MSeqDR Mitochondrial Disease Portal


 
*:HP: HPO terms, UMDF: 1= Disease, ND: NAMDC terms.
  Most Studied  CPEO, Complex I Deficiency, COXPD1, Leigh, LHON, MELAS, MERRF, Myopathy, SANDO
Disease Browser
Parent Node:
expand
Genetic Diseases, X-Linked (D040181)
Parent Node:
expand
Muscular Diseases (D009135)
..Starting node
..expand
Myopathy, X-Linked, with Excessive Autophagy (C564093)

       Child Nodes:



 Sister Nodes: 
..expandAlpha-B Crystallinopathy (C563848)
..expandAnal Sphincter Myopathy, Internal (C566287)
..expandAplasia of Extensor Muscles of Fingers, Unilateral, with Generalized Polyneuropathy (C565945)
..expandArthrogryposis (D001176) Child55
..expandCamptodactyly, fibrous tissue hyperplasia, and skeletal dysplasia (C537974)
..expandCarnitine Palmitoyltransferase II Deficiency, Late-Onset (C563461)  LSDB  L: 00486;
..expandChanarin-Dorfman Syndrome (C536560)
..expandCompartment Syndromes (D003161) Child3
..expandContracture (D003286) Child41
..expandCraniomandibular Disorders (D017271) Child4
..expandDimauro disease (C536176)
..expandEHLERS-DANLOS SYNDROME, KYPHOSCOLIOTIC TYPE, 2 (OMIM:614557)
..expandEncephalopathy, Axonal, with Necrotizing Myopathy, Cardiomyopathy, and Cataracts (C565596)
..expandEosinophilia-Myalgia Syndrome (D016603)
..expandEpiphyseal Dysplasia, Multiple, with Myopathy (C563420)
..expandErythrocyte Amp Deaminase Deficiency (C567878)
..expandErythrocyte Lactate Transporter Defect (C565449)
..expandFatigue Syndrome, Chronic (D015673)
..expandFibromyalgia (D005356)
..expandFingerprint Body Myopathy (C564425)
..expandHereditary Myopathy with Early Respiratory Failure (C566343)
..expandHypertrophia Musculorum Vera (C564152)
..expandIsaacs Syndrome (D020386)
..expandKocher-Debre-Semelaigne syndrome (C537211)
..expandMarinesco-Sjogren-like syndrome (MSLS) (C535913)
..expandMedial Tibial Stress Syndrome (D058923)
..expandMitochondrial DNA Depletion Syndrome, Myopathic Form (C563698)
..expandMitochondrial Myopathies (D017240) Child33  LSDB C:22 L: 00400;
..expandMuscle Cramp (D009120) Child3
..expandMUSCLE HYPERTROPHY (OMIM:614160)
..expandMuscle Neoplasms (D019042)
..expandMuscle Rigidity (D009127) Child3
..expandMuscle Spasticity (D009128) Child17
..expandMuscle Weakness (D018908) Child5  LSDB C:2
..expandMuscular Disorders, Atrophic (D020966) Child120  LSDB C:1
..expandMuscular Hypoplasia, Congenital Universal, of Krabbe (C563553)
..expandMusculoskeletal Pain (D059352) Child2
..expandMyalgia (D063806)
..expandMyofascial Pain Syndromes (D009209) Child1
..expandMyopathic carnitine deficiency (C536100)
..expandMyopathies, Structural, Congenital (D020914) Child34
..expandMyopathy due to Malate-Aspartate Shuttle Defect (C564973)
..expandMYOPATHY DUE TO MYOADENYLATE DEAMINASE DEFICIENCY (OMIM:615511)
..expandMyopathy with Giant Abnormal Mitochondria (C564971)
..expandMyopathy with Lactic Acidosis, Hereditary (C564972)  LSDB  L: 00476;
..expandMyopathy, Cataract, Hypogonadism Syndrome (C563578)
..expandMyopathy, congenital nonprogressive with Moebius and Robin sequences (C536102)
..expandMyopathy, Congenital, With Excess Of Muscle Spindles (C566896)
..expandMyopathy, Early-Onset, with Fatal Cardiomyopathy (C567129)
..expandMyopathy, Granulovacuolar Lobular, with Electrical Myotonia (C564974)
..expandMyopathy, Hyaline Body, Autosomal Recessive (C564970)
..expandMyopathy, Myosin Storage (C564253)
..expandMyopathy, Reducing Body, X-Linked, Childhood-Onset (C567468)
..expandMyopathy, Reducing Body, X-Linked, Early-Onset, Severe (C567469)
..expandMyopathy, X-Linked, with Excessive Autophagy (C564093)
..expandMyositis (D009220) Child16
..expandMyostatin-related muscle hypertrophy (C536106)
..expandMyotonic Disorders (D020967) Child10
..expandNeutral Lipid Storage Disease with Myopathy (C565192)
..expandOphthalmoplegic Neuromuscular Disorder with Abnormal Mitochondria (C564925)
..expandOptic Atrophy, Deafness, Ophthalmoplegia, and Myopathy (C565117)
..expandParalyses, Familial Periodic (D010245) Child7
..expandPectoralis Muscle, Absence of (C566793)
..expandPERIPHERAL NEUROPATHY, MYOPATHY, HOARSENESS, AND HEARING LOSS (OMIM:614369)
..expandPolymyalgia Rheumatica (D011111)
..expandProximal Myopathy with Focal Depletion of Mitochondria (C563453)
..expandRhabdomyolysis (D012206) Child6  LSDB C:2
..expandRippling muscle disease, 1 (C535686)
..expandSecretory Diarrhea, Myopathy, and Deafness (C564382)
..expandSingleton Merten syndrome (C537343)
..expandSystemic carnitine deficiency (C536778)  LSDB  L: 00473;
..expandTel Hashomer camptodactyly syndrome (C536953)
..expandTendinopathy (D052256) Child5
..expandTreft Sanborn Carey syndrome (C536544)
..expandUruguay Faciocardiomusculoskeletal Syndrome (C564544)
..expandVacuolar myopathy (C536522)
..expandVLCAD deficiency (C536353)  LSDB  L: 00436;
   

Human Disease MESH is developed by UMLS.
Further data from MedGen, OMIM,ClinVar, CTD
Term ID:8508
Name:Myopathy, X-Linked, with Excessive Autophagy
Definition:
Alternative IDs:OMIM:310440
ParentIDs:MESH:D009135|MESH:D040181
TreeNumbers:C05.651/C564093 |C10.668.491/C564093 |C16.320.322/C564093
Synonyms:MEAX |XMEA
Slim Mappings:Genetic disease (inborn)|Musculoskeletal disease|Nervous system disease
Reference: MedGen: C564093
MeSH: C564093
OMIM: 310440;
MSeqDR LSDB:  
Genes: AF8T;
Phenotypes
1 HP:0001419X-linked recessive inheritance
2 HP:0003551Difficulty climbing stairs
3 HP:0009046Difficulty running
4 HP:0003236Elevated serum creatine phosphokinase
5 HP:0001371Flexion contractureHP:0040283
6 HP:0003391Gowers sign
7 HP:0003829Incomplete penetrance
8 HP:0007941Limited extraocular movementsHP:0040283
9 HP:0001270Motor delayHP:0040283
10 HP:0003198Myopathy
NAMDC:  Myopathy
11 HP:0002486Myotonia
12 HP:0001319Neonatal hypotonia
NAMDC:  Floppy baby
HP:0040283
13 HP:0008994Proximal muscle weakness in lower limbs
14 HP:0002093Respiratory insufficiencyHP:0040283
15 HP:0002650ScoliosisHP:0040283
16 HP:0003202Skeletal muscle atrophy
17 HP:0003677Slow progression
Disease Causing ClinVar Variants
Variation_NameGeneIDGeneSymbolClinicalSignificancedbSNPRCVaccessionTestedInGTRPhenotypeIDsChromosomeStartStopHGVS_cHGVS_pHGVS_gOtherIDsDisease_ClinVar
NM_001017980.4(VMA21):c.12G>A (p.Pro4=)203547VMA21Likely benignrs1029458335RCV000952593|RCV001434487; NMedGen:CN517202|MONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980X150565792150565792GAX:g.150565792G>A-
NM_001017980.4(VMA21):c.15T>G (p.Asp5Glu)203547VMA21Likely benignrs765120199RCV000442228|RCV000877551; NMedGen:CN169374|MONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980X150565795150565795TGX:g.150565795T>GClinGen:CA10540534CN169374 not specified;
NM_001017980.4(VMA21):c.22G>A (p.Ala8Thr)203547VMA21Uncertain significancers1483109932RCV001229635; NMONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980X150565802150565802GAX:g.150565802G>A-
NM_001017980.4(VMA21):c.23C>T (p.Ala8Val)203547VMA21Uncertain significancers1556034337RCV000640508; NMONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980X150565803150565803CTNC_000023.10:g.150565803C>TClinGen:CA415270788C1839615 310440 Myopathy, X-linked, with excessive autophagy;
NM_001017980.4(VMA21):c.24G>A (p.Ala8=)203547VMA21Likely benign-1RCV001407353; NMONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980X150565804150565804GA150565804-
NM_001017980.4(VMA21):c.29A>G (p.Asn10Ser)203547VMA21Uncertain significancers1197341312RCV000698567; NMONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980X150565809150565809AGX:g.150565809A>G-C1839615 310440 Myopathy, X-linked, with excessive autophagy;
NM_001017980.4(VMA21):c.41C>T (p.Pro14Leu)203547VMA21Uncertain significancers1412988171RCV000640509; NMONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980X150565821150565821CTNC_000023.10:g.150565821C>TClinGen:CA415270825C1839615 310440 Myopathy, X-linked, with excessive autophagy;
NM_001017980.4(VMA21):c.42T>C (p.Pro14=)203547VMA21Likely benign-1RCV001418054; NMONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980X150565822150565822TC150565822-
NM_001017980.4(VMA21):c.53+5C>T203547VMA21Uncertain significance-1RCV001364804; NMONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980X150565838150565838CT150565838-
NM_001017980.4(VMA21):c.53+18C>T203547VMA21Likely benign-1RCV002214636; NMONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980X150565851150565851CT150565851-
NM_001017980.4(VMA21):c.54-27A>C203547VMA21Uncertain significancers878854352RCV000190826; NMONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980X150572076150572076ACNC_000023.10:g.150572076A>CClinGen:CA10575761,OMIM:300913.0001C1839615 310440 Myopathy, X-linked, with excessive autophagy;
NM_001017980.4(VMA21):c.54-27A>T203547VMA21Pathogenicrs878854352RCV000190827; NMONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980X150572076150572076ATNC_000023.10:g.150572076A>TClinGen:CA10575762,OMIM:300913.0002C1839615 310440 Myopathy, X-linked, with excessive autophagy;
NM_001017980.4(VMA21):c.54-16_54-8del203547VMA21Pathogenicrs878854357RCV000190834; NMONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980X150572083150572091TCTTTGTTTATX:g.150572083_150572091delClinGen:CA10575768,OMIM:300913.0009C1839615 310440 Myopathy, X-linked, with excessive autophagy;
NM_001017980.4(VMA21):c.54-17T>C203547VMA21Likely benign-1RCV002114028; NMONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980X150572086150572086TC150572086-
NM_001017980.4(VMA21):c.57T>C (p.Asn19=)203547VMA21Likely benign-1RCV001430946; NMONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980X150572106150572106TC150572106-
NM_001017980.4(VMA21):c.76A>G (p.Thr26Ala)203547VMA21Benign-1RCV002102993; NMONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980X150572125150572125AG150572125-
NM_001017980.4(VMA21):c.86C>T (p.Thr29Met)203547VMA21Uncertain significance-1RCV001978982; NMONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980X150572135150572135CT150572135-
NM_001017980.4(VMA21):c.102A>G (p.Thr34=)203547VMA21Benign-1RCV002095384; NMONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980X150572151150572151AG150572151-
NM_001017980.4(VMA21):c.112A>G (p.Ile38Val)203547VMA21Uncertain significance-1RCV001969259; NMONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980X150572161150572161AG150572161-
NM_001017980.4(VMA21):c.127G>T (p.Gly43Trp)203547VMA21Uncertain significance-1RCV001892441; NMONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980X150572176150572176GT150572176-
NM_001017980.4(VMA21):c.144T>G (p.Thr48=)203547VMA21Benignrs201487581RCV000877649; NMONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980X150572193150572193TGX:g.150572193T>G-
NM_001017980.4(VMA21):c.163+4A>G203547VMA21Pathogenicrs797044909RCV000190828|RCV000190737; NMONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980|MeSH:D030342,MedGen:C0950123X150572216150572216AGX:g.150572216A>GClinGen:CA204757,OMIM:300913.0003C0950123 Inborn genetic diseases;
NM_001017980.4(VMA21):c.163+14C>T203547VMA21Benign-1RCV002207146; NMONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980X150572226150572226CT150572226-
NM_001017980.4(VMA21):c.163+16T>G203547VMA21Benign-1RCV002124936; NMONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980X150572228150572228TG150572228-
NM_001017980.4(VMA21):c.164-19_164-18del203547VMA21Likely benign-1RCV002167680; NMONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980X150573368150573369CTGC150573367-
NM_001017980.4(VMA21):c.164-11dup203547VMA21Benign-1RCV002083831; NMONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980X150573369150573370GGT150573369-
NM_001017980.4(VMA21):c.164-19G>T203547VMA21Benign-1RCV002216185; NMONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980X150573369150573369GT150573369-
NM_001017980.4(VMA21):c.164-11del203547VMA21Benign-1RCV002140994; NMONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980X150573370150573370GTG150573369-
NM_001017980.4(VMA21):c.164-7T>G203547VMA21Pathogenicrs878854353RCV000190829; NMONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980X150573381150573381TGNC_000023.10:g.150573381T>GClinGen:CA10575763,OMIM:300913.0004C1839615 310440 Myopathy, X-linked, with excessive autophagy;
NM_001017980.4(VMA21):c.164-6T>G203547VMA21Pathogenicrs878854356RCV000190832; NMONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980X150573382150573382TGNC_000023.10:g.150573382T>GClinGen:CA10575766,OMIM:300913.0007C1839615 310440 Myopathy, X-linked, with excessive autophagy;
NM_001017980.4(VMA21):c.164G>T (p.Gly55Val)203547VMA21Uncertain significancers1306425454RCV000705011; NMONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980X150573388150573388GTX:g.150573388G>T-C1839615 310440 Myopathy, X-linked, with excessive autophagy;
NM_001017980.4(VMA21):c.165C>T (p.Gly55=)203547VMA21Benignrs146017753RCV000533169; NMONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980X150573389150573389CTNC_000023.10:g.150573389C>TClinGen:CA10540578C1839615 310440 Myopathy, X-linked, with excessive autophagy;
NM_001017980.4(VMA21):c.166G>A (p.Ala56Thr)203547VMA21Uncertain significancers140025330RCV000691154; NMONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980X150573390150573390GAX:g.150573390G>A-C1839615 310440 Myopathy, X-linked, with excessive autophagy;
NM_001017980.4(VMA21):c.175A>G (p.Met59Val)203547VMA21Uncertain significance-1RCV001366051; NMONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980X150573399150573399AG150573399-
NM_001017980.4(VMA21):c.182A>G (p.Asn61Ser)203547VMA21Benignrs141926826RCV000532808; NMONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980X150573406150573406AGX:g.150573406A>GClinGen:CA10540581C1839615 310440 Myopathy, X-linked, with excessive autophagy;
NM_001017980.4(VMA21):c.202G>T (p.Ala68Ser)203547VMA21Uncertain significancers778349414RCV001334673; NMONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980X150573426150573426GT150573426-
NM_001017980.4(VMA21):c.222C>T (p.Val74=)203547VMA21Likely benign-1RCV002133683; NMONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980X150573446150573446CT150573446-
NM_001017980.4(VMA21):c.223G>A (p.Ala75Thr)203547VMA21Uncertain significancers1464563401RCV001208862; NMONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980X150573447150573447GAX:g.150573447G>A-
NM_001017980.4(VMA21):c.225C>T (p.Ala75=)203547VMA21Benignrs139323488RCV000640510; NMONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980X150573449150573449CTNC_000023.10:g.150573449C>TClinGen:CA10540588C1839615 310440 Myopathy, X-linked, with excessive autophagy;
NM_001017980.4(VMA21):c.226G>A (p.Val76Ile)203547VMA21Uncertain significance-1RCV001931247; NMONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980X150573450150573450GA150573450-
NM_001017980.4(VMA21):c.228C>A (p.Val76=)203547VMA21Likely benign-1RCV002158405; NMONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980X150573452150573452CA150573452-
NM_001017980.4(VMA21):c.236T>G (p.Val79Gly)203547VMA21Uncertain significancers1602821150RCV000802782; NMONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980X150573460150573460TGX:g.150573460T>G-
NM_001017980.4(VMA21):c.245T>G (p.Leu82Arg)203547VMA21Uncertain significancers2011274822RCV001300038; NMONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980X150573469150573469TG150573469-
NM_001017980.4(VMA21):c.252G>A (p.Val84=)203547VMA21Benign-1RCV001514129; NMONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980X150573476150573476GA150573476-
NM_001017980.4(VMA21):c.255T>C (p.Tyr85=)203547VMA21Benign-1RCV001511018; NMONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980X150573479150573479TC150573479-
NM_001017980.4(VMA21):c.272G>C (p.Gly91Ala)203547VMA21Pathogenicrs878854354RCV000190830; NMONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980X150573496150573496GCX:g.150573496G>CClinGen:CA10575764,OMIM:300913.0005C1839615 310440 Myopathy, X-linked, with excessive autophagy;
NM_001017980.4(VMA21):c.291A>G (p.Glu97=)203547VMA21Likely benign-1RCV001433445; NMONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980X150573515150573515AG150573515-
NM_001017980.4(VMA21):c.300G>A (p.Gln100=)203547VMA21Likely benign-1RCV002077660; NMONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980X150573524150573524GA150573524-
NM_001017980.4(VMA21):c.*6A>G203547VMA21Likely pathogenicrs878854355RCV000190831; NMONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980X150573536150573536AGNC_000023.10:g.150573536A>GClinGen:CA10575765,OMIM:300913.0006C1839615 310440 Myopathy, X-linked, with excessive autophagy;
NM_001017980.4(VMA21):c.*13_*104del203547VMA21Pathogenicrs1556035617RCV000190833; NMONDO:MONDO:0010684,MedGen:C1839615,OMIM:310440, Orphanet:25980X150573543150573634CCTTTTTATAGCATTAAATTCATTTTTTAAAATGATAAATGCTGGAGGGGGCCATCTGATTTGAATAAAGTTGAAAGAACATGTTAAAGTCAGCNC_000023.10:g.150573543_150573634delClinGen:CA10575767,OMIM:300913.0008
MSeqDR Portal