MSeqDR Mitochondrial Disease Portal


 
*:HP: HPO terms, UMDF: 1= Disease, ND: NAMDC terms.
  Most Studied  CPEO, Complex I Deficiency, COXPD1, Leigh, LHON, MELAS, MERRF, Myopathy, SANDO
Disease Browser
Parent Node:
expand
Diseases (C)
Parent Node:
expand
Pitt-Hopkins syndrome (C537403)
..Starting node
..expand
PITT-HOPKINS-LIKE SYNDROME 2 (OMIM:614325)

       Child Nodes:



 Sister Nodes: 
..expandPITT-HOPKINS-LIKE SYNDROME 2 (OMIM:614325)
   

Human Disease MESH is developed by UMLS.
Further data from MedGen, OMIM,ClinVar, CTD
Term ID:9876
Name:PITT-HOPKINS-LIKE SYNDROME 2
Definition:
Alternative IDs:
ParentIDs:MESH:C537403
TreeNumbers:C08.618.501/C537403/614325 |C10.597.606.360/C537403/614325 |C23.550.291.812/C537403/614325 |C23.888.592.604.646/C537403/614325 |C23.888.852.591/C537403/614325 |F03.625.539/C537403/614325
Synonyms:PTHSL2
Slim Mappings:Mental disorder|Nervous system disease|Pathology (process)|Respiratory tract disease|Signs and symptoms
Reference: MedGen: 614325
MeSH: 614325
OMIM: 614325;
MSeqDR LSDB:  
Genes: NRXN1;
Phenotypes
1 HP:0000007Autosomal recessive inheritance
2 HP:0002136Broad-based gaitHP:0040283
3 HP:0002019Constipation
4 HP:0002307Drooling
5 HP:0200134Epileptic encephalopathyHP:0040282
6 HP:0011968Feeding difficulties
7 HP:0002020Gastroesophageal reflux
8 HP:0001290Generalized hypotonia
9 HP:0002883Hyperventilation
10 HP:0010864Intellectual disability, severe
11 HP:0010808Protruding tongue
12 HP:0001642Pulmonic stenosis
13 HP:0002650Scoliosis
14 HP:0000486Strabismus
15 HP:0000154Wide mouth
Disease Causing ClinVar Variants
Variation_NameGeneIDGeneSymbolClinicalSignificancedbSNPRCVaccessionTestedInGTRPhenotypeIDsChromosomeStartStopHGVS_cHGVS_pHGVS_gOtherIDsDisease_ClinVar
NM_001330078.2(NRXN1):c.*3346T>A9378NRXN1Uncertain significancers541005670RCV000360844; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014573650145736AT2:g.50145736A>TClinGen:CA10615804
NM_001330078.2(NRXN1):c.*3278T>G9378NRXN1Uncertain significancers886056154RCV000268601; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014580450145804AC2:g.50145804A>CClinGen:CA10615533
NM_001330078.2(NRXN1):c.*3204C>T9378NRXN1Uncertain significance-1RCV001143168; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014587850145878GA2:g.50145878G>A-
NM_001330078.2(NRXN1):c.*3186A>C9378NRXN1Uncertain significance-1RCV001143169; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014589650145896TG2:g.50145896T>G-
NM_001330078.2(NRXN1):c.*3123C>T9378NRXN1Uncertain significancers531095026RCV000321383; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014595950145959GA2:g.50145959G>AClinGen:CA10614076
NM_001330078.2(NRXN1):c.*2878G>A9378NRXN1Benign-1RCV001143170; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014620450146204CT2:g.50146204C>T-
NM_001330078.2(NRXN1):c.*2835T>C9378NRXN1Uncertain significancers553997030RCV000378095; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014624750146247AG2:g.50146247A>GClinGen:CA10614079
NM_001330078.2(NRXN1):c.*2787A>G9378NRXN1Uncertain significance-1RCV001136603; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014629550146295TC2:g.50146295T>C-
NM_001330078.2(NRXN1):c.*2766A>G9378NRXN1Uncertain significancers886056155RCV000281477; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014631650146316TC2:g.50146316T>CClinGen:CA10613610
NM_001330078.2(NRXN1):c.*2745G>C9378NRXN1Uncertain significance-1RCV001136604; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014633750146337CG2:g.50146337C>G-
NM_001330078.2(NRXN1):c.*2629A>C9378NRXN1Uncertain significancers533799399RCV000372459; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014645350146453TG2:g.50146453T>GClinGen:CA10614087
NM_001330078.2(NRXN1):c.*2535C>T9378NRXN1Uncertain significancers886056156RCV000279890; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014654750146547GA2:g.50146547G>AClinGen:CA10614091
NM_001330078.2(NRXN1):c.*2514A>G9378NRXN1Uncertain significancers746884216RCV000351275; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014656850146568TC2:g.50146568T>CClinGen:CA10613615
NM_001330078.2(NRXN1):c.*2511G>C9378NRXN1Benignrs148938313RCV000393386; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014657150146571CG2:g.50146571C>GClinGen:CA10615808CN239445 Pitt-Hopkins-like syndrome;
NM_001330078.2(NRXN1):c.*2386A>G9378NRXN1Uncertain significance-1RCV001138842; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014669650146696TC2:g.50146696T>C-
NM_001330078.2(NRXN1):c.*2377T>C9378NRXN1Uncertain significancers543797695RCV000310530; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014670550146705AG2:g.50146705A>GClinGen:CA10615815CN239445 Pitt-Hopkins-like syndrome;
NM_001330078.2(NRXN1):c.*2373G>A9378NRXN1Uncertain significancers886056158RCV000362933; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014670950146709CT2:g.50146709C>TClinGen:CA10615816CN239445 Pitt-Hopkins-like syndrome;
NM_001330078.2(NRXN1):c.*2372G>A9378NRXN1Benignrs116370948RCV000391503; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014671050146710CT2:g.50146710C>TClinGen:CA10614092CN239445 Pitt-Hopkins-like syndrome;
NM_001330078.2(NRXN1):c.*2298C>G9378NRXN1Uncertain significance-1RCV001138843; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014678450146784GC2:g.50146784G>C-
NM_001330078.2(NRXN1):c.*2286C>A9378NRXN1Uncertain significancers886056159RCV000305318; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014679650146796GT2:g.50146796G>TClinGen:CA10613627CN239445 Pitt-Hopkins-like syndrome;
NM_001330078.2(NRXN1):c.*2285T>A9378NRXN1Uncertain significance-1RCV001138844; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014679750146797AT2:g.50146797A>T-
NM_001330078.2(NRXN1):c.*2277G>A9378NRXN1Likely benignrs187875122RCV000357703; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014680550146805CT2:g.50146805C>TClinGen:CA10614098CN239445 Pitt-Hopkins-like syndrome;
NM_001330078.2(NRXN1):c.*2222A>G9378NRXN1Uncertain significancers551566143RCV000265322; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014686050146860TC2:g.50146860T>CClinGen:CA10614101CN239445 Pitt-Hopkins-like syndrome;
NM_001330078.2(NRXN1):c.*2116C>A9378NRXN1Uncertain significance-1RCV001141427; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014696650146966GT2:g.50146966G>T-
NM_001330078.2(NRXN1):c.*2105A>C9378NRXN1Benign-1RCV001141428; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014697750146977TG2:g.50146977T>G-
NM_001330078.2(NRXN1):c.*2025T>A9378NRXN1Uncertain significance-1RCV001141429; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014705750147057AT2:g.50147057A>T-
NM_001330078.2(NRXN1):c.*1911G>T9378NRXN1Benignrs11885824RCV000318011; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014717150147171CA2:g.50147171C>AClinGen:CA10615818CN239445 Pitt-Hopkins-like syndrome;
NM_001330078.2(NRXN1):c.*1842A>C9378NRXN1Uncertain significance-1RCV001141430; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014724050147240TG2:g.50147240T>G-
NM_001330078.2(NRXN1):c.*1692T>C9378NRXN1Benign-1RCV001141431; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014739050147390AG2:g.50147390A>G-
NM_001330078.2(NRXN1):c.*1583T>C9378NRXN1Uncertain significance-1RCV001141432; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014749950147499AG2:g.50147499A>G-
NM_001330078.2(NRXN1):c.*1539C>G9378NRXN1Benign-1RCV001143272; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014754350147543GC2:g.50147543G>C-
NM_001330078.2(NRXN1):c.*1524T>G9378NRXN1Uncertain significancers201970726RCV000259315; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014755850147558AC2:g.50147558A>CClinGen:CA10615535CN239445 Pitt-Hopkins-like syndrome;
NM_001330078.2(NRXN1):c.*1389T>A9378NRXN1Uncertain significance-1RCV001143273; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014769350147693AT2:g.50147693A>T-
NM_001330078.2(NRXN1):c.*1365A>G9378NRXN1Benign-1RCV001143274; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014771750147717TC2:g.50147717T>C-
NM_001330078.2(NRXN1):c.*1348C>G9378NRXN1Uncertain significance-1RCV001143275; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014773450147734GC2:g.50147734G>C-
NM_001330078.2(NRXN1):c.*1327C>G9378NRXN1Benignrs12998798RCV000316854; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014775550147755GC2:g.50147755G>CClinGen:CA10614103CN239445 Pitt-Hopkins-like syndrome;
NM_001330078.2(NRXN1):c.*1318A>C9378NRXN1Uncertain significance-1RCV001143276; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014776450147764TG2:g.50147764T>G-
NM_001330078.2(NRXN1):c.*1201A>T9378NRXN1Uncertain significance-1RCV001143277; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014788150147881TA2:g.50147881T>A-
NM_001330078.2(NRXN1):c.*1195A>G9378NRXN1Uncertain significancers200452275RCV000347611; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014788750147887TC2:g.50147887T>CClinGen:CA10615834CN239445 Pitt-Hopkins-like syndrome;
NM_001330078.2(NRXN1):c.*1090G>A9378NRXN1Uncertain significancers199680726RCV000398069; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014799250147992CT2:g.50147992C>TClinGen:CA10613633CN239445 Pitt-Hopkins-like syndrome;
NM_001330078.2(NRXN1):c.*1019G>A9378NRXN1Uncertain significancers886056163RCV000341922; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014806350148063CT2:g.50148063C>TClinGen:CA10614120
NM_001330078.2(NRXN1):c.*814G>A9378NRXN1Uncertain significancers886056165RCV000399645; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014826850148268CT2:g.50148268C>TClinGen:CA10615837
NM_001330078.2(NRXN1):c.*803C>G9378NRXN1Uncertain significance-1RCV001136703; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014827950148279GC2:g.50148279G>C-
NM_001330078.2(NRXN1):c.*793C>T9378NRXN1Uncertain significance-1RCV001136704; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014828950148289GA2:g.50148289G>A-
NM_001330078.2(NRXN1):c.*620A>T9378NRXN1Uncertain significancers202136352RCV000301131; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014846250148462TA2:g.50148462T>AClinGen:CA10613643
NM_001330078.2(NRXN1):c.*582G>C9378NRXN1Uncertain significance-1RCV001136705; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014850050148500CG2:g.50148500C>G-
NM_001330078.2(NRXN1):c.*573A>C9378NRXN1Likely benignrs184870922RCV000261858; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014850950148509TG2:g.50148509T>GClinGen:CA10613644
NM_001330078.2(NRXN1):c.*540T>A9378NRXN1Benign-1RCV001138942; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014854250148542AT2:g.50148542A>T-
NM_001330078.2(NRXN1):c.*527A>G9378NRXN1Uncertain significance-1RCV001138943; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014855550148555TC2:g.50148555T>C-
NM_001330078.2(NRXN1):c.*435T>C9378NRXN1Uncertain significancers200957137RCV000312357; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014864750148647AG2:g.50148647A>GClinGen:CA10615538
NM_001330078.2(NRXN1):c.*434A>G9378NRXN1Uncertain significance-1RCV001138944; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014864850148648TC2:g.50148648T>C-
NM_001330078.2(NRXN1):c.*383A>G9378NRXN1Uncertain significancers886056168RCV000277013; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014869950148699TC2:g.50148699T>CClinGen:CA10614133
NM_001330078.2(NRXN1):c.*381C>G9378NRXN1Uncertain significance-1RCV001138945; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014870150148701GC2:g.50148701G>C-
NM_001330078.2(NRXN1):c.*319T>C9378NRXN1Uncertain significancers201147530RCV000332103; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014876350148763AG2:g.50148763A>GClinGen:CA10615544
NM_001330078.2(NRXN1):c.*232G>A9378NRXN1Uncertain significance-1RCV001141543; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014885050148850CT2:g.50148850C>T-
NM_001330078.2(NRXN1):c.*110G>A9378NRXN1Benignrs1045881RCV000649755; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014897250148972CT2:g.50148972C>TClinGen:CA10615546
NM_001330078.2(NRXN1):c.*98A>G9378NRXN1Uncertain significancers201147127RCV000268658; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014898450148984TC2:g.50148984T>CClinGen:CA10615843
NC_000002.12:g.(?_49921924)_(49943811_?)del9378NRXN1Uncertain significance-1RCV000545080; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014906250170949nana-
NC_000002.12:g.(?_49921924)_(50055064_?)del9378NRXN1Uncertain significance-1RCV000649763; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014906250282202nana-C3280479 614325 Pitt-Hopkins-like syndrome 2;
NM_001330078.2(NRXN1):c.*12T>G9378NRXN1Uncertain significance-1RCV001141544; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014907050149070AC2:g.50149070A>C-
NM_001330078.2(NRXN1):c.4485C>T (p.Asn1495=)9378NRXN1Likely benignrs200814948RCV000600978|RCV000869466; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014912150149121GA2:g.50149121G>AClinGen:CA1654205CN169374 not specified;
NM_001330078.2(NRXN1):c.4473G>A (p.Ala1491=)9378NRXN1Benign/Likely benignrs113380721RCV000186640|RCV000459770|RCV000717459; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150|MedGen:C271175425014913350149133CT2:g.50149133C>TClinGen:CA232549CN169374 not specified;
NM_001330078.2(NRXN1):c.4444G>A (p.Val1482Ile)9378NRXN1Uncertain significance-1RCV001199339; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014916250149162CT2:g.50149162C>T-
NM_001330078.2(NRXN1):c.4428A>G (p.Ala1476=)9378NRXN1Likely benignrs184343684RCV000425330|RCV000878786; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014917850149178TC2:g.50149178T>CClinGen:CA1654211CN169374 not specified;
NM_001330078.2(NRXN1):c.4392T>C (p.His1464=)9378NRXN1Conflicting interpretations of pathogenicityrs112536447RCV000127237|RCV000649752|RCV000717146; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150|MedGen:C271175425014921450149214AG2:g.50149214A>GClinGen:CA292593CN169374 not specified;
NM_001330078.2(NRXN1):c.4352C>T (p.Ala1451Val)9378NRXN1Uncertain significancers1060503175RCV000471230; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014925450149254GA2:g.50149254G>AClinGen:CA16611090
NM_001330078.2(NRXN1):c.4344C>T (p.Leu1448=)9378NRXN1Likely benignrs111725706RCV000914493; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014926250149262GA2:g.50149262G>A-
NM_001330078.2(NRXN1):c.4338T>C (p.Leu1446=)9378NRXN1Benign/Likely benignrs796052759RCV000188222|RCV000649757; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014926850149268AG2:g.50149268A>GClinGen:CA316049CN169374 not specified;
NM_001330078.2(NRXN1):c.4337T>A (p.Leu1446His)9378NRXN1Uncertain significancers1293864569RCV000649730; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014926950149269AT2:g.50149269A>TClinGen:CA346818583C3280479 614325 Pitt-Hopkins-like syndrome 2;
NM_001330078.2(NRXN1):c.4324G>A (p.Ala1442Thr)9378NRXN1Uncertain significance-1RCV001244843; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014928250149282CT2:g.50149282C>T-
NM_001330078.2(NRXN1):c.4275G>T (p.Arg1425=)9378NRXN1Conflicting interpretations of pathogenicityrs143495349RCV000127236|RCV000463080|RCV000715969|RCV001085278; NMedGen:CN169374|MedGen:CN517202|MedGen:C2711754|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014933150149331CA2:g.50149331C>AClinGen:CA292591CN169374 not specified;
NM_001330078.2(NRXN1):c.4257C>G (p.Gly1419=)9378NRXN1Uncertain significance-1RCV001044830; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014934950149349GC2:g.50149349G>C-
NM_001330078.2(NRXN1):c.4254A>G (p.Pro1418=)9378NRXN1Conflicting interpretations of pathogenicityrs55923848RCV000186639|RCV000716113|RCV000723887|RCV001082689; NMedGen:CN169374|MedGen:C2711754|MedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014935250149352TC2:g.50149352T>CClinGen:CA231344CN169374 not specified;
NM_001330078.2(NRXN1):c.4248G>A (p.Pro1416=)9378NRXN1Conflicting interpretations of pathogenicityrs151195816RCV000193445|RCV000719951|RCV000866214; NMedGen:CN169374|MedGen:C2711754|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014935850149358CT2:g.50149358C>TClinGen:CA206946CN169374 not specified;
NM_001330078.2(NRXN1):c.4247C>G (p.Pro1416Arg)9378NRXN1Uncertain significancers199697191RCV000703445; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014935950149359GC2:g.50149359G>C-C3280479 614325 Pitt-Hopkins-like syndrome 2;
NM_001330078.2(NRXN1):c.4237G>A (p.Gly1413Ser)9378NRXN1Uncertain significancers200604893RCV000188306|RCV000534805; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014936950149369CT2:g.50149369C>TClinGen:CA316192CN169374 not specified;
NM_001330078.2(NRXN1):c.4236C>T (p.Gly1412=)9378NRXN1Conflicting interpretations of pathogenicityrs587781101RCV000127235|RCV000703577; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014937050149370GA2:g.50149370G>AClinGen:CA292589CN169374 not specified;
NM_001330078.2(NRXN1):c.4233A>C (p.Ala1411=)9378NRXN1Likely benignrs199973187RCV000887652; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014937350149373TG2:g.50149373T>G-
NM_001330078.2(NRXN1):c.4229G>A (p.Arg1410Gln)9378NRXN1Uncertain significance-1RCV001143378; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014937750149377CT2:g.50149377C>T-
NM_001330078.2(NRXN1):c.4228C>T (p.Arg1410Ter)9378NRXN1Uncertain significance-1RCV001064291; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014937850149378GA2:g.50149378G>A-
NM_001330078.2(NRXN1):c.4220A>G (p.Asn1407Ser)9378NRXN1Uncertain significancers146968018RCV000688095; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025014938650149386TC2:g.50149386T>C-
NC_000002.12:g.(?_49943684)_(49943811_?)del9378NRXN1Uncertain significance-1RCV001033249; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025017082250170949nana-1-
NM_001330078.2(NRXN1):c.4216+9A>G9378NRXN1Likely benignrs201702263RCV000925833; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025017083350170833TC2:g.50170833T>C-
NM_001330078.2(NRXN1):c.4176T>C (p.Asp1392=)9378NRXN1Likely benignrs201135028RCV000440335|RCV000472283; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025017088250170882AG2:g.50170882A>GClinGen:CA1654258CN169374 not specified;
NM_001330078.2(NRXN1):c.4167C>G (p.Pro1389=)9378NRXN1Conflicting interpretations of pathogenicityrs143446587RCV000194780|RCV000558765|RCV000719287; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150|MedGen:C271175425017089150170891GC2:g.50170891G>CClinGen:CA209189
NM_001330078.2(NRXN1):c.4130C>T (p.Thr1377Ile)9378NRXN1Uncertain significance-1RCV001069537; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025017092850170928GA2:g.50170928G>A-
NM_001330078.2(NRXN1):c.4129-30181T>C9378NRXN1Benignrs9636391RCV000986758; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025020111050201110AG2:g.50201110A>G-
NC_000002.12:g.(?_50053251)_(50055064_?)del9378NRXN1Pathogenic-1RCV000649766; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025028038950282202nana-
NM_001330078.2(NRXN1):c.4128+3G>A9378NRXN1Uncertain significance-1RCV001051867; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025028040650280406CT2:g.50280406C>T-
NM_001330078.2(NRXN1):c.4107G>A (p.Pro1369=)9378NRXN1Likely benignrs183440866RCV000444959|RCV000649759; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025028043050280430CT2:g.50280430C>TClinGen:CA1654303CN169374 not specified;
NM_001330078.2(NRXN1):c.4094G>T (p.Arg1365Ile)9378NRXN1Uncertain significancers1220949138RCV000810753; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025028044350280443CA2:g.50280443C>A-
NM_001330078.2(NRXN1):c.4088C>A (p.Ala1363Asp)9378NRXN1Uncertain significancers781551221RCV000688996; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025028044950280449GT2:g.50280449G>T-
NM_001330078.2(NRXN1):c.4068G>A (p.Thr1356=)9378NRXN1Benignrs74714098RCV000117840|RCV000473497|RCV000716687; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150|MedGen:C271175425028046950280469CT2:g.50280469C>TClinGen:CA288974CN169374 not specified;
NM_001330078.2(NRXN1):c.4060A>T (p.Thr1354Ser)9378NRXN1Conflicting interpretations of pathogenicityrs202006815RCV000335433|RCV000649756; NMONDO:MONDO:0016377,MedGen:C4751168, Orphanet:221150|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025028047750280477TA2:g.50280477T>AClinGen:CA1654309
NM_001330078.2(NRXN1):c.4029G>A (p.Met1343Ile)9378NRXN1Uncertain significancers146100580RCV000521963|RCV000697380; NMedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025028050850280508CT2:g.50280508C>TClinGen:CA1654314CN169374 not specified;
NM_001330078.2(NRXN1):c.4025C>T (p.Ala1342Val)9378NRXN1Uncertain significance-1RCV001051664; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025028051250280512GA2:g.50280512G>A-
NM_001330078.2(NRXN1):c.4011G>C (p.Glu1337Asp)9378NRXN1Conflicting interpretations of pathogenicityrs200935246RCV000725076|RCV000764438|RCV001088709; NMedGen:CN517202|MONDO:MONDO:0013696,MedGen:C3808494,OMIM:614332; MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025028052650280526CG2:g.50280526C>GClinGen:CA316208CN169374 not specified;
NM_001330078.2(NRXN1):c.4004C>T (p.Thr1335Ile)9378NRXN1Conflicting interpretations of pathogenicityrs200672080RCV000188315|RCV000190702|RCV000656931|RCV001080620; NMedGen:CN169374|MeSH:D030342,MedGen:C0950123|MedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025028053350280533GA2:g.50280533G>AClinGen:CA204683C0950123 Inborn genetic diseases;
NM_001330078.2(NRXN1):c.3995C>T (p.Ser1332Phe)9378NRXN1Uncertain significance-1RCV001209982; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025028054250280542GA2:g.50280542G>A-
NM_001330078.2(NRXN1):c.3954C>T (p.Ile1318=)9378NRXN1Likely benignrs201464255RCV000977697; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025028058350280583GA2:g.50280583G>A-
NM_001330078.2(NRXN1):c.3947C>G (p.Ala1316Gly)9378NRXN1Uncertain significance-1RCV001226258; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025028059050280590GC2:g.50280590G>C-
NM_001330078.2(NRXN1):c.3933A>G (p.Ala1311=)9378NRXN1Benign/Likely benignrs79970751RCV000079527|RCV000710166|RCV000715126|RCV001080183; NMedGen:CN169374|MedGen:CN517202|MedGen:C2711754|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025028060450280604TC2:g.50280604T>CClinGen:CA285443CN169374 not specified;
NM_001330078.2(NRXN1):c.3919G>A (p.Val1307Ile)9378NRXN1Uncertain significancers200044811RCV000535888|RCV000720025; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150|MedGen:C271175425028061850280618CT2:g.50280618C>TClinGen:CA47835511
NM_001330078.2(NRXN1):c.3876del (p.Phe1293fs)9378NRXN1Pathogenicrs1573629114RCV000818853; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025028066150280661AGA2:g.50280661_50280661del-
NM_001330078.2(NRXN1):c.3869G>T (p.Gly1290Val)9378NRXN1Uncertain significancers1558777086RCV000695299; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025028066850280668CA2:g.50280668C>A-C3280479 614325 Pitt-Hopkins-like syndrome 2;
NM_001330078.2(NRXN1):c.3865C>A (p.Gln1289Lys)9378NRXN1Uncertain significance-1RCV001038595; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025028067250280672GT2:g.50280672G>T-
NM_001330078.2(NRXN1):c.3855C>T (p.Gly1285=)9378NRXN1Uncertain significancers55776596RCV000693370; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025028068250280682GA2:g.50280682G>A-C3280479 614325 Pitt-Hopkins-like syndrome 2;
NM_001330078.2(NRXN1):c.3842C>A (p.Thr1281Asn)9378NRXN1Uncertain significancers1573629404RCV000811683; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025028069550280695GT2:g.50280695G>T-
NM_001330078.2(NRXN1):c.3838G>A (p.Ala1280Thr)9378NRXN1Uncertain significance-1RCV001243611; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025028069950280699CT2:g.50280699C>T-
NM_001330078.2(NRXN1):c.3808+3dup9378NRXN1Likely benignrs770051379RCV000609974|RCV000983756; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025028208450282085GGT2:g.50282084_50282085insTClinGen:CA1654362CN169374 not specified;
NM_001330078.2(NRXN1):c.3799C>T (p.Leu1267Phe)9378NRXN1Uncertain significance-1RCV001234128; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025028210250282102GA2:g.50282102G>A-
NM_001330078.2(NRXN1):c.3775G>C (p.Gly1259Arg)9378NRXN1Uncertain significancers1558780258RCV000695626; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025028212650282126CG2:g.50282126C>G-
NM_001330078.2(NRXN1):c.3771A>G (p.Arg1257=)9378NRXN1Likely benignrs201390160RCV000939849; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025028213050282130TC2:g.50282130T>C-
NM_001330078.2(NRXN1):c.3770G>A (p.Arg1257Gln)9378NRXN1Uncertain significancers1573636785RCV000806612; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025028213150282131CT2:g.50282131C>T-
NM_001330078.2(NRXN1):c.3733G>A (p.Glu1245Lys)9378NRXN1Uncertain significance-1RCV001205822; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025028216850282168CT2:g.50282168C>T-
NM_001330078.2(NRXN1):c.3718+8A>G9378NRXN1Uncertain significancers939526667RCV000818765; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025031845350318453TC2:g.50318453T>C-
NM_001330078.2(NRXN1):c.3718+7A>G9378NRXN1Likely benignrs752561425RCV000649760; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025031845450318454TC2:g.50318454T>CClinGen:CA658795793C3280479 614325 Pitt-Hopkins-like syndrome 2;
NM_001330078.2(NRXN1):c.3647G>A (p.Arg1216His)9378NRXN1Uncertain significance-1RCV001070705; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025031853250318532CT2:g.50318532C>T-
NM_001330078.2(NRXN1):c.3646C>T (p.Arg1216Cys)9378NRXN1Uncertain significancers199888301RCV000300196; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025031853350318533GA2:g.50318533G>AClinGen:CA10614135
NM_001330078.2(NRXN1):c.3634T>A (p.Tyr1212Asn)9378NRXN1Uncertain significance-1RCV001063829; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025031854550318545AT2:g.50318545A>T-
NM_001330078.2(NRXN1):c.3630G>T (p.Gly1210=)9378NRXN1Uncertain significancers200865423RCV000812573; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025031854950318549CA2:g.50318549C>A-
NM_001330078.2(NRXN1):c.3618C>T (p.Ile1206=)9378NRXN1Likely benignrs1573859191RCV000981150; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025031856150318561GA2:g.50318561G>A-
NM_001330078.2(NRXN1):c.3612T>A (p.Asn1204Lys)9378NRXN1Uncertain significancers757509384RCV000649740; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025031856750318567AT2:g.50318567A>TClinGen:CA1654406
NM_001330078.2(NRXN1):c.3595G>A (p.Ala1199Thr)9378NRXN1Likely benignrs201336161RCV000188296|RCV000559566; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025031858450318584CT2:g.50318584C>TClinGen:CA316173CN169374 not specified;
NM_001330078.2(NRXN1):c.3552G>C (p.Gln1184His)9378NRXN1Uncertain significancers886056169RCV000350502; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025031862750318627CG2:g.50318627C>GClinGen:CA10614137
NM_001330078.2(NRXN1):c.3547-10T>G9378NRXN1Likely benignrs201072369RCV000873897; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025031864250318642AC2:g.50318642A>C-
NC_000002.12:g.(?_50236769)_(50346969_?)dup9378NRXN1Likely pathogenic-1RCV001033736; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025046390750574107nana-1-
NM_001330078.2(NRXN1):c.3542A>G (p.His1181Arg)9378NRXN1Uncertain significancers200915287RCV000188300|RCV000764439; NMedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150; MONDO:MONDO:0013696,MedGen:C3808494,OMIM:61433225046393150463931TC2:g.50463931T>CClinGen:CA316181CN169374 not specified;
NM_001330078.2(NRXN1):c.3532C>A (p.Leu1178Ile)9378NRXN1Uncertain significancers201442938RCV000390224; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025046394150463941GT2:g.50463941G>TClinGen:CA1654448
NM_001330078.2(NRXN1):c.3524G>A (p.Gly1175Asp)9378NRXN1Uncertain significance-1RCV001068753; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025046394950463949CT2:g.50463949C>T-
NM_001330078.2(NRXN1):c.3490G>A (p.Val1164Ile)9378NRXN1Uncertain significance-1RCV001213367; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025046398350463983CT2:g.50463983C>T-
NM_001330078.2(NRXN1):c.3489C>T (p.Ala1163=)9378NRXN1Conflicting interpretations of pathogenicityrs147580960RCV000433174|RCV000732176|RCV001087630; NMedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025046398450463984GA2:g.50463984G>AClinGen:CA1654452CN169374 not specified;
NM_001330078.2(NRXN1):c.3442C>T (p.Arg1148Ter)9378NRXN1Pathogenic-1RCV001218116; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025046403150464031GA2:g.50464031G>A-
NM_001330078.2(NRXN1):c.3408G>A (p.Thr1136=)9378NRXN1Benign/Likely benignrs80094872RCV000117839|RCV000233932|RCV000717050; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150|MedGen:C271175425046406550464065CT2:g.50464065C>TClinGen:CA288972CN169374 not specified;
NM_001330078.2(NRXN1):c.3407C>T (p.Thr1136Met)9378NRXN1Uncertain significancers138261348RCV000689247|RCV000764440; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150; MONDO:MONDO:0013696,MedGen:C3808494,OMIM:61433225046406650464066GA2:g.50464066G>A-C3280479 614325 Pitt-Hopkins-like syndrome 2;
NM_001330078.2(NRXN1):c.3384T>C (p.Phe1128=)9378NRXN1Conflicting interpretations of pathogenicityrs751894635RCV000369791|RCV000424165; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150|MedGen:CN16937425046408950464089AG2:g.50464089A>GClinGen:CA1654466
NM_001330078.2(NRXN1):c.3378T>C (p.Tyr1126=)9378NRXN1Likely benignrs1420076341RCV000547148; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025046409550464095AG2:g.50464095A>GClinGen:CA426101933C3280479 614325 Pitt-Hopkins-like syndrome 2;
NM_001330078.2(NRXN1):c.3375A>G (p.Thr1125=)9378NRXN1Likely benignrs757748286RCV000604096|RCV000924784; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025046409850464098TC2:g.50464098T>CClinGen:CA1654468CN169374 not specified;
NM_001330078.2(NRXN1):c.3371C>T (p.Thr1124Met)9378NRXN1Uncertain significance-1RCV001243347; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025046410250464102GA2:g.50464102G>A-
NM_001330078.2(NRXN1):c.3365-3C>T9378NRXN1Uncertain significancers1553807559RCV000649761; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025046411150464111GA2:g.50464111G>AClinGen:CA658795792C3280479 614325 Pitt-Hopkins-like syndrome 2;
NC_000002.12:g.(?_50346671)_(50623635_?)del9378NRXN1Uncertain significance-1RCV000813977; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025057380950850773nana-
NM_138735.4(NRXN1):c.49GGC[11] (p.Gly17[11])9378NRXN1Conflicting interpretations of pathogenicityrs750165040RCV000266728|RCV000719298|RCV001080228; NMedGen:CN517202|MedGen:C2711754|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025057400850574009GGCGC2:g.50574008_50574009insCGCClinGen:CA10604227
NM_001330078.2(NRXN1):c.3365-109902C>T9378NRXN1Uncertain significancers113067443RCV000768035; NMONDO:MONDO:0013696,MedGen:C3808494,OMIM:614332; MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025057401050574010GA2:g.50574010G>A-
NM_001330078.2(NRXN1):c.3365-109939C>T9378NRXN1Uncertain significancers766942777RCV000487952|RCV000720337|RCV000764441; NMedGen:CN517202|MedGen:C2711754|MONDO:MONDO:0013696,MedGen:C3808494,OMIM:614332; MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025057404750574047GA2:g.50574047G>AClinGen:CA316175CN517202 not provided;
NM_001330078.2(NRXN1):c.3365-109952G>T9378NRXN1Uncertain significance-1RCV001197274; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025057406050574060CA2:g.50574060C>A-
NM_001330078.2(NRXN1):c.3365-110131T>G9378NRXN1Likely benignrs193267438RCV000209863; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025057423950574239AC2:g.50574239A>CClinGen:CA354185C3280479 614325 Pitt-Hopkins-like syndrome 2;
NM_001330078.2(NRXN1):c.3364+13144G>A9378NRXN1Uncertain significancers188620205RCV000626017; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025067943650679436CT2:g.50679436C>TClinGen:CA47943100C3280479 614325 Pitt-Hopkins-like syndrome 2;
NC_000002.12:g.(?_50465422)_(51032054_?)del9378NRXN1Pathogenic-1RCV000649762; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025069256051259192nana-
NC_000002.12:g.(?_50465422)_(50623635_?)del9378NRXN1Uncertain significance-1RCV000707915; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025069256050850773nana-
NC_000002.12:g.(?_50465422)_(50472491_?)del9378NRXN1Uncertain significance-1RCV000708376; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025069256050699629nana-C3280479 614325 Pitt-Hopkins-like syndrome 2;
NM_001330078.2(NRXN1):c.3364+9C>T9378NRXN1Uncertain significancers200767650RCV000270547; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025069257150692571GA2:g.50692571G>AClinGen:CA1654590
NM_001330078.2(NRXN1):c.3364C>T (p.Pro1122Ser)9378NRXN1Uncertain significancers1442195856RCV000705070; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025069258050692580GA2:g.50692580G>A-
NM_001330078.2(NRXN1):c.3344G>A (p.Ser1115Asn)9378NRXN1Uncertain significancers201871194RCV000117838|RCV001046749; NMedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025069260050692600CT2:g.50692600C>TClinGen:CA231342CN517202 not provided;
NM_001330078.2(NRXN1):c.3311G>A (p.Gly1104Asp)9378NRXN1Uncertain significance-1RCV001215573; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025069263350692633CT2:g.50692633C>T-
NM_001330078.2(NRXN1):c.3281A>G (p.Asn1094Ser)9378NRXN1Uncertain significancers201963074RCV000188291|RCV000529852; NMedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025069266350692663TC2:g.50692663T>CClinGen:CA316167CN169374 not specified;
NM_001330078.2(NRXN1):c.3254C>T (p.Thr1085Ile)9378NRXN1Uncertain significancers796052784RCV000188290|RCV000817752; NMedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025069269050692690GA2:g.50692690G>AClinGen:CA316165
NM_001330078.2(NRXN1):c.3249C>T (p.Pro1083=)9378NRXN1Benign/Likely benignrs116236999RCV000117837|RCV000231057|RCV000717618; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150|MedGen:C271175425069269550692695GA2:g.50692695G>AClinGen:CA288970CN169374 not specified;
NM_001330078.2(NRXN1):c.3245-10T>G9378NRXN1Uncertain significancers1553645389RCV000649729; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025069270950692709AC2:g.50692709A>CClinGen:CA658795795
NM_001330078.2(NRXN1):c.3237A>G (p.Gly1079=)9378NRXN1Uncertain significancers886056170RCV000366377; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025069944350699443TC2:g.50699443T>CClinGen:CA10613645CN239445 Pitt-Hopkins-like syndrome;
NM_001330078.2(NRXN1):c.3219C>T (p.Asn1073=)9378NRXN1Conflicting interpretations of pathogenicityrs563089155RCV000117836|RCV000417600|RCV000715887|RCV001088487; NMedGen:CN517202|MedGen:CN169374|MedGen:C2711754|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025069946150699461GA2:g.50699461G>AClinGen:CA231340CN517202 not provided;
NM_001330078.2(NRXN1):c.3211T>C (p.Phe1071Leu)9378NRXN1Uncertain significance-1RCV001218337; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025069946950699469AG2:g.50699469A>G-
NM_001330078.2(NRXN1):c.3205G>A (p.Ala1069Thr)9378NRXN1Uncertain significance-1RCV001205185; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025069947550699475CT2:g.50699475C>T-
NM_001330078.2(NRXN1):c.3201C>T (p.Ser1067=)9378NRXN1Conflicting interpretations of pathogenicityrs75275592RCV000188237|RCV000585295|RCV000720494|RCV001084649; NMedGen:CN169374|MedGen:CN517202|MedGen:C2711754|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025069947950699479GA2:g.50699479G>AClinGen:CA316067CN517202 not provided;
NM_001330078.2(NRXN1):c.3189G>A (p.Pro1063=)9378NRXN1Uncertain significance-1RCV001058065; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025069949150699491CT2:g.50699491C>T-
NM_001330078.2(NRXN1):c.3181C>T (p.Arg1061Trp)9378NRXN1Uncertain significancers765632172RCV000459018; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025069949950699499GA2:g.50699499G>AClinGen:CA1654650
NM_001330078.2(NRXN1):c.3139G>C (p.Glu1047Gln)9378NRXN1Uncertain significance-1RCV001139046; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025069954150699541CG2:g.50699541C>G-
NM_001330078.2(NRXN1):c.3129A>G (p.Val1043=)9378NRXN1Conflicting interpretations of pathogenicityrs200698497RCV000186647|RCV000720775|RCV000723586|RCV001086473; NMedGen:CN169374|MedGen:C2711754|MedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025069955150699551TC2:g.50699551T>CClinGen:CA221543CN169374 not specified;
NM_001330078.2(NRXN1):c.3103A>G (p.Thr1035Ala)9378NRXN1Uncertain significancers753262049RCV000726048|RCV000817074; NMedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025069957750699577TC2:g.50699577T>CClinGen:CA1654656
NM_001330078.2(NRXN1):c.3090A>C (p.Gly1030=)9378NRXN1Conflicting interpretations of pathogenicityrs201886024RCV000188236|RCV000477294|RCV001087851; NMedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025069959050699590TG2:g.50699590T>GClinGen:CA316065CN169374 not specified;
NM_001330078.2(NRXN1):c.3049G>C (p.Ala1017Pro)9378NRXN1Uncertain significance-1RCV001228295; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025072306450723064CG2:g.50723064C>G-
NM_001330078.2(NRXN1):c.3046G>A (p.Gly1016Arg)9378NRXN1Uncertain significancers1553698219RCV000533202; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025072306750723067CT2:g.50723067C>TClinGen:CA346776287C3280479 614325 Pitt-Hopkins-like syndrome 2;
NM_001330078.2(NRXN1):c.3045C>T (p.Ala1015=)9378NRXN1Conflicting interpretations of pathogenicityrs56402642RCV000186646|RCV000710165|RCV000718506|RCV001085705; NMedGen:CN169374|MedGen:CN517202|MedGen:C2711754|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025072306850723068GA2:g.50723068G>AClinGen:CA221538CN169374 not specified;
NM_001330078.2(NRXN1):c.3039C>G (p.Ile1013Met)9378NRXN1Uncertain significancers1553698285RCV000624080; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025072307450723074GC2:g.50723074G>CClinGen:CA346776298
NM_001330078.2(NRXN1):c.3033G>T (p.Thr1011=)9378NRXN1Likely benignrs764611037RCV000920158; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025072308050723080CA2:g.50723080C>A-
NM_001330078.2(NRXN1):c.3032C>T (p.Thr1011Met)9378NRXN1Uncertain significancers199980022RCV000188286|RCV000552360; NMedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025072308150723081GA2:g.50723081G>AClinGen:CA316157CN169374 not specified;
NM_001330078.2(NRXN1):c.3030A>G (p.Thr1010=)9378NRXN1Likely benignrs201085950RCV000436570|RCV000861922; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025072308350723083TC2:g.50723083T>CClinGen:CA1654690CN169374 not specified;
NM_001330078.2(NRXN1):c.3012G>A (p.Lys1004=)9378NRXN1Conflicting interpretations of pathogenicityrs201118246RCV000079520|RCV001078643; NMedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025072310150723101CT2:g.50723101C>TClinGen:CA221534CN169374 not specified;
NM_001330078.2(NRXN1):c.3005C>T (p.Thr1002Ile)9378NRXN1Uncertain significance-1RCV001052443; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025072310850723108GA2:g.50723108G>A-
NM_001330078.2(NRXN1):c.2970C>T (p.Asn990=)9378NRXN1Likely benignrs534591485RCV000868456; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025072314350723143GA2:g.50723143G>A-
NM_001330078.2(NRXN1):c.2967C>T (p.His989=)9378NRXN1Likely benignrs1449052965RCV000932023; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025072314650723146GA2:g.50723146G>A-
NM_001330078.2(NRXN1):c.2953G>A (p.Asp985Asn)9378NRXN1Uncertain significancers1553698631RCV000517560|RCV000544411; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025072316050723160CT2:g.50723160C>TClinGen:CA346776494
NM_001330078.2(NRXN1):c.2936C>G (p.Ser979Ter)9378NRXN1Pathogenicrs267606922RCV000009608; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025072317750723177GC2:g.50723177G>CClinGen:CA120070,OMIM:600565.0002C3280479 614325 Pitt-Hopkins-like syndrome 2;
NM_001330078.2(NRXN1):c.2844T>A (p.Asp948Glu)9378NRXN1Uncertain significance-1RCV001056846; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025072450650724506AT2:g.50724506A>T-
NM_001330078.2(NRXN1):c.2841G>A (p.Gly947=)9378NRXN1Likely benignrs201264810RCV000929375; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025072450950724509CT2:g.50724509C>T-
NM_001330078.2(NRXN1):c.2837G>T (p.Ser946Ile)9378NRXN1Uncertain significancers201337797RCV000798024; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025072451350724513CA2:g.50724513C>A-
NM_001330078.2(NRXN1):c.2829A>G (p.Leu943=)9378NRXN1Likely benignrs754048752RCV000227099; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025072452150724521TC2:g.50724521T>CClinGen:CA1654729C3280479 614325 Pitt-Hopkins-like syndrome 2;
NM_001330078.2(NRXN1):c.2799C>G (p.Phe933Leu)9378NRXN1Uncertain significance-1RCV001035789; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025072455150724551GC2:g.50724551G>C-
NM_001330078.2(NRXN1):c.2772C>T (p.Tyr924=)9378NRXN1Conflicting interpretations of pathogenicityrs200182626RCV000188235|RCV000719723|RCV000727636|RCV001088099; NMedGen:CN169374|MedGen:C2711754|MedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025072457850724578GA2:g.50724578G>AClinGen:CA316063CN169374 not specified;
NM_001330078.2(NRXN1):c.2731A>G (p.Thr911Ala)9378NRXN1Uncertain significance-1RCV001070408|RCV001251855; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150|Human Phenotype Ontology:HP:0000730,Human Phenotype Ontology:HP:0001249,Human Phenotype Ontology:HP:0001267,Human Phenotype Ontology:HP:0001286,Human Phenotype Ontology:HP:0002122,Human Phe25072461950724619TC2:g.50724619T>C-
NM_001330078.2(NRXN1):c.2730G>A (p.Lys910=)9378NRXN1Conflicting interpretations of pathogenicityrs192909520RCV000186645|RCV000720068|RCV000723568|RCV001081066; NMedGen:CN169374|MedGen:C2711754|MedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025072462050724620CT2:g.50724620C>TClinGen:CA221531CN169374 not specified;
NM_001330078.2(NRXN1):c.2717C>T (p.Pro906Leu)9378NRXN1Uncertain significancers1558833706RCV000696016; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025072463350724633GA2:g.50724633G>A-C3280479 614325 Pitt-Hopkins-like syndrome 2;
NM_001330078.2(NRXN1):c.2714A>C (p.Asp905Ala)9378NRXN1Uncertain significance-1RCV001057827; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025072463650724636TG2:g.50724636T>G-
NM_001330078.2(NRXN1):c.2713G>A (p.Asp905Asn)9378NRXN1Uncertain significancers773147215RCV000531661; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025072463750724637CT2:g.50724637C>TClinGen:CA1654742
NM_001330078.2(NRXN1):c.2698A>C (p.Arg900=)9378NRXN1Uncertain significancers574531814RCV000267729; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025072465250724652TG2:g.50724652T>GClinGen:CA1654745
NM_001330078.2(NRXN1):c.2658C>T (p.Gly886=)9378NRXN1Uncertain significancers752920557RCV000792259; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025072469250724692GA2:g.50724692G>A-
NM_001330078.2(NRXN1):c.2654A>G (p.Asn885Ser)9378NRXN1Uncertain significance-1RCV001060870; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025072469650724696TC2:g.50724696T>C-
NM_001330078.2(NRXN1):c.2623A>G (p.Asn875Asp)9378NRXN1Uncertain significance-1RCV001222195; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025072472750724727TC2:g.50724727T>C-
NM_001330078.2(NRXN1):c.2605C>A (p.Leu869Met)9378NRXN1Conflicting interpretations of pathogenicityrs201818223RCV000188281|RCV000515261|RCV000719870|RCV000723597|RCV001085353; NMedGen:CN169374|MONDO:MONDO:0013696,MedGen:C3808494,OMIM:614332; MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150|MedGen:C2711754|MedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025072474550724745GT2:g.50724745G>TClinGen:CA221529CN169374 not specified;
NM_001330078.2(NRXN1):c.2604C>T (p.His868=)9378NRXN1Likely benignrs367854771RCV000972581; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025072474650724746GA2:g.50724746G>A-
NM_001330078.2(NRXN1):c.2597T>C (p.Ile866Thr)9378NRXN1Uncertain significancers796052779RCV000188280|RCV000538380; NMedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025072475350724753AG2:g.50724753A>GClinGen:CA316147CN169374 not specified;
NM_001330078.2(NRXN1):c.2582T>C (p.Val861Ala)9378NRXN1Uncertain significance-1RCV001050479; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025072476850724768AG2:g.50724768A>G-
NM_001330078.2(NRXN1):c.2564G>A (p.Arg855Gln)9378NRXN1Uncertain significancers796052776RCV000519744; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025072478650724786CT2:g.50724786C>TClinGen:CA316141C3280479 614325 Pitt-Hopkins-like syndrome 2;
NM_001330078.2(NRXN1):c.2536A>G (p.Asn846Asp)9378NRXN1Uncertain significance-1RCV001068206; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025072481450724814TC2:g.50724814T>C-
NM_001330078.2(NRXN1):c.2534A>G (p.His845Arg)9378NRXN1Uncertain significance-1RCV001040837; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025072481650724816TC2:g.50724816T>C-
NM_001330078.2(NRXN1):c.2533C>T (p.His845Tyr)9378NRXN1Conflicting interpretations of pathogenicityrs199784139RCV000188275|RCV000465496|RCV000513409|RCV000716693|RCV000764442; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150|MedGen:CN517202|MedGen:C2711754|MONDO:MONDO:0013696,MedGen:C3808494,OMIM:614332; MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025072481750724817GA2:g.50724817G>AClinGen:CA316137CN517202 not provided;
NM_001330078.2(NRXN1):c.2526G>A (p.Leu842=)9378NRXN1Likely benignrs868353645RCV000525947; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025072482450724824CT2:g.50724824C>TClinGen:CA47361139
NM_001330078.2(NRXN1):c.2518A>T (p.Thr840Ser)9378NRXN1Uncertain significancers1573258498RCV000793232; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025072483250724832TA2:g.50724832T>A-
NM_001330078.2(NRXN1):c.2507C>T (p.Ala836Val)9378NRXN1Conflicting interpretations of pathogenicityrs199557987RCV000174865|RCV000868228; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025072484350724843GA2:g.50724843G>AClinGen:CA302762CN169374 not specified;
NM_001330078.2(NRXN1):c.2497+9C>G9378NRXN1Conflicting interpretations of pathogenicityrs1243683821RCV000841656|RCV001209722; NMedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025073362450733624GC2:g.50733624G>C-
NM_001330078.2(NRXN1):c.2497+5A>G9378NRXN1Uncertain significancers1573307996RCV000817022; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025073362850733628TC2:g.50733628T>C-
NM_001330078.2(NRXN1):c.2497+3A>G9378NRXN1Uncertain significancers202074070RCV000188272|RCV000725752|RCV000802683; NMedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025073363050733630TC2:g.50733630T>CClinGen:CA316134
NM_001330078.2(NRXN1):c.2492T>C (p.Met831Thr)9378NRXN1Uncertain significancers1573308071RCV000792998; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025073363850733638AG2:g.50733638A>G-
NM_001330078.2(NRXN1):c.2491A>G (p.Met831Val)9378NRXN1Uncertain significancers200018177RCV000649734; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025073363950733639TC2:g.50733639T>CClinGen:CA1654806C3280479 614325 Pitt-Hopkins-like syndrome 2;
NM_001330078.2(NRXN1):c.2488G>C (p.Ala830Pro)9378NRXN1Uncertain significancers759806453RCV000554189; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025073364250733642CG2:g.50733642C>GClinGen:CA346777846C3280479 614325 Pitt-Hopkins-like syndrome 2;
NM_001330078.2(NRXN1):c.2488G>T (p.Ala830Ser)9378NRXN1Uncertain significancers759806453RCV000818775; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025073364250733642CA2:g.50733642C>A-
NM_001330078.2(NRXN1):c.2483A>C (p.Gln828Pro)9378NRXN1Uncertain significancers1060503177RCV000459931; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025073364750733647TG2:g.50733647T>GClinGen:CA16610972
NM_001330078.2(NRXN1):c.2476G>A (p.Asp826Asn)9378NRXN1Uncertain significancers3185852RCV000541720; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025073365450733654CT2:g.50733654C>TClinGen:CA47370185C3280479 614325 Pitt-Hopkins-like syndrome 2;
NM_001330078.2(NRXN1):c.2459G>A (p.Ser820Asn)9378NRXN1Conflicting interpretations of pathogenicityrs80293130RCV000188271|RCV000515422|RCV000706193|RCV000720544|RCV000728599; NMedGen:CN169374|MONDO:MONDO:0013696,MedGen:C3808494,OMIM:614332; MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150|MedGen:C2711754|MedGen:CN51720225073367150733671CT2:g.50733671C>TClinGen:CA316132CN169374 not specified;
NM_001330078.2(NRXN1):c.2458A>C (p.Ser820Arg)9378NRXN1Uncertain significance-1RCV001034839; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025073367250733672TG2:g.50733672T>G-
NM_001330078.2(NRXN1):c.2450G>A (p.Arg817His)9378NRXN1Uncertain significance-1RCV001065254; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025073368050733680CT2:g.50733680C>T-
NM_001330078.2(NRXN1):c.2446C>A (p.Arg816=)9378NRXN1Likely benignrs200325059RCV000649748; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025073368450733684GT2:g.50733684G>TClinGen:CA47370261C3280479 614325 Pitt-Hopkins-like syndrome 2;
NM_001330078.2(NRXN1):c.2446C>T (p.Arg816Trp)9378NRXN1Uncertain significance-1RCV001241089; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025073368450733684GA2:g.50733684G>A-
NM_001330078.2(NRXN1):c.2437C>T (p.Arg813Cys)9378NRXN1Uncertain significancers201150987RCV000649731; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025073369350733693GA2:g.50733693G>AClinGen:CA1654821C3280479 614325 Pitt-Hopkins-like syndrome 2;
NM_001330078.2(NRXN1):c.2421C>T (p.Asn807=)9378NRXN1Benign/Likely benignrs115211871RCV000079516|RCV000230396|RCV000715066; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150|MedGen:C271175425073370950733709GA2:g.50733709G>AClinGen:CA147118CN169374 not specified;
NM_001330078.2(NRXN1):c.2410C>A (p.Leu804Ile)9378NRXN1Uncertain significancers763449110RCV000799211; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025073372050733720GT2:g.50733720G>T-
NM_001330078.2(NRXN1):c.2405A>G (p.Tyr802Cys)9378NRXN1Uncertain significance-1RCV001220310; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025073372550733725TC2:g.50733725T>C-
NM_001330078.2(NRXN1):c.2385C>G (p.Pro795=)9378NRXN1Benign/Likely benignrs147984237RCV000173027|RCV000467657|RCV000715090; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150|MedGen:C271175425073374550733745GC2:g.50733745G>CClinGen:CA302672CN169374 not specified;
NC_000002.12:g.(?_50528605)_(50623635_?)del9378NRXN1Uncertain significance-1RCV000649765; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025075574350850773nana-
NC_000002.12:g.(?_50528605)_(50553045_?)del9378NRXN1Pathogenic-1RCV000708443; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025075574350780183nana-C3280479 614325 Pitt-Hopkins-like syndrome 2;
NM_001330078.2(NRXN1):c.2368A>C (p.Asn790His)9378NRXN1Uncertain significance-1RCV001209575; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025075576950755769TG2:g.50755769T>G-
NM_001330078.2(NRXN1):c.2346A>C (p.Leu782=)9378NRXN1Uncertain significancers764741914RCV000702904; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025075836650758366TG2:g.50758366T>G-C3280479 614325 Pitt-Hopkins-like syndrome 2;
NM_001330078.2(NRXN1):c.2336C>T (p.Thr779Met)9378NRXN1Uncertain significance-1RCV001043099; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025075837650758376GA2:g.50758376G>A-
NM_001330078.2(NRXN1):c.2323C>T (p.Arg775Cys)9378NRXN1Uncertain significancers201387857RCV000687698; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025075838950758389GA2:g.50758389G>A-C3280479 614325 Pitt-Hopkins-like syndrome 2;
NM_001330078.2(NRXN1):c.2268G>A (p.Met756Ile)9378NRXN1Uncertain significancers201741425RCV000804733; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025075844450758444CT2:g.50758444C>T-
NM_001330078.2(NRXN1):c.2261T>C (p.Ile754Thr)9378NRXN1Uncertain significancers1060503178RCV000469254; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025075845150758451AG2:g.50758451A>GClinGen:CA16610997
NM_001330078.2(NRXN1):c.2257G>A (p.Gly753Ser)9378NRXN1Uncertain significance-1RCV001052114; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025075845550758455CT2:g.50758455C>T-
NM_001330078.2(NRXN1):c.2253A>G (p.Ala751=)9378NRXN1Uncertain significancers199648817RCV000809004; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025075845950758459TC2:g.50758459T>C-
NM_001330078.2(NRXN1):c.2251G>A (p.Ala751Thr)9378NRXN1Uncertain significance-1RCV001202659; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025075846150758461CT2:g.50758461C>T-
NM_001330078.2(NRXN1):c.2244C>G (p.Ser748=)9378NRXN1Likely benignrs761608592RCV000429364|RCV000870642; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025075846850758468GC2:g.50758468G>CClinGen:CA1654885CN169374 not specified;
NM_001330078.2(NRXN1):c.2190G>T (p.Gln730His)9378NRXN1Uncertain significancers199978276RCV000188261|RCV000719892|RCV000764443|RCV000810957; NMedGen:CN169374|MedGen:C2711754|MONDO:MONDO:0013696,MedGen:C3808494,OMIM:614332; MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025075852250758522CA2:g.50758522C>AClinGen:CA316113
NM_001330078.2(NRXN1):c.2179A>G (p.Met727Val)9378NRXN1Uncertain significance-1RCV001038845; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025075853350758533TC2:g.50758533T>C-
NM_001330078.2(NRXN1):c.2171G>C (p.Ser724Thr)9378NRXN1Uncertain significancers1558890325RCV000707531; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025075854150758541CG2:g.50758541C>G-
NC_000002.12:g.(?_50538233)_(50553045_?)del9378NRXN1Pathogenic-1RCV000813348; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025076537150780183nana-
NC_000002.12:g.(?_50538233)_(50538656_?)del9378NRXN1Uncertain significance-1RCV001031131; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025076537150765794nana-1-
NM_001330078.2(NRXN1):c.2138A>G (p.Glu713Gly)9378NRXN1Uncertain significance-1RCV001245806; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025076539650765396TC2:g.50765396T>C-
NM_001330078.2(NRXN1):c.2132C>T (p.Ser711Phe)9378NRXN1Uncertain significancers1558901426RCV000696445; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025076540250765402GA2:g.50765402G>A-
NM_001330078.2(NRXN1):c.2132C>G (p.Ser711Cys)9378NRXN1Uncertain significance-1RCV001246509; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025076540250765402GC2:g.50765402G>C-
NM_001330078.2(NRXN1):c.2122C>A (p.Leu708Ile)9378NRXN1Conflicting interpretations of pathogenicityrs56086732RCV000079514|RCV000443049|RCV000715105|RCV001083273; NMedGen:CN169374|MedGen:CN517202|MedGen:C2711754|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025076541250765412GT2:g.50765412G>TClinGen:CA285441CN517202 not provided;
NM_001330078.2(NRXN1):c.2120A>C (p.Tyr707Ser)9378NRXN1Uncertain significancers752073539RCV000489835|RCV001141663; NMedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025076541450765414TG2:g.50765414T>GClinGen:CA1654927CN169374 not specified;
NM_001330078.2(NRXN1):c.2110G>A (p.Gly704Arg)9378NRXN1Uncertain significancers757547387RCV000188258|RCV000819138; NMedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025076542450765424CT2:g.50765424C>TClinGen:CA316107
NM_001330078.2(NRXN1):c.2109C>T (p.Ser703=)9378NRXN1Benign/Likely benignrs200456688RCV000426996|RCV000933306; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025076542550765425GA2:g.50765425G>AClinGen:CA1654928CN169374 not specified;
NM_001330078.2(NRXN1):c.2092T>C (p.Tyr698His)9378NRXN1Uncertain significance-1RCV001141664; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025076544250765442AG2:g.50765442A>G-
NM_001330078.2(NRXN1):c.2045G>C (p.Ser682Thr)9378NRXN1Uncertain significance-1RCV001061405; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025076548950765489CG2:g.50765489C>G-
NM_001330078.2(NRXN1):c.2037G>A (p.Pro679=)9378NRXN1Conflicting interpretations of pathogenicityrs199714221RCV000188231|RCV000726803|RCV001078519; NMedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025076549750765497CT2:g.50765497C>TClinGen:CA316056CN169374 not specified;
NM_001330078.2(NRXN1):c.2036C>T (p.Pro679Leu)9378NRXN1Uncertain significancers201735573RCV000188257|RCV000719891|RCV000799433; NMedGen:CN169374|MedGen:C2711754|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025076549850765498GA2:g.50765498G>AClinGen:CA316105
NM_001330078.2(NRXN1):c.2013C>T (p.Ser671=)9378NRXN1Uncertain significance-1RCV001143481; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025076552150765521GA2:g.50765521G>A-
NM_001330078.2(NRXN1):c.2008C>G (p.Pro670Ala)9378NRXN1Uncertain significancers762326241RCV000174043|RCV000649742; NMedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025076552650765526GC2:g.50765526G>CClinGen:CA239504CN169374 not specified;
NM_001330078.2(NRXN1):c.1996G>A (p.Ala666Thr)9378NRXN1Uncertain significancers201731350RCV000550700; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025076553850765538CT2:g.50765538C>TClinGen:CA1654944C3280479 614325 Pitt-Hopkins-like syndrome 2;
NM_001330078.2(NRXN1):c.1978G>A (p.Ala660Thr)9378NRXN1Uncertain significancers199939303RCV000188309|RCV000689938|RCV000718196|RCV000764444; NMedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150|MedGen:C2711754|MONDO:MONDO:0013696,MedGen:C3808494,OMIM:614332; MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025076555650765556CT2:g.50765556C>TClinGen:CA316198CN169374 not specified;
NM_001330078.2(NRXN1):c.1969C>T (p.Arg657Trp)9378NRXN1Uncertain significancers200844126RCV000079513|RCV000824551; NMedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025076556550765565GA2:g.50765565G>AClinGen:CA221527
NM_001330078.2(NRXN1):c.1955A>G (p.Gln652Arg)9378NRXN1Uncertain significance-1RCV001215687; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025076557950765579TC2:g.50765579T>C-
NM_001330078.2(NRXN1):c.1948G>A (p.Asp650Asn)9378NRXN1Uncertain significance-1RCV001214546; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025076558650765586CT2:g.50765586C>T-
NM_001330078.2(NRXN1):c.1945A>G (p.Ile649Val)9378NRXN1Conflicting interpretations of pathogenicityrs200074974RCV000188230|RCV000649744|RCV000720360|RCV000723794; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150|MedGen:C2711754|MedGen:CN51720225076558950765589TC2:g.50765589T>CClinGen:CA234422CN169374 not specified;
NM_001330078.2(NRXN1):c.1913A>G (p.Tyr638Cys)9378NRXN1Uncertain significancers727504051RCV000153602|RCV000807785; NMedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025076562150765621TC2:g.50765621T>CClinGen:CA234424
NM_001330078.2(NRXN1):c.1911C>T (p.Asn637=)9378NRXN1Likely benignrs201960393RCV000893102; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025076562350765623GA2:g.50765623G>A-
NM_001330078.2(NRXN1):c.1861A>G (p.Asn621Asp)9378NRXN1Uncertain significance-1RCV001060869; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025076567350765673TC2:g.50765673T>C-
NM_001330078.2(NRXN1):c.1857A>G (p.Pro619=)9378NRXN1Uncertain significance-1RCV001143482; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025076567750765677TC2:g.50765677T>C-
NM_001330078.2(NRXN1):c.1850G>A (p.Gly617Glu)9378NRXN1Uncertain significance-1RCV001072082; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025076568450765684CT2:g.50765684C>T-
NM_001330078.2(NRXN1):c.1843C>T (p.Leu615=)9378NRXN1Conflicting interpretations of pathogenicityrs201029409RCV000174044|RCV000724259|RCV001086764; NMedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025076569150765691GA2:g.50765691G>AClinGen:CA239506CN169374 not specified;
NM_001330078.2(NRXN1):c.1833T>C (p.Asp611=)9378NRXN1Benignrs190377845RCV000188229|RCV000864874; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025076570150765701AG2:g.50765701A>GClinGen:CA316054CN169374 not specified;
NM_001330078.2(NRXN1):c.1811G>A (p.Ser604Asn)9378NRXN1Uncertain significance-1RCV001040959; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025076572350765723CT2:g.50765723C>T-
NM_001330078.2(NRXN1):c.1800T>C (p.Ala600=)9378NRXN1Likely benignrs1553760251RCV000649753; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025076573450765734AG2:g.50765734A>GClinGen:CA426126123C3280479 614325 Pitt-Hopkins-like syndrome 2;
NM_001330078.2(NRXN1):c.1796C>G (p.Thr599Ser)9378NRXN1Uncertain significancers1558902953RCV000696444; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025076573850765738GC2:g.50765738G>C-
NM_001330078.2(NRXN1):c.1786A>T (p.Thr596Ser)9378NRXN1Uncertain significancers1060503176RCV000466435; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025076574850765748TA2:g.50765748T>AClinGen:CA16611193
NM_001330078.2(NRXN1):c.1784G>A (p.Arg595His)9378NRXN1Uncertain significancers761279630RCV000479818|RCV000764445; NMedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150; MONDO:MONDO:0013696,MedGen:C3808494,OMIM:61433225076575050765750CT2:g.50765750C>TClinGen:CA1654974CN169374 not specified;
NM_001330078.2(NRXN1):c.1783C>T (p.Arg595Cys)9378NRXN1Uncertain significance-1RCV001049963; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025076575150765751GA2:g.50765751G>A-
NM_001330078.2(NRXN1):c.1778C>T (p.Thr593Met)9378NRXN1Uncertain significancers201530175RCV000188252|RCV000797439; NMedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025076575650765756GA2:g.50765756G>AClinGen:CA316095
NM_001330078.2(NRXN1):c.1769C>G (p.Ser590Cys)9378NRXN1Uncertain significance-1RCV001216579; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025076576550765765GC2:g.50765765G>C-
NM_001330078.2(NRXN1):c.1760-13C>G9378NRXN1Uncertain significancers886056171RCV000337793; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025076578750765787GC2:g.50765787G>CClinGen:CA10613658
NM_001330078.2(NRXN1):c.1758A>G (p.Ser586=)9378NRXN1Uncertain significance-1RCV001034864; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025077972650779726TC2:g.50779726T>C-
NM_001330078.2(NRXN1):c.1749C>T (p.Asp583=)9378NRXN1Conflicting interpretations of pathogenicityrs199934259RCV000193373|RCV000232596; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025077973550779735GA2:g.50779735G>AClinGen:CA206821
NM_001330078.2(NRXN1):c.1715A>G (p.Asp572Gly)9378NRXN1Uncertain significancers1558925182RCV000680051; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025077976950779769TC2:g.50779769T>C-C3280479 614325 Pitt-Hopkins-like syndrome 2;
NM_001330078.2(NRXN1):c.1700T>G (p.Leu567Trp)9378NRXN1Uncertain significancers372311299RCV000079512|RCV000718850|RCV000764446|RCV001215824; NMedGen:CN517202|MedGen:C2711754|MONDO:MONDO:0013696,MedGen:C3808494,OMIM:614332; MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025077978450779784AC2:g.50779784A>CClinGen:CA221525CN169374 not specified;
NM_001330078.2(NRXN1):c.1696C>A (p.Leu566Met)9378NRXN1Uncertain significance-1RCV001064763; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025077978850779788GT2:g.50779788G>T-
NM_001330078.2(NRXN1):c.1693G>A (p.Ala565Thr)9378NRXN1Uncertain significance-1RCV001235535; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025077979150779791CT2:g.50779791C>T-
NM_001330078.2(NRXN1):c.1688T>C (p.Ile563Thr)9378NRXN1Conflicting interpretations of pathogenicityrs201837579RCV000712450|RCV000719093|RCV001081850; NMedGen:CN517202|MedGen:C2711754|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025077979650779796AG2:g.50779796A>GClinGen:CA239187CN169374 not specified;
NM_001330078.2(NRXN1):c.1679C>A (p.Thr560Asn)9378NRXN1Uncertain significancers200332295RCV000537930; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025077980550779805GT2:g.50779805G>TClinGen:CA1655005C3280479 614325 Pitt-Hopkins-like syndrome 2;
NM_001330078.2(NRXN1):c.1647C>A (p.His549Gln)9378NRXN1Uncertain significancers201152575RCV000649741; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025077983750779837GT2:g.50779837G>TClinGen:CA1655008C3280479 614325 Pitt-Hopkins-like syndrome 2;
NM_001330078.2(NRXN1):c.1598C>T (p.Pro533Leu)9378NRXN1Uncertain significance-1RCV001051522; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025077988650779886GA2:g.50779886G>A-
NM_001330078.2(NRXN1):c.1593G>C (p.Lys531Asn)9378NRXN1Uncertain significancers1573517782RCV000813730; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025077989150779891CG2:g.50779891C>G-
NM_001330078.2(NRXN1):c.1575A>G (p.Arg525=)9378NRXN1Conflicting interpretations of pathogenicityrs201941844RCV000127241|RCV000712449|RCV000717983|RCV001082810; NMedGen:CN169374|MedGen:CN517202|MedGen:C2711754|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025077990950779909TC2:g.50779909T>CClinGen:CA292596CN169374 not specified;
NM_001330078.2(NRXN1):c.1566C>T (p.Gly522=)9378NRXN1Uncertain significancers199701804RCV000188249|RCV000695977; NMedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025077991850779918GA2:g.50779918G>AClinGen:CA316089CN169374 not specified;
NM_001330078.2(NRXN1):c.1551C>G (p.Ile517Met)9378NRXN1Uncertain significancers1553778339RCV000649743; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025077993350779933GC2:g.50779933G>CClinGen:CA346773515C3280479 614325 Pitt-Hopkins-like syndrome 2;
NM_001330078.2(NRXN1):c.1546C>A (p.Leu516Ile)9378NRXN1Uncertain significancers781442387RCV000373872; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025077993850779938GT2:g.50779938G>TClinGen:CA1655022CN239445 Pitt-Hopkins-like syndrome;
NM_001330078.2(NRXN1):c.1532C>T (p.Thr511Ile)9378NRXN1Uncertain significance-1RCV001206035; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025077995250779952GA2:g.50779952G>A-
NM_001330078.2(NRXN1):c.1424A>C (p.Asn475Thr)9378NRXN1Uncertain significancers751754721RCV000193954|RCV001206083; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025078006050780060TG2:g.50780060T>GClinGen:CA207785
NM_001330078.2(NRXN1):c.1424A>G (p.Asn475Ser)9378NRXN1Uncertain significancers751754721RCV000805850; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025078006050780060TC2:g.50780060T>C-
NM_001330078.2(NRXN1):c.1418G>A (p.Cys473Tyr)9378NRXN1Uncertain significance-1RCV001143483; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025078006650780066CT2:g.50780066C>T-
NM_001330078.2(NRXN1):c.1382C>T (p.Pro461Leu)9378NRXN1Uncertain significancers530674644RCV000549238|RCV000724087; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150|MedGen:CN51720225078010250780102GA2:g.50780102G>AClinGen:CA239185CN169374 not specified;
NM_001330078.2(NRXN1):c.1381C>G (p.Pro461Ala)9378NRXN1Uncertain significance-1RCV001220920; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025078010350780103GC2:g.50780103G>C-
NM_001330078.2(NRXN1):c.1365T>C (p.Leu455=)9378NRXN1Conflicting interpretations of pathogenicityrs201727684RCV000186641|RCV000716763|RCV000723784|RCV001084654; NMedGen:CN169374|MedGen:C2711754|MedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025078011950780119AG2:g.50780119A>GClinGen:CA232551CN169374 not specified;
NM_001330078.2(NRXN1):c.1351G>C (p.Glu451Gln)9378NRXN1Uncertain significance-1RCV001238254; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025078013350780133CG2:g.50780133C>G-
NM_001330078.2(NRXN1):c.1326A>C (p.Val442=)9378NRXN1Conflicting interpretations of pathogenicityrs201485014RCV000173732|RCV000724283|RCV001080670; NMedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025078015850780158TG2:g.50780158T>GClinGen:CA239191CN169374 not specified;
NM_001330078.2(NRXN1):c.1326A>G (p.Val442=)9378NRXN1Likely benignrs201485014RCV000982744; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025078015850780158TC2:g.50780158T>C-
NC_000002.12:g.(?_50620002)_(50623635_?)del9378NRXN1Pathogenic-1RCV001031610; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025084714050850773nana-1-
NC_000002.12:g.(?_50620002)_(51032054_?)del9378NRXN1Pathogenic-1RCV001033397; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025084714051259192nana-1-
NM_001330078.2(NRXN1):c.1292G>A (p.Ser431Asn)9378NRXN1Uncertain significancers796052788RCV000188307|RCV000626016; NMedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025084718850847188CT2:g.50847188C>TClinGen:CA316194
NM_001330078.2(NRXN1):c.1285C>T (p.Pro429Ser)9378NRXN1Benign/Likely benignrs78540316RCV000079510|RCV000209954|RCV000716228|RCV000857869; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150|MedGen:C2711754|MedGen:CN51720225084719550847195GA2:g.50847195G>AClinGen:CA285439CN169374 not specified;
NM_001330078.2(NRXN1):c.1270G>A (p.Asp424Asn)9378NRXN1Uncertain significance-1RCV001136904; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025084721050847210CT2:g.50847210C>T-
NM_001330078.2(NRXN1):c.1269C>T (p.Ala423=)9378NRXN1Likely benignrs753264637RCV000536718; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025084721150847211GA2:g.50847211G>AClinGen:CA1655075
NM_001330078.2(NRXN1):c.1221G>A (p.Met407Ile)9378NRXN1Uncertain significancers373954439RCV000796976; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025084725950847259CT2:g.50847259C>T-
NM_001330078.2(NRXN1):c.1202C>T (p.Thr401Met)9378NRXN1Uncertain significancers796052764RCV000188244|RCV001055962; NMedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025084727850847278GA2:g.50847278G>AClinGen:CA316079CN169374 not specified;
NM_001330078.2(NRXN1):c.1179G>C (p.Gly393=)9378NRXN1Uncertain significance-1RCV001136905; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025084730150847301CG2:g.50847301C>G-
NM_001330078.2(NRXN1):c.1163C>T (p.Thr388Ile)9378NRXN1Uncertain significancers886056172RCV000348696; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025084731750847317GA2:g.50847317G>AClinGen:CA10615553CN239445 Pitt-Hopkins-like syndrome;
NM_001330078.2(NRXN1):c.1162A>T (p.Thr388Ser)9378NRXN1Uncertain significance-1RCV001219583; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025084731850847318TA2:g.50847318T>A-
NM_001330078.2(NRXN1):c.1159-8T>G9378NRXN1Uncertain significance-1RCV001066729; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025084732950847329AC2:g.50847329A>C-
NM_001330078.2(NRXN1):c.1158+26A>T9378NRXN1Conflicting interpretations of pathogenicityrs201802152RCV000117834|RCV000188225|RCV000719842|RCV001083943|RCV001251856; NMedGen:CN517202|MedGen:CN169374|MedGen:C2711754|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150|Human Phenotype Ontology:HP:0000730,Human Phenotype Ontology:HP:0001249,Human Phenotype Ontology:HP:0001267,Human Phenotype Ontology:HP:0001225084833850848338TA2:g.50848338T>AClinGen:CA231339CN517202 not provided;
NM_001330078.2(NRXN1):c.1158+21G>A9378NRXN1Uncertain significance-1RCV001236846; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025084834350848343CT2:g.50848343C>T-
NM_001330078.2(NRXN1):c.1135-2A>G9378NRXN1Likely pathogenic-1RCV001069413; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025084838950848389TC2:g.50848389T>C-
NM_001330078.2(NRXN1):c.1135-8C>T9378NRXN1Likely benignrs1430859209RCV000543447; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025084839550848395GA2:g.50848395G>AClinGen:CA532636391
NM_001330078.2(NRXN1):c.1134+8C>T9378NRXN1Benign/Likely benignrs200448187RCV000426249|RCV000535239; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025085044450850444GA2:g.50850444G>AClinGen:CA1655124CN169374 not specified;
NM_001330078.2(NRXN1):c.1113A>G (p.Lys371=)9378NRXN1Uncertain significance-1RCV001220360; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025085047350850473TC2:g.50850473T>C-
NM_001330078.2(NRXN1):c.1097C>T (p.Ala366Val)9378NRXN1Uncertain significance-1RCV001037440; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025085048950850489GA2:g.50850489G>A-
NM_001330078.2(NRXN1):c.1059A>C (p.Ala353=)9378NRXN1Likely benignrs200259338RCV000558951; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025085052750850527TG2:g.50850527T>GClinGen:CA1655131C3280479 614325 Pitt-Hopkins-like syndrome 2;
NM_001330078.2(NRXN1):c.1050C>G (p.Ala350=)9378NRXN1Likely benignrs201397488RCV000426869|RCV000720886|RCV000863085; NMedGen:CN169374|MedGen:C2711754|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025085053650850536GC2:g.50850536G>CClinGen:CA1655132CN169374 not specified;
NM_001330078.2(NRXN1):c.1048G>C (p.Ala350Pro)9378NRXN1Uncertain significance-1RCV001039234; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025085053850850538CG2:g.50850538C>G-
NM_001330078.2(NRXN1):c.900C>T (p.Pro300=)9378NRXN1Benignrs2303298RCV000117844|RCV000459957|RCV000715089|RCV000992454; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150|MedGen:C2711754|MedGen:CN51720225085068650850686GA2:g.50850686G>AClinGen:CA154148CN169374 not specified;
NM_001330078.2(NRXN1):c.882C>T (p.Tyr294=)9378NRXN1Conflicting interpretations of pathogenicityrs200464704RCV000188224|RCV000724611|RCV001080290; NMedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025085070450850704GA2:g.50850704G>AClinGen:CA247123CN169374 not specified;
NM_001330078.2(NRXN1):c.881A>G (p.Tyr294Cys)9378NRXN1Uncertain significancers781054571RCV000531020; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025085070550850705TC2:g.50850705T>CClinGen:CA346822626C3280479 614325 Pitt-Hopkins-like syndrome 2;
NM_001330078.2(NRXN1):c.864A>G (p.Gly288=)9378NRXN1Likely benignrs373654735RCV000419068|RCV000649749; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025085072250850722TC2:g.50850722T>CClinGen:CA1655147CN169374 not specified;
NM_001330078.2(NRXN1):c.861A>G (p.Lys287=)9378NRXN1Uncertain significance-1RCV001062066; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025085072550850725TC2:g.50850725T>C-
NM_001330078.2(NRXN1):c.855G>A (p.Thr285=)9378NRXN1Likely benignrs201753471RCV000873912; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025085073150850731CT2:g.50850731C>T-
NM_001330078.2(NRXN1):c.833-5T>G9378NRXN1Conflicting interpretations of pathogenicityrs199712573RCV000444152|RCV000649754|RCV000717775; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150|MedGen:C271175425085075850850758AC2:g.50850758A>CClinGen:CA1655154CN169374 not specified;
NC_000002.12:g.(?_50921849)_(50925975_?)del9378NRXN1Uncertain significance-1RCV000649764; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025114898751153113nana-C3280479 614325 Pitt-Hopkins-like syndrome 2;
NC_000002.12:g.(?_50921849)_(51032054_?)del9378NRXN1Pathogenic-1RCV000810681; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025114898751259192nana-
NC_000002.12:g.(?_50921849)_(51032054_?)dup9378NRXN1Uncertain significance-1RCV001033591; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025114898751259192nana-1-
NM_001330078.2(NRXN1):c.832+6A>G9378NRXN1Uncertain significancers200841589RCV000554716; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025114900151149001TC2:g.51149001T>CClinGen:CA48023280
NM_001330078.2(NRXN1):c.832+2dup9378NRXN1Uncertain significancers1344399066RCV000698740; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025114900451149005TTA2:g.51149004_51149005insA-
NM_001330078.2(NRXN1):c.832+1G>A9378NRXN1Likely pathogenic-1RCV001066155; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025114900651149006CT2:g.51149006C>T-
NM_001330078.2(NRXN1):c.814G>A (p.Asp272Asn)9378NRXN1Uncertain significance-1RCV001210173; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025114980251149802CT2:g.51149802C>T-
NM_001330078.2(NRXN1):c.811G>A (p.Gly271Ser)9378NRXN1Uncertain significancers368240967RCV000707331; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025114980551149805CT2:g.51149805C>T-
NM_001330078.2(NRXN1):c.805A>T (p.Met269Leu)9378NRXN1Uncertain significancers776779952RCV000414234|RCV001203909; NMedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025114981151149811TA2:g.51149811T>AClinGen:CA1655300CN169374 not specified;
NM_001330078.2(NRXN1):c.805A>G (p.Met269Val)9378NRXN1Uncertain significance-1RCV001224643; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025114981151149811TC2:g.51149811T>C-
NM_001330078.2(NRXN1):c.804G>C (p.Leu268=)9378NRXN1Likely benignrs1553364040RCV000828263|RCV001087129; NMedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025114981251149812CG2:g.51149812C>GClinGen:CA426106032
NM_001330078.2(NRXN1):c.798G>A (p.Ala266=)9378NRXN1Benign/Likely benignrs201027928RCV000127233|RCV000542258; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025114981851149818CT2:g.51149818C>TClinGen:CA292586CN169374 not specified;
NM_001330078.2(NRXN1):c.781A>G (p.Asn261Asp)9378NRXN1Uncertain significancers781179797RCV000457101|RCV000725747; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150|MedGen:CN51720225115308551153085TC2:g.51153085T>CClinGen:CA316071
NM_001330078.2(NRXN1):c.779A>G (p.Asn260Ser)9378NRXN1Uncertain significancers779434583RCV000731065|RCV001246634; NMedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025115308751153087TC2:g.51153087T>C-
NM_001330078.2(NRXN1):c.-59_772+1193del9378NRXN1Pathogenic-1RCV001253604; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125344751255470TACTTTAAATCCTGACATCTCCTACTTAGCCACTGATTCGTCTTTTTCACACCACTCACTCACTTTCTGTTAGAGGCTTTGCTGTATTTATACAACAGTATTTTCCTTGGT2:g.51253447_51253545del-
NC_000002.12:g.(?_51026351)_(51032054_?)del9378NRXN1Pathogenic-1RCV000708307; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125348951259192nana-
NM_001330078.2(NRXN1):c.772+1140G>A9378NRXN1Benign/Likely benignrs61658382RCV000117842|RCV000513746|RCV001079862; NMedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125350051253500CT2:g.51253500C>TClinGen:CA288976CN517202 not provided;
NM_001330078.2(NRXN1):c.772+1133T>C9378NRXN1Likely pathogenicrs1476850082RCV000689979; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125350751253507AG2:g.51253507A>G-
NM_001330078.2(NRXN1):c.772+1118G>A9378NRXN1Likely benignrs201194822RCV000616998|RCV000867276; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125352251253522CT2:g.51253522C>TClinGen:CA1655382CN169374 not specified;
NM_001330078.2(NRXN1):c.772+1116A>G9378NRXN1Uncertain significance-1RCV001196942; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125352451253524TC2:g.51253524T>C-
NM_001330078.2(NRXN1):c.772+1094A>C9378NRXN1Uncertain significancers200332062RCV000798588; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125354651253546TG2:g.51253546T>G-
NM_001330078.2(NRXN1):c.772+1081A>G9378NRXN1Uncertain significancers759434607RCV000522827|RCV000700475; NMedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125355951253559TC2:g.51253559T>CClinGen:CA1655388CN169374 not specified;
NM_001330078.2(NRXN1):c.772+1078A>G9378NRXN1Conflicting interpretations of pathogenicityrs144049982RCV000153604|RCV000467253|RCV000719324; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150|MedGen:C271175425125356251253562TC2:g.51253562T>CClinGen:CA295629CN169374 not specified;
NM_001330078.2(NRXN1):c.772+1070G>A9378NRXN1Uncertain significance-1RCV001139142; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125357051253570CT2:g.51253570C>T-
NM_001330078.2(NRXN1):c.772+1066T>C9378NRXN1Uncertain significance-1RCV001039848; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125357451253574AG2:g.51253574A>G-
NM_001330078.2(NRXN1):c.772+1063C>T9378NRXN1Uncertain significancers184695687RCV000704916; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125357751253577GA2:g.51253577G>A-
NM_001330078.2(NRXN1):c.772+1050C>A9378NRXN1Uncertain significancers367919055RCV000117833|RCV000460863|RCV000720275; NMedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150|MedGen:C271175425125359051253590GT2:g.51253590G>TClinGen:CA231337CN517202 not provided;
NM_001330078.2(NRXN1):c.772+1045G>A9378NRXN1Uncertain significancers372181288RCV000525075; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125359551253595CT2:g.51253595C>TClinGen:CA48054736
NM_001330078.2(NRXN1):c.772+1040A>T9378NRXN1Conflicting interpretations of pathogenicityrs201741449RCV000188293|RCV000691824|RCV000718550; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150|MedGen:C271175425125360051253600TA2:g.51253600T>AClinGen:CA316169
NM_001330078.2(NRXN1):c.772+1032G>A9378NRXN1Conflicting interpretations of pathogenicityrs771759988RCV000310309; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125360851253608CT2:g.51253608C>TClinGen:CA1655397CN239445 Pitt-Hopkins-like syndrome;
NM_001330078.2(NRXN1):c.772+1024C>G9378NRXN1Conflicting interpretations of pathogenicityrs199645252RCV000192851|RCV000792511; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125361651253616GC2:g.51253616G>CClinGen:CA205964
NM_001330078.2(NRXN1):c.772G>A (p.Glu258Lys)9378NRXN1Uncertain significancers746465882RCV000498652|RCV001220515; NMedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125464051254640CT2:g.51254640C>TClinGen:CA1655416CN169374 not specified;
NM_001330078.2(NRXN1):c.753C>A (p.Arg251=)9378NRXN1Likely benignrs770481343RCV000548792; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125465951254659GT2:g.51254659G>TClinGen:CA426128838C3280479 614325 Pitt-Hopkins-like syndrome 2;
NM_001330078.2(NRXN1):c.752G>A (p.Arg251His)9378NRXN1Uncertain significancers780954241RCV000364833|RCV000728207; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150|MedGen:CN51720225125466051254660CT2:g.51254660C>TClinGen:CA1655418CN169374 not specified;
NM_001330078.2(NRXN1):c.749T>A (p.Phe250Tyr)9378NRXN1Uncertain significancers200646155RCV000188276|RCV000766527|RCV001051150; NMedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125466351254663AT2:g.51254663A>TClinGen:CA316139CN169374 not specified;
NM_001330078.2(NRXN1):c.746G>A (p.Gly249Asp)9378NRXN1Uncertain significance-1RCV001224762; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125466651254666CT2:g.51254666C>T-
NM_001330078.2(NRXN1):c.740G>A (p.Arg247Gln)9378NRXN1Uncertain significancers1478221604RCV000811843; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125467251254672CT2:g.51254672C>T-
NM_001330078.2(NRXN1):c.739C>G (p.Arg247Gly)9378NRXN1Uncertain significancers200009780RCV000188288|RCV000792500|RCV001257611; NMedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150|Human Phenotype Ontology:HP:0000730,Human Phenotype Ontology:HP:0001249,Human Phenotype Ontology:HP:0001267,Human Phenotype Ontology:HP:0001286,Human Phenotype Ontology:HP:025125467351254673GC2:g.51254673G>CClinGen:CA316161
NM_001330078.2(NRXN1):c.730_735delinsCTGG (p.Asp244fs)9378NRXN1Pathogenic-1RCV001245999; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125467751254682GCAGTCCCAG2:g.51254678_51254682del-
NM_001330078.2(NRXN1):c.724G>C (p.Val242Leu)9378NRXN1Uncertain significancers878854254RCV000228333; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125468851254688CG2:g.51254688C>GClinGen:CA10582096C3280479 614325 Pitt-Hopkins-like syndrome 2;
NM_001330078.2(NRXN1):c.723C>G (p.Ala241=)9378NRXN1Likely benignrs200153066RCV000423843|RCV000719984|RCV000868312; NMedGen:CN169374|MedGen:C2711754|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125468951254689GC2:g.51254689G>CClinGen:CA1655425CN169374 not specified;
NM_001330078.2(NRXN1):c.665_673dup (p.Glu222_Glu224dup)9378NRXN1Uncertain significancers774230140RCV000649736|RCV000720288|RCV000768036; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150|MedGen:C2711754|MONDO:MONDO:0013696,MedGen:C3808494,OMIM:614332; MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125473851254739CCCCTCGCCCT2:g.51254738_51254739insCCTCGCCCTClinGen:CA1655435
NM_001330078.2(NRXN1):c.672G>T (p.Glu224Asp)9378NRXN1Uncertain significancers1011679353RCV000704827; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125474051254740CA2:g.51254740C>A-C3280479 614325 Pitt-Hopkins-like syndrome 2;
NM_001330078.2(NRXN1):c.670G>A (p.Glu224Lys)9378NRXN1Uncertain significance-1RCV001139143; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125474251254742CT2:g.51254742C>T-
NM_001330078.2(NRXN1):c.664G>A (p.Glu222Lys)9378NRXN1Uncertain significancers1575276127RCV000808782; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125474851254748CT2:g.51254748C>T-
NM_001330078.2(NRXN1):c.655G>A (p.Ala219Thr)9378NRXN1Uncertain significance-1RCV001035714; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125475751254757CT2:g.51254757C>T-
NM_001330078.2(NRXN1):c.652G>C (p.Glu218Gln)9378NRXN1Uncertain significancers756078185RCV000649735; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125476051254760CG2:g.51254760C>GClinGen:CA346823570
NM_001330078.2(NRXN1):c.644G>A (p.Ser215Asn)9378NRXN1Uncertain significance-1RCV001139144; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125476851254768CT2:g.51254768C>T-
NM_001330078.2(NRXN1):c.637G>A (p.Gly213Arg)9378NRXN1Uncertain significancers199561088RCV000188287|RCV000766526|RCV000813276; NMedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125477551254775CT2:g.51254775C>TClinGen:CA316159
NM_001330078.2(NRXN1):c.609_610delinsCA (p.Lys203_Leu204delinsAsnMet)9378NRXN1Uncertain significancers886042534RCV000281400|RCV001057033; NMedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125480251254803GCTGNC_000002.11:g.51254802_51254803delinsTGClinGen:CA10604366CN169374 not specified;
NM_001330078.2(NRXN1):c.600C>T (p.Gly200=)9378NRXN1Conflicting interpretations of pathogenicityrs201481698RCV000598907|RCV000768037|RCV001080918; NMedGen:CN517202|MONDO:MONDO:0013696,MedGen:C3808494,OMIM:614332; MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125481251254812GA2:g.51254812G>AClinGen:CA1655452CN169374 not specified;
NM_001330078.2(NRXN1):c.588C>T (p.Pro196=)9378NRXN1Likely benignrs201644834RCV000615200|RCV000869587; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125482451254824GA2:g.51254824G>AClinGen:CA1655454CN169374 not specified;
NM_001330078.2(NRXN1):c.588C>G (p.Pro196=)9378NRXN1Likely benignrs201644834RCV000863969; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125482451254824GC2:g.51254824G>C-
NM_001330078.2(NRXN1):c.587C>T (p.Pro196Leu)9378NRXN1Uncertain significancers199836119RCV000188313|RCV000815563; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125482551254825GA2:g.51254825G>AClinGen:CA316204
NM_001330078.2(NRXN1):c.583C>T (p.Leu195=)9378NRXN1Likely benignrs923508164RCV000437787|RCV000898686; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125482951254829GA2:g.51254829G>AClinGen:CA16604226CN169374 not specified;
NM_001330078.2(NRXN1):c.570C>A (p.Asn190Lys)9378NRXN1Uncertain significancers564945882RCV000188274|RCV000818582; NMedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125484251254842GT2:g.51254842G>TClinGen:CA316135
NM_001330078.2(NRXN1):c.569A>G (p.Asn190Ser)9378NRXN1Uncertain significancers200792504RCV000188273|RCV000473936|RCV000515306|RCV000716587|RCV000723758|RCV001251857; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150|MONDO:MONDO:0013696,MedGen:C3808494,OMIM:614332; MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150|MedGen:C2711754|MedGen:CN517202|Human Phenotype Ontology:HP:025125484351254843TC2:g.51254843T>CClinGen:CA234426CN169374 not specified;
NM_001330078.2(NRXN1):c.569A>T (p.Asn190Ile)9378NRXN1Uncertain significance-1RCV001210103; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125484351254843TA2:g.51254843T>A-
NM_001330078.2(NRXN1):c.553C>G (p.Arg185Gly)9378NRXN1Uncertain significance-1RCV001236646; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125485951254859GC2:g.51254859G>C-
NM_001330078.2(NRXN1):c.546G>A (p.Gly182=)9378NRXN1Likely benignrs1464488808RCV000649751; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125486651254866CT2:g.51254866C>TClinGen:CA426129341C3280479 614325 Pitt-Hopkins-like syndrome 2;
NM_001330078.2(NRXN1):c.543G>A (p.Lys181=)9378NRXN1Uncertain significance-1RCV001139145; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125486951254869CT2:g.51254869C>T-
NM_001330078.2(NRXN1):c.542A>G (p.Lys181Arg)9378NRXN1Uncertain significance-1RCV001224351; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125487051254870TC2:g.51254870T>C-
NM_001330078.2(NRXN1):c.536C>T (p.Pro179Leu)9378NRXN1Uncertain significancers777080356RCV000795924; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125487651254876GA2:g.51254876G>A-
NM_001330078.2(NRXN1):c.524G>A (p.Arg175Lys)9378NRXN1Uncertain significance-1RCV001141767; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125488851254888CT2:g.51254888C>T-
NM_001330078.2(NRXN1):c.521T>C (p.Val174Ala)9378NRXN1Uncertain significancers545577149RCV000360392; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125489151254891AG2:g.51254891A>GClinGen:CA1655464CN239445 Pitt-Hopkins-like syndrome;
NM_001330078.2(NRXN1):c.518C>T (p.Ser173Leu)9378NRXN1Uncertain significancers775907305RCV000796607; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125489451254894GA2:g.51254894G>A-
NM_001330078.2(NRXN1):c.515C>T (p.Ala172Val)9378NRXN1Uncertain significancers199986986RCV000649733; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125489751254897GA2:g.51254897G>AClinGen:CA48054900C3280479 614325 Pitt-Hopkins-like syndrome 2;
NM_001330078.2(NRXN1):c.511C>T (p.Leu171=)9378NRXN1Benignrs1045874RCV000079528|RCV000261050|RCV000715059; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150|MedGen:C271175425125490151254901GA2:g.51254901G>AClinGen:CA147121CN169374 not specified;
NM_001330078.2(NRXN1):c.503A>G (p.Lys168Arg)9378NRXN1Uncertain significancers200625614RCV000497458|RCV001141768; NMedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125490951254909TC2:g.51254909T>CClinGen:CA48054902CN169374 not specified;
NM_001330078.2(NRXN1):c.501C>G (p.Leu167=)9378NRXN1Benign/Likely benignrs200248561RCV000186644|RCV000712451|RCV000717118|RCV001085357; NMedGen:CN169374|MedGen:CN517202|MedGen:C2711754|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125491151254911GC2:g.51254911G>CClinGen:CA232555CN169374 not specified;
NM_001330078.2(NRXN1):c.499C>A (p.Leu167Ile)9378NRXN1Uncertain significancers753449110RCV000815186; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125491351254913GT2:g.51254913G>T-
NM_001330078.2(NRXN1):c.498G>A (p.Ala166=)9378NRXN1Conflicting interpretations of pathogenicityrs201212909RCV000186643|RCV000724556|RCV001087602; NMedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125491451254914CT2:g.51254914C>TClinGen:CA232553CN169374 not specified;
NM_001330078.2(NRXN1):c.492C>T (p.Ala164=)9378NRXN1Conflicting interpretations of pathogenicityrs201180707RCV000357139|RCV000866360; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150|MedGen:CN51720225125492051254920GA2:g.51254920G>AClinGen:CA1655472CN239445 Pitt-Hopkins-like syndrome;
NM_001330078.2(NRXN1):c.479C>T (p.Pro160Leu)9378NRXN1Uncertain significancers371517584RCV000475838; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125493351254933GA2:g.51254933G>AClinGen:CA1655475
NM_001330078.2(NRXN1):c.476C>T (p.Pro159Leu)9378NRXN1Uncertain significancers373070672RCV000188268|RCV000824466; NMedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125493651254936GA2:g.51254936G>AClinGen:CA316127
NM_001330078.2(NRXN1):c.475C>T (p.Pro159Ser)9378NRXN1Uncertain significance-1RCV001053434; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125493751254937GA2:g.51254937G>A-
NM_001330078.2(NRXN1):c.446T>C (p.Val149Ala)9378NRXN1Uncertain significancers759122060RCV000698776; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125496651254966AG2:g.51254966A>G-
NM_001330078.2(NRXN1):c.445G>A (p.Val149Met)9378NRXN1Uncertain significance-1RCV001236077; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125496751254967CT2:g.51254967C>T-
NM_001330078.2(NRXN1):c.435G>T (p.Arg145Ser)9378NRXN1Uncertain significancers1303388955RCV000817331; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125497751254977CA2:g.51254977C>A-
NM_001330078.2(NRXN1):c.420C>G (p.Val140=)9378NRXN1Likely benignrs751401940RCV000866400; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125499251254992GC2:g.51254992G>C-
NM_001330078.2(NRXN1):c.417G>A (p.Glu139=)9378NRXN1Likely benignrs757453009RCV000548362; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125499551254995CT2:g.51254995C>TClinGen:CA1655491C3280479 614325 Pitt-Hopkins-like syndrome 2;
NM_001330078.2(NRXN1):c.412G>T (p.Val138Leu)9378NRXN1Uncertain significancers374644929RCV000719931|RCV001038049; NMedGen:C2711754|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125500051255000CA2:g.51255000C>A-
NM_001330078.2(NRXN1):c.410G>T (p.Trp137Leu)9378NRXN1Uncertain significance-1RCV001057536; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125500251255002CA2:g.51255002C>A-
NM_001330078.2(NRXN1):c.407A>G (p.Lys136Arg)9378NRXN1Uncertain significancers202118977RCV000188311|RCV001223877; NMedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125500551255005TC2:g.51255005T>CClinGen:CA316200
NM_001330078.2(NRXN1):c.407A>C (p.Lys136Thr)9378NRXN1Uncertain significancers202118977RCV000814214; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125500551255005TG2:g.51255005T>G-
NM_001330078.2(NRXN1):c.389T>C (p.Ile130Thr)9378NRXN1Uncertain significance-1RCV001202053; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125502351255023AG2:g.51255023A>G-
NM_001330078.2(NRXN1):c.374A>G (p.Asn125Ser)9378NRXN1Uncertain significancers770641207RCV000188267|RCV000701447; NMedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125503851255038TC2:g.51255038T>CClinGen:CA316125CN169374 not specified;
NM_001330078.2(NRXN1):c.370C>T (p.Arg124Cys)9378NRXN1Uncertain significancers202244228RCV000716692|RCV001051974; NMedGen:C2711754|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125504251255042GA2:g.51255042G>A-
NM_001330078.2(NRXN1):c.348C>A (p.Ser116Arg)9378NRXN1Uncertain significancers764148223RCV000660502; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125506451255064GT2:g.51255064G>T-C3280479 614325 Pitt-Hopkins-like syndrome 2;
NM_001330078.2(NRXN1):c.342G>T (p.Trp114Cys)9378NRXN1Uncertain significancers1575278010RCV000817333; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125507051255070CA2:g.51255070C>A-
NM_001330078.2(NRXN1):c.325G>A (p.Val109Ile)9378NRXN1Uncertain significancers779979011RCV000492823|RCV001060039; NMedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125508751255087CT2:g.51255087C>TClinGen:CA346824240CN169374 not specified;
NM_001330078.2(NRXN1):c.325G>C (p.Val109Leu)9378NRXN1Uncertain significancers779979011RCV000649732; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125508751255087CG2:g.51255087C>GClinGen:CA1655511C3280479 614325 Pitt-Hopkins-like syndrome 2;
NM_001330078.2(NRXN1):c.324G>A (p.Pro108=)9378NRXN1Benign/Likely benignrs199595253RCV000444941|RCV000649750; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125508851255088CT2:g.51255088C>TClinGen:CA1655512CN169374 not specified;
NM_001330078.2(NRXN1):c.322C>T (p.Pro108Ser)9378NRXN1Conflicting interpretations of pathogenicityrs199784029RCV000515350|RCV000719177|RCV000723727|RCV001082855|RCV001251858; NMONDO:MONDO:0013696,MedGen:C3808494,OMIM:614332; MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150|MedGen:C2711754|MedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150|Human Phenotype Ontology:HP:0000730,Human Phe25125509051255090GA2:g.51255090G>AClinGen:CA221541CN169374 not specified;
NM_001330078.2(NRXN1):c.320C>T (p.Thr107Met)9378NRXN1Uncertain significancers368549770RCV000504207|RCV000792806; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125509251255092GA2:g.51255092G>AClinGen:CA1655518
NM_001330078.2(NRXN1):c.316G>A (p.Asp106Asn)9378NRXN1Uncertain significancers200576486RCV000500819|RCV001041325; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125509651255096CT2:g.51255096C>TClinGen:CA316121CN169374 not specified;
NM_001330078.2(NRXN1):c.315C>T (p.Ala105=)9378NRXN1Uncertain significancers767271650RCV000261922; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125509751255097GA2:g.51255097G>AClinGen:CA1655524CN239445 Pitt-Hopkins-like syndrome;
NM_001330078.2(NRXN1):c.302C>G (p.Ala101Gly)9378NRXN1Uncertain significancers200184823RCV000188256|RCV000719147|RCV000764447|RCV000798181; NMedGen:CN517202|MedGen:C2711754|MONDO:MONDO:0013696,MedGen:C3808494,OMIM:614332; MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125511051255110GC2:g.51255110G>CClinGen:CA316103
NM_001330078.2(NRXN1):c.302C>T (p.Ala101Val)9378NRXN1Uncertain significance-1RCV001054145; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125511051255110GA2:g.51255110G>A-
NM_001330078.2(NRXN1):c.283A>G (p.Ile95Val)9378NRXN1Uncertain significance-1RCV001221679; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125512951255129TC2:g.51255129T>C-
NM_001330078.2(NRXN1):c.276C>T (p.Ser92=)9378NRXN1Likely benignrs1553516780RCV000555673; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125513651255136GA2:g.51255136G>AClinGen:CA426129352
NM_001330078.2(NRXN1):c.270G>T (p.Gln90His)9378NRXN1Uncertain significancers199960045RCV000656993|RCV000765689|RCV001035816; NMedGen:CN517202|MONDO:MONDO:0013696,MedGen:C3808494,OMIM:614332; MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125514251255142CA2:g.51255142C>AClinGen:CA241414CN517202 not provided;
NM_001330078.2(NRXN1):c.262C>G (p.Arg88Gly)9378NRXN1Uncertain significancers748684256RCV000188264|RCV000765690; NMedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150; MONDO:MONDO:0013696,MedGen:C3808494,OMIM:61433225125515051255150GC2:g.51255150G>CClinGen:CA316119CN169374 not specified;
NM_001330078.2(NRXN1):c.261C>A (p.Gly87=)9378NRXN1Benign/Likely benignrs587781102RCV000127246|RCV000468290; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125515151255151GT2:g.51255151G>TClinGen:CA292602CN169374 not specified;
NM_001330078.2(NRXN1):c.256G>A (p.Gly86Ser)9378NRXN1Uncertain significance-1RCV001226641; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125515651255156CT2:g.51255156C>T-
NM_001330078.2(NRXN1):c.252G>A (p.Thr84=)9378NRXN1Conflicting interpretations of pathogenicityrs886042465RCV000304707|RCV001079005; NMedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125516051255160CT2:g.51255160C>TClinGen:CA10604279CN169374 not specified;
NM_001330078.2(NRXN1):c.222C>T (p.Gly74=)9378NRXN1Benign/Likely benignrs201592993RCV000127244|RCV000462667; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125519051255190GA2:g.51255190G>AClinGen:CA292599CN169374 not specified;
NM_001330078.2(NRXN1):c.219G>C (p.Glu73Asp)9378NRXN1Uncertain significancers201031680RCV000188260|RCV001060695; NMedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125519351255193CG2:g.51255193C>GClinGen:CA316111
NM_001330078.2(NRXN1):c.219G>A (p.Glu73=)9378NRXN1Likely benignrs201031680RCV000865619; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125519351255193CT2:g.51255193C>T-
NM_001330078.2(NRXN1):c.202C>G (p.Leu68Val)9378NRXN1Uncertain significancers1160149775RCV000813426; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125521051255210GC2:g.51255210G>C-
NM_001330078.2(NRXN1):c.190C>A (p.Arg64Ser)9378NRXN1Uncertain significancers201566733RCV000649737; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125522251255222GT2:g.51255222G>TClinGen:CA48054934
NM_001330078.2(NRXN1):c.158A>C (p.Glu53Ala)9378NRXN1Uncertain significance-1RCV001063641; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125525451255254TG2:g.51255254T>G-
NM_001330078.2(NRXN1):c.157G>A (p.Glu53Lys)9378NRXN1Uncertain significance-1RCV001242849; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125525551255255CT2:g.51255255C>T-
NM_001330078.2(NRXN1):c.150C>T (p.Cys50=)9378NRXN1Uncertain significancers1057518563RCV000473400; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125526251255262GA2:g.51255262G>AClinGen:CA16610975
NM_001330078.2(NRXN1):c.143C>G (p.Ala48Gly)9378NRXN1Uncertain significance-1RCV001209681; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125526951255269GC2:g.51255269G>C-
NM_001330078.2(NRXN1):c.129C>T (p.Phe43=)9378NRXN1Likely benignrs554874239RCV000940162; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125528351255283GA2:g.51255283G>A-
NM_001330078.2(NRXN1):c.122C>T (p.Thr41Met)9378NRXN1Uncertain significance-1RCV001041517; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125529051255290GA2:g.51255290G>A-
NM_001330078.2(NRXN1):c.113G>A (p.Gly38Asp)9378NRXN1Uncertain significancers1553517468RCV000649739; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125529951255299CT2:g.51255299C>TClinGen:CA346824686C3280479 614325 Pitt-Hopkins-like syndrome 2;
NM_001330078.2(NRXN1):c.108C>T (p.Ala36=)9378NRXN1Likely benignrs199871750RCV000430250|RCV000546560; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125530451255304GA2:g.51255304G>AClinGen:CA1655559CN169374 not specified;
NM_001330078.2(NRXN1):c.108C>G (p.Ala36=)9378NRXN1Uncertain significance-1RCV001143579; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125530451255304GC2:g.51255304G>C-
NM_001330078.2(NRXN1):c.105C>A (p.Gly35=)9378NRXN1Conflicting interpretations of pathogenicityrs55640811RCV000186642|RCV000717079|RCV000723673|RCV001082246; NMedGen:CN169374|MedGen:C2711754|MedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125530751255307GT2:g.51255307G>TClinGen:CA221522CN169374 not specified;
NM_001330078.2(NRXN1):c.105C>T (p.Gly35=)9378NRXN1Uncertain significancers55640811RCV000529246; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125530751255307GA2:g.51255307G>AClinGen:CA426129233
NM_001330078.2(NRXN1):c.76G>C (p.Glu26Gln)9378NRXN1Uncertain significancers201847846RCV000498110|RCV001225086; NMedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125533651255336CG2:g.51255336C>GClinGen:CA1655564CN169374 not specified;
NM_001330078.2(NRXN1):c.76G>A (p.Glu26Lys)9378NRXN1Uncertain significancers201847846RCV000824207; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125533651255336CT2:g.51255336C>T-
NM_001330078.2(NRXN1):c.75G>A (p.Ala25=)9378NRXN1Conflicting interpretations of pathogenicityrs376641324RCV000613077|RCV001211306; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125533751255337CT2:g.51255337C>TClinGen:CA1655566CN169374 not specified;
NM_001330078.2(NRXN1):c.65G>A (p.Gly22Asp)9378NRXN1Uncertain significancers1575279682RCV000818406; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125534751255347CT2:g.51255347C>T-
NM_001330078.2(NRXN1):c.59T>G (p.Leu20Arg)9378NRXN1Uncertain significance-1RCV001067477; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125535351255353AC2:g.51255353A>C-
NM_001330078.2(NRXN1):c.40C>A (p.Leu14Met)9378NRXN1Uncertain significance-1RCV001062694; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125537251255372GT2:g.51255372G>T-
NM_001330078.2(NRXN1):c.37C>T (p.Leu13Phe)9378NRXN1Uncertain significancers201674835RCV000720348|RCV001219129; NMedGen:C2711754|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125537551255375GA2:g.51255375G>A-
NM_001330078.2(NRXN1):c.35T>G (p.Phe12Cys)9378NRXN1Uncertain significancers1298445857RCV000698366|RCV000717333; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150|MedGen:C271175425125537751255377AC2:g.51255377A>C-
NM_001330078.2(NRXN1):c.24C>T (p.Arg8=)9378NRXN1Conflicting interpretations of pathogenicityrs200113281RCV000175677|RCV001089109; NMedGen:CN517202|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125538851255388GA2:g.51255388G>AClinGen:CA241410CN169374 not specified;
NM_001330078.2(NRXN1):c.20A>T (p.Gln7Leu)9378NRXN1Uncertain significancers1558617775RCV000706465; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125539251255392TA2:g.51255392T>A-C3280479 614325 Pitt-Hopkins-like syndrome 2;
NM_001330078.2(NRXN1):c.11C>T (p.Ala4Val)9378NRXN1Uncertain significancers1198368082RCV000814987; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125540151255401GA2:g.51255401G>A-
NM_001330078.2(NRXN1):c.9G>C (p.Thr3=)9378NRXN1Likely benignrs770820205RCV000472390|RCV000602134; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150|MedGen:CN16937425125540351255403CG2:g.51255403C>GClinGen:CA1655571
NM_001330078.2(NRXN1):c.-34C>A9378NRXN1Conflicting interpretations of pathogenicityrs200335720RCV000127239|RCV000385562; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125544551255445GT2:g.51255445G>TClinGen:CA292595CN169374 not specified;
NM_001330078.2(NRXN1):c.-133G>A9378NRXN1Uncertain significance-1RCV001143580; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125554451255544CT2:g.51255544C>T-
NM_001330078.2(NRXN1):c.-154A>G9378NRXN1Uncertain significance-1RCV001143581; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125556551255565TC2:g.51255565T>C-
NM_001330078.2(NRXN1):c.-193C>T9378NRXN1Uncertain significancers186097623RCV000295876; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125560451255604GA2:g.51255604G>AClinGen:CA10615557CN239445 Pitt-Hopkins-like syndrome;
NM_001330078.2(NRXN1):c.-209A>G9378NRXN1Likely benignrs112715587RCV000332175; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125562051255620TC2:g.51255620T>CClinGen:CA10615857CN239445 Pitt-Hopkins-like syndrome;
NM_001330078.2(NRXN1):c.-217C>G9378NRXN1Likely benignrs201073462RCV000381980; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125562851255628GC2:g.51255628G>CClinGen:CA10613659CN239445 Pitt-Hopkins-like syndrome;
NM_001330078.2(NRXN1):c.-224G>A9378NRXN1Uncertain significancers201347407RCV000287648; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125563551255635CT2:g.51255635C>TClinGen:CA10614140CN239445 Pitt-Hopkins-like syndrome;
NM_001330078.2(NRXN1):c.-232T>C9378NRXN1Uncertain significancers200988069RCV000347128; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125564351255643AG2:g.51255643A>GClinGen:CA10615858CN239445 Pitt-Hopkins-like syndrome;
NM_001330078.2(NRXN1):c.-281T>C9378NRXN1Benignrs35228545RCV000398128|RCV000829843; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150|MedGen:CN51720225125569251255692AG2:g.51255692A>GClinGen:CA10615558
NM_001330078.2(NRXN1):c.-282G>A9378NRXN1Uncertain significancers886056173RCV000284000; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125569351255693CT2:g.51255693C>TClinGen:CA10614141CN239445 Pitt-Hopkins-like syndrome;
NM_001330078.2(NRXN1):c.-333A>G9378NRXN1Uncertain significance-1RCV001137006; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125574451255744TC2:g.51255744T>C-
NM_001330078.2(NRXN1):c.-344A>C9378NRXN1Uncertain significance-1RCV001137007; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125575551255755TG2:g.51255755T>G-
NM_001330078.2(NRXN1):c.-371A>C9378NRXN1Uncertain significance-1RCV001137008; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125578251255782TG2:g.51255782T>G-
NM_001330078.2(NRXN1):c.-421A>C9378NRXN1Benignrs67661616RCV000339081; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125583251255832TG2:g.51255832T>GClinGen:CA10615859CN239445 Pitt-Hopkins-like syndrome;
NM_001330078.2(NRXN1):c.-422C>T9378NRXN1Uncertain significancers886056174RCV000398779; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125583351255833GA2:g.51255833G>AClinGen:CA10614143CN239445 Pitt-Hopkins-like syndrome;
NM_001330078.2(NRXN1):c.-453T>C9378NRXN1Uncertain significancers201518531RCV000304851; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125586451255864AG2:g.51255864A>GClinGen:CA10613663CN239445 Pitt-Hopkins-like syndrome;
NM_001330078.2(NRXN1):c.-465T>C9378NRXN1Uncertain significancers200410983RCV000354980; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125587651255876AG2:g.51255876A>GClinGen:CA10615861CN239445 Pitt-Hopkins-like syndrome;
NM_001330078.2(NRXN1):c.-557C>T9378NRXN1Uncertain significancers190900829RCV000399122; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125596851255968GA2:g.51255968G>AClinGen:CA10615862CN239445 Pitt-Hopkins-like syndrome;
NM_001330078.2(NRXN1):c.-563G>C9378NRXN1Benignrs62143025RCV000301456; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125597451255974CG2:g.51255974C>GClinGen:CA10613665CN239445 Pitt-Hopkins-like syndrome;
NM_001330078.2(NRXN1):c.-602G>A9378NRXN1Benignrs62143026RCV000356328|RCV000829961; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150|MedGen:CN51720225125601351256013CT2:g.51256013C>TClinGen:CA10613668
NM_001330078.2(NRXN1):c.-644A>G9378NRXN1Uncertain significancers199722674RCV000275652; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125605551256055TC2:g.51256055T>CClinGen:CA10613669CN239445 Pitt-Hopkins-like syndrome;
NM_001330078.2(NRXN1):c.-747C>G9378NRXN1Uncertain significancers199974519RCV000330703; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125615851256158GC2:g.51256158G>CClinGen:CA10614144
NM_001330078.2(NRXN1):c.-798G>A9378NRXN1Uncertain significance-1RCV001141882; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125620951256209CT2:g.51256209C>T-
NM_001330078.2(NRXN1):c.-813A>G9378NRXN1Uncertain significancers201740093RCV000370874; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125622451256224TC2:g.51256224T>CClinGen:CA10615563
NM_001330078.2(NRXN1):c.-883T>C9378NRXN1Benignrs10188340RCV000276312|RCV000830073; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:221150|MedGen:CN51720225125629451256294AG2:g.51256294A>GClinGen:CA10615564
NM_001330078.2(NRXN1):c.-922+7A>C9378NRXN1Conflicting interpretations of pathogenicityrs200115353RCV000127231|RCV000326728; NMedGen:CN169374|MONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125911251259112TG2:g.51259112T>GClinGen:CA292584CN169374 not specified;
NM_001330078.2(NRXN1):c.-951T>C9378NRXN1Benignrs2287235RCV000381367; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125914851259148AG2:g.51259148A>GClinGen:CA10614145
NM_001330078.2(NRXN1):c.-995T>C9378NRXN1Uncertain significance-1RCV001141883; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125919251259192AG2:g.51259192A>G-
NM_001330078.2(NRXN1):c.-1011G>A9378NRXN1Uncertain significancers113142002RCV000291983; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125920851259208CT2:g.51259208C>TClinGen:CA10613670
NM_001330078.2(NRXN1):c.-1039C>T9378NRXN1Uncertain significancers201743429RCV000328210; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125923651259236GA2:g.51259236G>AClinGen:CA10615565
NM_001330078.2(NRXN1):c.-1057C>G9378NRXN1Uncertain significancers886056175RCV000378129; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125925451259254GC2:g.51259254G>CClinGen:CA10615571
NM_001135659.2(NRXN1):c.-1103T>C9378NRXN1Uncertain significancers199802558RCV000283643; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125930051259300AG2:g.51259300A>GClinGen:CA10614146
NM_001135659.2(NRXN1):c.-1122C>T9378NRXN1Uncertain significancers199620396RCV000341497; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125931951259319GA2:g.51259319G>AClinGen:CA10615572
NM_001135659.2(NRXN1):c.-1167C>T9378NRXN1Uncertain significance-1RCV001143676; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125936451259364GA2:g.51259364G>A-
NM_001135659.2(NRXN1):c.-1219C>T9378NRXN1Uncertain significancers200251205RCV000372830; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125941651259416GA2:g.51259416G>AClinGen:CA10615573
NM_001135659.2(NRXN1):c.-1263G>C9378NRXN1Uncertain significancers199614038RCV000338021; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125946051259460CG2:g.51259460C>GClinGen:CA10615864
NM_001135659.2(NRXN1):c.-1270A>C9378NRXN1Uncertain significancers200176717RCV000397099; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125946751259467TG2:g.51259467T>GClinGen:CA10615581
NM_001135659.2(NRXN1):c.-1273G>A9378NRXN1Uncertain significancers186103615RCV000312102; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125947051259470CT2:g.51259470C>TClinGen:CA10614149
NM_001135659.2(NRXN1):c.-1310G>C9378NRXN1Uncertain significancers199990648RCV000348328; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125950751259507CG2:g.51259507C>GClinGen:CA10615585
NM_001135659.2(NRXN1):c.-1334C>G9378NRXN1Uncertain significancers201606022RCV000390220; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125953151259531GC2:g.51259531G>CClinGen:CA10615865
NM_001135659.2(NRXN1):c.-1356C>T9378NRXN1Uncertain significance-1RCV001137126; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125955351259553GA2:g.51259553G>A-
NM_001135659.2(NRXN1):c.-1373C>A9378NRXN1Uncertain significancers886056177RCV000363612; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125957051259570GT2:g.51259570G>TClinGen:CA10615869
NM_001135659.2(NRXN1):c.-1381G>A9378NRXN1Uncertain significancers886056178RCV000268953; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125957851259578CT2:g.51259578C>TClinGen:CA10614150
NM_001135659.2(NRXN1):c.-1394G>T9378NRXN1Likely benign-1RCV001137127; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125959151259591CA2:g.51259591C>A-
NM_001135659.2(NRXN1):c.-1395G>A9378NRXN1Uncertain significancers886056179RCV000310084; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125959251259592CT2:g.51259592C>TClinGen:CA10613673
NM_001135659.2(NRXN1):c.-1451T>C9378NRXN1Uncertain significance-1RCV001139366; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125964851259648AG2:g.51259648A>G-
NM_001135659.2(NRXN1):c.-1455C>T9378NRXN1Uncertain significancers201544418RCV000306400; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025125965251259652GA2:g.51259652G>AClinGen:CA10614162CN239445 Pitt-Hopkins-like syndrome;
Single allele-1NRXN1;MIR8485;LOC110121071Pathogenic-1RCV000678023; NMONDO:MONDO:0013690,MedGen:C3280479,OMIM:614325, Orphanet:22115025051655051259738nana-C1968689 243700 Hyperimmunoglobulin E recurrent infection syndrome, autosomal recessive;
MSeqDR Portal