (p.Gly1108=)8243SMC1AConflicting interpretations of pathogenicityrs374246357RCV000821652|RCV000999450; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199|MedGen:CN517202X5340920053409200GAX:g.53409200G>A-
NM_001281463.1(SMC1A):c.3307A>G (p.Met1103Val)8243SMC1ALikely pathogenicrs1057519499RCV000416533; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340921753409217TCX:g.53409217T>CClinGen:CA16044282C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_006306.4(SMC1A):c.3362G>A (p.Arg1121His)8243SMC1APathogenic-1RCV001270858; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340922853409228CTX:g.53409228C>T-
NM_001281463.1(SMC1A):c.3224T>A (p.Phe1075Tyr)8243SMC1AUncertain significancers1131692271RCV000496004; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340930053409300ATX:g.53409300A>TClinGen:CA413243671C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_006306.4(SMC1A):c.3286-4C>T8243SMC1ALikely benignrs1556885985RCV000976783; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340930853409308GAX:g.53409308G>A-
NM_001281463.1(SMC1A):c.3188A>G (p.Tyr1063Cys)8243SMC1APathogenic/Likely pathogenicrs587784418RCV000147566; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340945853409458TCX:g.53409458T>CClinGen:CA272574,UniProtKB:Q14683#VAR_062801C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_001281463.1(SMC1A):c.3186C>T (p.Ile1062=)8243SMC1AUncertain significancers587784417RCV000147565; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340946053409460GAX:g.53409460G>AClinGen:CA272569C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_006306.4(SMC1A):c.3249dup (p.Ile1084fs)8243SMC1APathogenic-1RCV001060696; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340946253409463TTCX:g.53409462_53409463insC-
NM_001281463.1(SMC1A):c.3169A>G (p.Thr1057Ala)8243SMC1AUncertain significancers1602398590RCV000811425; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340947753409477TCX:g.53409477T>C-
NM_006306.4(SMC1A):c.3205C>T (p.Arg1069Cys)8243SMC1ALikely benign-1RCV001256205; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340950753409507GAX:g.53409507G>A-
NM_001281463.1(SMC1A):c.3131G>A (p.Arg1044His)8243SMC1APathogenic/Likely pathogenicrs1556886034RCV000623215|RCV000707530; NMeSH:D030342,MedGen:C0950123|MONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340951553409515CTX:g.53409515C>TClinGen:CA413244342C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_006306.4(SMC1A):c.3187AAG[1] (p.Lys1064del)8243SMC1ALikely pathogenic-1RCV001196790; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340952053409522CCTTCX:g.53409520_53409522del-
NM_001281463.1(SMC1A):c.3120C>G (p.Ile1040Met)8243SMC1AUncertain significancers372307204RCV000688735; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340952653409526GCX:g.53409526G>C-C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_001281463.1(SMC1A):c.3112G>A (p.Glu1038Lys)8243SMC1AConflicting interpretations of pathogenicityrs1057521921RCV000427470|RCV001066009; NMedGen:CN517202|MONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340953453409534CTX:g.53409534C>TClinGen:CA16608532CN517202 not provided;
NM_006306.4(SMC1A):c.3177C>T (p.Phe1059=)8243SMC1ALikely benignrs375312256RCV000935569; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340953553409535GAX:g.53409535G>A-
NM_001281463.1(SMC1A):c.3085C>T (p.Arg1029Ter)8243SMC1APathogenicrs1569351907RCV000692280; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340956153409561GAX:g.53409561G>A-
NM_001281463.1(SMC1A):c.3080G>A (p.Arg1027Gln)8243SMC1AConflicting interpretations of pathogenicityrs587784416RCV000147564|RCV000255003; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199|MedGen:CN517202X5340956653409566CTX:g.53409566C>TClinGen:CA272565,UniProtKB:Q14683#VAR_062800C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_006306.4(SMC1A):c.3131-13T>G8243SMC1AUncertain significance-1RCV001165575; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5340959453409594ACX:g.53409594A>C-
NM_006306.4(SMC1A):c.3119dup (p.Thr1041fs)8243SMC1APathogenic-1RCV001249630; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5341002853410029CCTX:g.53410028_53410029insT-
NM_001281463.1(SMC1A):c.3037C>T (p.Arg1013Ter)8243SMC1APathogenicrs1556886124RCV000639410; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5341004553410045GAX:g.53410045G>AClinGen:CA413245380C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_001281463.1(SMC1A):c.2990_3016delinsTGCAG (p.Arg997fs)8243SMC1ALikely pathogenicrs1556886127RCV000639413; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5341006653410092TGGCCTTCATGTTGGGGGCGGCAATACCTGCAX:g.53410067_53410092delClinGen:CA658799759
NM_001281463.1(SMC1A):c.3004A>T (p.Asn1002Tyr)8243SMC1ALikely pathogenicrs587784415RCV000147563; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5341007853410078TAX:g.53410078T>AClinGen:CA272560C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_006306.4(SMC1A):c.3063C>T (p.Ala1021=)8243SMC1ALikely benignrs202083908RCV000935757; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5341008553410085GAX:g.53410085G>A-
NM_006306.4(SMC1A):c.3053A>G (p.Gln1018Arg)8243SMC1AUncertain significance-1RCV001059977; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5341009553410095TCX:g.53410095T>C-
NM_006306.4(SMC1A):c.3022C>T (p.Gln1008Ter)8243SMC1APathogenicrs1602398950RCV000990830; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5341012653410126GAX:g.53410126G>A-
NM_001281463.1(SMC1A):c.2911G>T (p.Ala971Ser)8243SMC1AUncertain significancers782127256RCV000690033; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5341017153410171CAX:g.53410171C>A-C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_001281463.1(SMC1A):c.2908-2A>G8243SMC1APathogenicrs727503774RCV000157050; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199; MONDO:MONDO:0011518,MedGen:C1854630,OMIM:605130, Orphanet:319182X5341017653410176TCX:g.53410176T>CClinGen:CA333595
NM_006306.4(SMC1A):c.2973G>A (p.Lys991=)8243SMC1AUncertain significance-1RCV001216313; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5342169853421698CTX:g.53421698C>T-
NM_001281463.1(SMC1A):c.2884G>A (p.Gly962Ser)8243SMC1AConflicting interpretations of pathogenicityrs782381563RCV000538565|RCV000717223; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199|MedGen:C2711754X5342172153421721CTX:g.53421721C>TClinGen:CA10420371C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_006306.4(SMC1A):c.2948A>G (p.Tyr983Cys)8243SMC1AConflicting interpretations of pathogenicity-1RCV001031001; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5342172353421723TCX:g.53421723T>C-
NM_006306.4(SMC1A):c.2872dup (p.Gln958fs)8243SMC1APathogenicrs1602404847RCV000812147; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5342179853421799TTGX:g.53421798_53421799insG-
NM_006306.4(SMC1A):c.2862+4A>G8243SMC1AUncertain significance-1RCV001061962; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5342314353423143TCX:g.53423143T>C-
NM_006306.4(SMC1A):c.2853_2856del (p.Ser951fs)8243SMC1APathogenicrs863225458RCV000202429|RCV000394437|RCV001072124; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199|MedGen:CN517202|MedGen:C5393312,OMIM:301044X5342315353423156CCTGACX:g.53423153_53423156delClinGen:CA277856,OMIM:300040.0008C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_001281463.1(SMC1A):c.2758C>T (p.Leu920=)8243SMC1ABenign/Likely benignrs139654605RCV000193146|RCV000713378|RCV000715324|RCV001085865; NMedGen:CN169374|MedGen:CN517202|MedGen:C2711754|MONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5342318553423185GAX:g.53423185G>AClinGen:CA206432C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_006306.4(SMC1A):c.2814dup (p.Lys939Ter)8243SMC1APathogenicrs1602405588RCV000990831; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5342319453423195TTAX:g.53423194_53423195insA-
NM_001281463.1(SMC1A):c.2726A>G (p.Gln909Arg)8243SMC1AUncertain significancers782728089RCV000707099; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5342321753423217TCX:g.53423217T>C-C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_001281463.1(SMC1A):c.2672C>T (p.Thr891Ile)8243SMC1AUncertain significancers1569355048RCV000693326; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5342327153423271GAX:g.53423271G>A-
NM_006306.4(SMC1A):c.2729AGG[1] (p.Glu911del)8243SMC1AUncertain significance-1RCV001219346; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5342327553423277ACCTAX:g.53423275_53423277del-
NM_001281463.1(SMC1A):c.2643-4T>A8243SMC1AUncertain significancers1602405648RCV000822010; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5342330453423304ATX:g.53423304A>T-
NM_001281463.1(SMC1A):c.2642A>G (p.Lys881Arg)8243SMC1AUncertain significancers1569355072RCV000685225; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5342339253423392TCX:g.53423392T>C-
NM_006306.4(SMC1A):c.2700C>T (p.Gly900=)8243SMC1AUncertain significance-1RCV001165576; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5342340053423400GAX:g.53423400G>A-
NM_006306.4(SMC1A):c.2645C>T (p.Ser882Leu)8243SMC1AUncertain significance-1RCV001227326; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5342345553423455GAX:g.53423455G>A-
NM_006306.4(SMC1A):c.2611C>T (p.Gln871Ter)8243SMC1ALikely pathogenic-1RCV001252976|RCV001255325; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199|Human Phenotype Ontology:HP:0000730,Human Phenotype Ontology:HP:0001249,Human Phenotype Ontology:HP:0001267,Human Phenotype Ontology:HP:0001286,Human Phenotype Ontology:HP:0002122,Human PhenotX5342348953423489GAX:g.53423489G>A-
NM_006306.4(SMC1A):c.2556C>A (p.Leu852=)8243SMC1ALikely benignrs1602407405RCV000934869; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5342651753426517GTX:g.53426517G>T-
NM_001281463.1(SMC1A):c.2481del (p.Ile827fs)8243SMC1APathogenicrs797045069RCV000191130; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5342652653426526CTCX:g.53426526_53426526delClinGen:CA276167C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_006306.4(SMC1A):c.2493_2495del (p.Asp831_Gln832delinsGlu)8243SMC1APathogenicrs1602407457RCV000012438; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5342657853426580TTGGTX:g.53426578_53426580delOMIM:300040.0001C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_001281463.1(SMC1A):c.2381G>A (p.Arg794His)8243SMC1ALikely pathogenicrs886044819RCV000400812|RCV000990832; NMedGen:CN517202|MONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5342662653426626CTX:g.53426626C>TClinGen:CA10604669CN517202 not provided;
NM_001281463.1(SMC1A):c.2380C>T (p.Arg794Cys)8243SMC1AUncertain significancers1556888586RCV000528271; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5342662753426627GAX:g.53426627G>AClinGen:CA413250707C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NC_000023.10:g.(?_53430478)_(53432101_?)del8243SMC1APathogenic-1RCV000811350; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343047853432101nana-
NM_001281463.1(SMC1A):c.2354+5G>A8243SMC1AUncertain significancers1556889217RCV000689724; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343049353430493CTX:g.53430493C>T-C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_001281463.1(SMC1A):c.2354G>A (p.Arg785His)8243SMC1ALikely pathogenicrs1569356550RCV000680262|RCV001268607; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199|MedGen:CN517202X5343049853430498CTX:g.53430498C>T-C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_001281463.1(SMC1A):c.2328dup (p.Arg777fs)8243SMC1APathogenicrs1569356555RCV000680261; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343052353430524GGTX:g.53430523_53430524insT-
NM_001281463.1(SMC1A):c.2303G>A (p.Arg768Gln)8243SMC1APathogenicrs797045993RCV000194474; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343054953430549CTX:g.53430549C>TClinGen:CA277329,UniProtKB:Q14683#VAR_062798
NM_001281463.1(SMC1A):c.2302C>T (p.Arg768Trp)8243SMC1APathogenic/Likely pathogenicrs587784412RCV000147560|RCV001252688|RCV001265874; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199|Human Phenotype Ontology:HP:0000252,Human Phenotype Ontology:HP:0001366,Human Phenotype Ontology:HP:0005485,Human Phenotype Ontology:HP:0005489,Human Phenotype Ontology:HP:0005497,MedGen:C4551X5343055053430550GAX:g.53430550G>AClinGen:CA272550C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_001281463.1(SMC1A):c.2285T>C (p.Ile762Thr)8243SMC1APathogenic/Likely pathogenicrs387906702RCV000022820|RCV000441375|RCV000623393; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199|MedGen:CN517202|MeSH:D030342,MedGen:C0950123X5343056753430567AGX:g.53430567A>GClinGen:CA259690,UniProtKB:Q14683#VAR_064543,OMIM:300040.0005C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_001281463.1(SMC1A):c.2284A>G (p.Ile762Val)8243SMC1AUncertain significancers587784411RCV000147559; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343056853430568TCX:g.53430568T>CClinGen:CA272545C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_001281463.1(SMC1A):c.2261T>A (p.Val754Glu)8243SMC1ALikely pathogenicrs587784410RCV000147558; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343059153430591ATX:g.53430591A>TClinGen:CA272540C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_006306.4(SMC1A):c.2320G>T (p.Asp774Tyr)8243SMC1ALikely pathogenic-1RCV001045982; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343059853430598CAX:g.53430598C>A-
NM_006306.4(SMC1A):c.2320G>A (p.Asp774Asn)8243SMC1AUncertain significance-1RCV001170013; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343059853430598CTX:g.53430598C>T-
NM_006306.4(SMC1A):c.2314G>T (p.Val772Leu)8243SMC1AUncertain significance-1RCV001210741; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343060453430604CAX:g.53430604C>A-
NM_001281463.1(SMC1A):c.2248-2A>G8243SMC1ALikely pathogenicrs1602409271RCV000791958; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343060653430606TCX:g.53430606T>C-
NM_001281463.1(SMC1A):c.2131-5T>C8243SMC1ABenign/Likely benignrs2297104RCV000081384|RCV000368215|RCV000535243|RCV000715398; NMedGen:CN169374|MONDO:MONDO:0016033,MedGen:C0270972,OMIM:PS122470, Orphanet:199|MONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199|MedGen:C2711754X5343083053430830AGX:g.53430830A>GClinGen:CA148480C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_006306.4(SMC1A):c.2161C>T (p.Gln721Ter)8243SMC1APathogenic-1RCV001049126; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343197953431979GAX:g.53431979G>A-
NM_001281463.1(SMC1A):c.2065C>T (p.Arg689Trp)8243SMC1APathogenicrs587784409RCV000147557; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343200953432009GAX:g.53432009G>AClinGen:CA272536,UniProtKB:Q14683#VAR_062796C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_006306.4(SMC1A):c.2095C>T (p.Arg699Cys)8243SMC1AUncertain significance-1RCV001051163; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343204553432045GAX:g.53432045G>A-
NM_001281463.1(SMC1A):c.2012G>A (p.Arg671Gln)8243SMC1AConflicting interpretations of pathogenicityrs587784408RCV000147556; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343206253432062CTX:g.53432062C>TClinGen:CA272531C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_006306.4(SMC1A):c.2065A>G (p.Met689Val)8243SMC1AUncertain significance-1RCV001222901; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343207553432075TCX:g.53432075T>C-
NM_006306.4(SMC1A):c.2061G>A (p.Glu687=)8243SMC1AUncertain significance-1RCV001165577; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343207953432079CTX:g.53432079C>T-
NM_001281463.1(SMC1A):c.1980_1982del (p.Glu662del)8243SMC1ALikely pathogenicrs797045992RCV000193116; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343218753432189CTCTCX:g.53432187_53432189delClinGen:CA277080
NM_006306.4(SMC1A):c.2039G>A (p.Arg680His)8243SMC1ALikely benignrs1556889522RCV000930925; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343219653432196CTX:g.53432196C>T-
NM_001281463.1(SMC1A):c.1969G>T (p.Glu657Ter)8243SMC1APathogenicrs1569356968RCV000757943; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343220053432200CAX:g.53432200C>A-
NM_006306.4(SMC1A):c.1964G>A (p.Gly655Glu)8243SMC1ALikely pathogenicrs1602410098RCV000990833; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343227153432271CTX:g.53432271C>T-
NM_006306.4(SMC1A):c.1958C>T (p.Ser653Phe)8243SMC1APathogenic-1RCV001270900; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343227753432277GAX:g.53432277G>A-
NM_006306.4(SMC1A):c.1917G>A (p.Val639=)8243SMC1AUncertain significance-1RCV001165578; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343231853432318CTX:g.53432318C>T-
NM_006306.4(SMC1A):c.1911G>A (p.Lys637=)8243SMC1AUncertain significance-1RCV001208784; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343242553432425CTX:g.53432425C>T-
NM_001281463.1(SMC1A):c.1811G>A (p.Arg604His)8243SMC1AConflicting interpretations of pathogenicityrs587784407RCV000147555; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343245953432459CTX:g.53432459C>TClinGen:CA272526C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_001281463.1(SMC1A):c.1810C>T (p.Arg604Cys)8243SMC1AUncertain significancers1556889577RCV000639412; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343246053432460GAX:g.53432460G>AClinGen:CA413252792
NM_001281463.1(SMC1A):c.1806T>G (p.Asp602Glu)8243SMC1AUncertain significancers1369059288RCV000819704|RCV000999455; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199|MedGen:CN517202X5343246453432464ACX:g.53432464A>C-
NM_006306.4(SMC1A):c.1863C>T (p.Asn621=)8243SMC1ALikely benignrs782665597RCV000928881; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343247353432473GAX:g.53432473G>A-
NM_001281463.1(SMC1A):c.1781C>T (p.Ala594Val)8243SMC1AUncertain significancers782196047RCV000822047; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343248953432489GAX:g.53432489G>A-
NM_006306.4(SMC1A):c.1781_1784TGAT[1] (p.Ile595fs)8243SMC1APathogenicrs1602410239RCV000995879; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343254853432551CATCACX:g.53432548_53432551del-
NM_001281463.1(SMC1A):c.1688T>C (p.Leu563Pro)8243SMC1ALikely pathogenicrs587784406RCV000147554; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343258253432582AGX:g.53432582A>GClinGen:CA272521C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_001281463.1(SMC1A):c.1632G>A (p.Glu544=)8243SMC1ABenignrs7052858RCV000147553|RCV000639411|RCV000718839; NMedGen:CN169374|MONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199|MedGen:C2711754X5343273653432736CTX:g.53432736C>TClinGen:CA173505C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_006306.4(SMC1A):c.1682A>G (p.Lys561Arg)8243SMC1AUncertain significance-1RCV001221735; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343275253432752TCX:g.53432752T>C-
NM_006306.4(SMC1A):c.1681A>C (p.Lys561Gln)8243SMC1AUncertain significance-1RCV001048196; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343275353432753TGX:g.53432753T>G-
NM_001281463.1(SMC1A):c.1479+4A>C8243SMC1AConflicting interpretations of pathogenicityrs377270943RCV000147552|RCV000356126|RCV000720083; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199|MedGen:CN169374|MedGen:C2711754X5343598953435989TGX:g.53435989T>GClinGen:CA272520C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_001281463.1(SMC1A):c.1421G>A (p.Arg474His)8243SMC1APathogenicrs122454123RCV000012441; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343605153436051CTX:g.53436051C>TClinGen:CA255969,UniProtKB:Q14683#VAR_062793,OMIM:300040.0004C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_006306.4(SMC1A):c.1486C>T (p.Arg496Cys)8243SMC1ALikely pathogenic-1RCV001043421; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343605253436052GAX:g.53436052G>A-
NM_001281463.1(SMC1A):c.1412A>C (p.Glu471Ala)8243SMC1APathogenicrs122454122RCV000012439; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343606053436060TGX:g.53436060T>GClinGen:CA255965,UniProtKB:Q14683#VAR_026529,OMIM:300040.0002C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_001281463.1(SMC1A):c.1391A>G (p.Asp464Gly)8243SMC1AConflicting interpretations of pathogenicityrs587784405RCV000147551; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343608153436081TCX:g.53436081T>CClinGen:CA272515C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_006306.4(SMC1A):c.1436A>C (p.Gln479Pro)8243SMC1AUncertain significance-1RCV001202476; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343610253436102TGX:g.53436102T>G-
NM_001281463.1(SMC1A):c.1322_1323insC (p.Glu442fs)8243SMC1APathogenicrs1057519398RCV000417105; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343614953436150CCGX:g.53436149_53436150insGClinGen:CA16044384
NM_001281463.1(SMC1A):c.1257C>T (p.Tyr419=)8243SMC1ABenign/Likely benignrs144850468RCV000180295|RCV000535594|RCV000717385; NMedGen:CN169374|MONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199|MedGen:C2711754X5343636653436366GAX:g.53436366G>AClinGen:CA203639C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_006306.4(SMC1A):c.1299del (p.Lys433fs)8243SMC1APathogenicrs1602411858RCV000799059; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343639053436390GCGX:g.53436390_53436390del-
NM_006306.4(SMC1A):c.1269A>G (p.Gln423=)8243SMC1AUncertain significance-1RCV001165579; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343642053436420TCX:g.53436420T>C-
NM_001281463.1(SMC1A):c.1201C>A (p.Gln401Lys)8243SMC1ALikely pathogenicrs587784404RCV000147550; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343642253436422GTX:g.53436422G>TClinGen:CA272510C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_001281463.1(SMC1A):c.1188+11G>C8243SMC1AConflicting interpretations of pathogenicityrs144354524RCV000147549; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343870053438700CGX:g.53438700C>GClinGen:CA272509
NM_001281463.1(SMC1A):c.1188+5G>A8243SMC1AUncertain significancers1569358589RCV000686797; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343870653438706CTX:g.53438706C>T-
NM_006306.4(SMC1A):c.1235G>A (p.Arg412Gln)8243SMC1AUncertain significance-1RCV001254177; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343873053438730CTX:g.53438730C>T-
NM_006306.4(SMC1A):c.1203A>C (p.Lys401Asn)8243SMC1AUncertain significance-1RCV001231773; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343876253438762TGX:g.53438762T>G-
NM_001281463.1(SMC1A):c.1127G>A (p.Arg376Gln)8243SMC1APathogenicrs587784403RCV000147548; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343877253438772CTX:g.53438772C>TClinGen:CA272505,UniProtKB:Q14683#VAR_062791C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_001281463.1(SMC1A):c.1124A>G (p.Asn375Ser)8243SMC1AUncertain significancers782697006RCV000499405|RCV000704265; NMedGen:CN169374|MONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343877553438775TCX:g.53438775T>CClinGen:CA10420591C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_001281463.1(SMC1A):c.1107G>A (p.Gln369=)8243SMC1ABenignrs147952638RCV000720541|RCV000891014; NMedGen:C2711754|MONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343879253438792CTX:g.53438792C>TClinGen:CA10420592CN239271 Cornelia de Lange Syndrome;
NM_006306.4(SMC1A):c.1150A>G (p.Lys384Glu)8243SMC1AUncertain significance-1RCV001195912; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343881553438815TCX:g.53438815T>C-
NM_001281463.1(SMC1A):c.1070_1072AAG[2] (p.Glu359del)8243SMC1ALikely pathogenicrs797045991RCV000195085; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343882153438823GCTTGX:g.53438821_53438823delClinGen:CA277433
NM_001281463.1(SMC1A):c.1048-2A>G8243SMC1APathogenicrs1569358628RCV000680263; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343885353438853TCX:g.53438853T>C-C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_001281463.1(SMC1A):c.1032G>A (p.Thr344=)8243SMC1ALikely benignrs140585416RCV000517467|RCV000639421; NMedGen:CN169374|MONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343896053438960CTX:g.53438960C>TClinGen:CA10420608
NM_001281463.1(SMC1A):c.854A>G (p.His285Arg)8243SMC1AUncertain significancers1556890616RCV000556180; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343913853439138TCX:g.53439138T>CClinGen:CA413257876C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_001281463.1(SMC1A):c.793_795del (p.Lys265del)8243SMC1AUncertain significancers1556890626RCV000639415; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343919753439199CCTTCX:g.53439197_53439199delClinGen:CA658799760
NM_001281463.1(SMC1A):c.789-15C>T8243SMC1AUncertain significancers147791932RCV000147574; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343921853439218GAX:g.53439218G>AClinGen:CA272598
NM_006306.4(SMC1A):c.854+6_854+7del8243SMC1AUncertain significance-1RCV001241732; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343984353439844CCTCX:g.53439843_53439844del-
NM_001281463.1(SMC1A):c.730_732AAG[2] (p.Lys246del)8243SMC1APathogenicrs727503773RCV000157049|RCV000626897; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199|6 conditionsX5343990053439902CCTTCX:g.53439900_53439902delClinGen:CA333590C0241654 Abnormality of the heart valves;
NM_006306.4(SMC1A):c.764G>A (p.Arg255His)8243SMC1ALikely benign-1RCV001034190; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343994053439940CTX:g.53439940C>T-
NM_006306.4(SMC1A):c.756C>G (p.Asp252Glu)8243SMC1AUncertain significance-1RCV001270902; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5343994853439948GCX:g.53439948G>C-
NM_001281463.1(SMC1A):c.633G>A (p.Val211=)8243SMC1ABenignrs145319852RCV000153977|RCV000545929|RCV000715607; NMedGen:CN169374|MONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199|MedGen:C2711754X5344000553440005CTX:g.53440005C>TClinGen:CA180446C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_001281463.1(SMC1A):c.589del (p.Ala197fs)8243SMC1APathogenicrs1569359048RCV000680260; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5344004953440049GCGX:g.53440049_53440049del-
NM_001281463.1(SMC1A):c.550-2A>G8243SMC1APathogenicrs587784423RCV000147572; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5344009053440090TCX:g.53440090T>CClinGen:CA272597
NM_001281463.1(SMC1A):c.550-6G>A8243SMC1ABenign/Likely benignrs587784424RCV000147573|RCV000872759; NMedGen:CN169374|MONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5344009453440094CTX:g.53440094C>TClinGen:CA173520
NM_006306.4(SMC1A):c.615+2T>C8243SMC1APathogenicrs868985177RCV000990834; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5344018053440180AGX:g.53440180A>G-
NM_001281463.1(SMC1A):c.521G>A (p.Arg174His)8243SMC1APathogenicrs1556890815RCV000639414; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5344021053440210CTX:g.53440210C>TClinGen:CA413259183
NM_001281463.1(SMC1A):c.520C>T (p.Arg174Cys)8243SMC1APathogenicrs587784422RCV000147571; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5344021153440211GAX:g.53440211G>AClinGen:CA272592C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_006306.4(SMC1A):c.583G>T (p.Glu195Ter)8243SMC1ALikely pathogenicrs1602413582RCV000990835; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5344021453440214CAX:g.53440214C>A-
NM_006306.4(SMC1A):c.579G>A (p.Ala193=)8243SMC1ALikely benignrs199571320RCV000925437; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5344021853440218CTX:g.53440218C>T-
NM_001281463.1(SMC1A):c.481C>T (p.Gln161Ter)8243SMC1APathogenicrs587784421RCV000147570; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5344025053440250GAX:g.53440250G>AClinGen:CA272587C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_006306.4(SMC1A):c.512G>A (p.Arg171Gln)8243SMC1AUncertain significance-1RCV001201950; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5344028553440285CTX:g.53440285C>T-
NM_001281463.1(SMC1A):c.428C>T (p.Ala143Val)8243SMC1AUncertain significancers1556890833RCV000813864; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5344030353440303GAX:g.53440303G>A-
NM_006306.4(SMC1A):c.452G>A (p.Arg151Lys)8243SMC1AUncertain significance-1RCV001213339; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5344034553440345CTX:g.53440345C>T-
NM_001281463.1(SMC1A):c.355G>A (p.Glu119Lys)8243SMC1ALikely pathogenicrs587784420RCV000147569; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5344037653440376CTX:g.53440376C>TClinGen:CA272583,UniProtKB:Q14683#VAR_062787C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_001281463.1(SMC1A):c.346-10C>T8243SMC1ABenignrs149219651RCV000081386|RCV000531305; NMedGen:CN169374|MONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5344039553440395GAX:g.53440395G>AClinGen:CA148486C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_006306.4(SMC1A):c.397T>G (p.Phe133Val)8243SMC1APathogenic-1RCV001048385; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5344172153441721ACX:g.53441721A>C-
NM_006306.4(SMC1A):c.392del (p.Arg131fs)8243SMC1APathogenic-1RCV001062141; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5344172653441726ACAX:g.53441726_53441726del-
NM_006306.4(SMC1A):c.392G>A (p.Arg131His)8243SMC1AUncertain significance-1RCV001059173; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5344172653441726CTX:g.53441726C>T-
NM_001281463.1(SMC1A):c.232G>C (p.Gly78Arg)8243SMC1AUncertain significancers1569359487RCV000679806; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5344193053441930CGX:g.53441930C>G-C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_001281463.1(SMC1A):c.219C>G (p.Ala73=)8243SMC1AConflicting interpretations of pathogenicityrs587784414RCV000147562|RCV000955143; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199|MedGen:CN517202X5344194353441943GCX:g.53441943G>CClinGen:CA272555C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_001281463.1(SMC1A):c.195_206del (p.Glu65_Glu68del)8243SMC1AUncertain significancers1569359505RCV000705752; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5344195653441967GTCCTCAGCACCCGX:g.53441956_53441967del-C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_001281463.1(SMC1A):c.161A>G (p.Asn54Ser)8243SMC1AUncertain significancers200243549RCV000687190; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5344200153442001TCX:g.53442001T>C-C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_001281463.1(SMC1A):c.74T>G (p.Phe25Cys)8243SMC1AUncertain significancers1569359530RCV000679805; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5344208853442088ACX:g.53442088A>C-C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_001281463.1(SMC1A):c.62A>T (p.Asp21Val)8243SMC1ALikely pathogenicrs1569359535RCV000680259; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5344210053442100TAX:g.53442100T>A-C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_001281463.1(SMC1A):c.58A>G (p.Met20Val)8243SMC1AConflicting interpretations of pathogenicityrs1556891104RCV000500991; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5344210453442104TCX:g.53442104T>CClinGen:CA413133133C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_001281463.1(SMC1A):c.50C>G (p.Ser17Ter)8243SMC1APathogenicrs1057518670RCV000415358; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5344211253442112GCX:g.53442112G>CClinGen:CA16043711C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_001281463.1(SMC1A):c.44G>T (p.Gly15Val)8243SMC1ALikely pathogenicrs1569359540RCV000680258; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5344211853442118CAX:g.53442118C>A-C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NC_000023.10:g.(?_53448825)_(53449569_?)del8243SMC1APathogenic-1RCV001033160; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5344882553449569nana-1-
NM_001281463.1(SMC1A):c.-118G>A8243SMC1ALikely pathogenicrs1556892359RCV000660365; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5344945553449455CTX:g.53449455C>T-C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_001281463.1(SMC1A):c.-150C>T8243SMC1ALikely benignrs781999328RCV000639420; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5344948753449487GAX:g.53449487G>AClinGen:CA10420756C1802395 300590 Congenital muscular hypertrophy-cerebral syndrome;
NM_006306.4(SMC1A):c.37A>C (p.Lys13Gln)8243SMC1AUncertain significance-1RCV001055709; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5344951353449513TGX:g.53449513T>G-
NM_001281463.1(SMC1A):c.-213C>T8243SMC1AUncertain significancers797044618RCV000173402|RCV000760215; NMedGen:CN517202|MONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5344955053449550GAX:g.53449550G>AClinGen:CA238857
NM_006306.4(SMC1A):c.-7G>A8243SMC1AUncertain significance-1RCV001167172; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5344955653449556CTX:g.53449556C>T-
NM_001281463.1(SMC1A):c.-275G>T8243SMC1AUncertain significance-1RCV001167173; NMONDO:MONDO:0010370,MedGen:C1802395,OMIM:300590, Orphanet:199X5344961253449612CAX:g.53449612C>A-
MSeqDR Portal