MSeqDR Mitochondrial Disease Portal


 
*:HP: HPO terms, UMDF: 1= Disease, ND: NAMDC terms.
  Most Studied  CPEO, Complex I Deficiency, COXPD1, Leigh, LHON, MELAS, MERRF, Myopathy, SANDO
Disease Browser
Parent Node:
expand
Agammaglobulinemia (D000361)
Parent Node:
expand
Dwarfism, Pituitary (D004393)
Parent Node:
expand
Genetic Diseases, X-Linked (D040181)
..Starting node
..expand
Hypogammaglobulinemia and Isolated growth hormone deficiency, X-linked (C537149)

       Child Nodes:



 Sister Nodes: 
..expandAarskog Syndrome (C535331) Child1
..expandAbruzzo Erickson syndrome (C535559)
..expandAchromatopsia incomplete, X-linked (C538165)
..expandAdrenal Hypoplasia, Congenital, with Precocious Puberty (C564568)
..expandAgammaglobulinemia, X-linked, type 2 (C538057)
..expandAicardi Syndrome (D058540) Child1
..expandAland Island Eye Disease (C562664)
..expandAlpha-Thalassemia Myelodysplasia Syndrome (C563023)
..expandAlport Syndrome, Mental Retardation, Midface Hypoplasia, and Elliptocytosis (C564570)
..expandAlzheimer Disease 16 (C567463)
..expandAndrogen-Insensitivity Syndrome (D013734) Child2
..expandAnemia, Nonspherocytic Hemolytic, Due To G6pd Deficiency (C567533)
..expandAnemia, sideroblastic spinocerebellar ataxia (C536358)
..expandAnemia, X-Linked, without Thrombocytopenia (C564429)
..expandAnencephaly and spina bifida X-linked (C536359)
..expandAneurysm, Intracranial Berry, 5 (C563670)
..expandAngioma serpiginosum, X-linked (C536366)
..expandArthrogryposis multiplex congenita, distal, X-linked (C535380)
..expandArthrogryposis, X-Linked, Type V (C564574)
..expandArts syndrome (C535388)
..expandAtypical Mycobacteriosis, Familial, X-Linked 1 (C567070)
..expandAtypical Mycobacteriosis, Familial, X-Linked 2 (C567068)
..expandBarth Syndrome (D056889) Child2  LSDB  L: 00399;
..expandBornholm Eye Disease (C564092)
..expandBrain Anomalies, Retardation, Ectodermal Dysplasia, Skeletal Malformations, Hirschsprung Disease, Ear-Eye Anomalies, Cleft Palate-Cryptorchidism, And (C564519)
..expandBranchial arch syndrome X-linked (C537102)
..expandBrunner Syndrome (C563156)
..expandBruton type agammaglobulinemia (C537409)
..expandBulbo-Spinal Atrophy, X-Linked (D055534) Child1
..expandBullous Dystrophy, Hereditary Macular Type (C563065)
..expandCardiac valvular dysplasia, X-linked (C535576)
..expandCardiomyopathy, Dilated, 3A (C564721)
..expandCataract, congenital, with microcornea or slight microphthalmia (C535338)
..expandChondrodysplasia punctata, brachytelephalangic (C535941)
..expandChoroideremia (D015794) Child2
..expandChromosome Xp11.23-P11.22 Duplication Syndrome (C567585)
..expandChromosome Xq28 Duplication Syndrome (C567580)
..expandCleft Palate with Ankyloglossia (C564442)
..expandCleft palate X-linked (C536426)
..expandCone Dystrophy, X-Linked, 1 (C564439)
..expandCone dystrophy, x-linked, with tapetal-like sheen (C535975)
..expandCone-Rod Dystrophy, X-Linked, 2 (C564717)
..expandCone-Rod Dystrophy, X-Linked, 3 (C564507)
..expandCone-Rod Dystrophy, X-Linked, Type 1 (C564438)
..expandCongenital alopecia X-linked (C535981)
..expandCongenital Heart Defects, X-Linked (C567444)
..expandCongenital Hemidysplasia with Ichthyosiform Erythroderma and Limb Defects (C562515)
..expandCongenital idiopathic intestinal pseudoobstruction (C535532)
..expandCorpus Callosum, Partial Agenesis of, X-Linked (C564115)
..expandCraniofacioskeletal Syndrome (C567471)
..expandDeafness, High-Frequency Sensorineural, X-Linked (C564432)
..expandDeafness, X-Linked 1 (C564433)
..expandDeafness, X-Linked 3 (C564727)
..expandDeafness, X-Linked 4 (C564723)
..expandDeafness, X-Linked 5 (C564472)
..expandDent Disease (D057973) Child1
..expandDent disease 1 (C538212)
..expandDent Disease 2 (C564487)
..expandDyserythropoietic Anemia with Thrombocytopenia (C564525)
..expandDyskeratosis Congenita (D019871) Child3
..expandDystonia 3, Torsion, X-Linked (C564048)
..expandEctodermal Dysplasia 1, Anhidrotic (D053358) Child1
..expandEctodermal Dysplasia, Anhidrotic, with Immunodeficiency, Osteopetrosis, and Lymphedema (C564538)
..expandEctodermal dysplasia, hypohidrotic, with immune deficiency (C536181)
..expandEhlers-Danlos syndrome type 5 (C536197)
..expandEpidermodysplasia Verruciformis, X-Linked (C564430)
..expandEpilepsy, Female-Restricted, with Mental Retardation (C564715)
..expandEpilepsy, X-Linked, with Variable Learning Disabilities and Behavior Disorders (C564505)
..expandEpisodic Muscle Weakness, X-Linked (C564565)
..expandExudative Vitreoretinopathy, Familial, X-Linked Recessive (C564428)
..expandFabry Disease (D000795) Child2
..expandFetal akinesia syndrome, X-linked (C537921)
..expandFg Syndrome 5 (C564480)
..expandFocal Dermal Hypoplasia (D005489) Child1
..expandGlycogen Storage Disease Type IIb (D052120)
..expandGlycogen Storage Disease Type VIII (D006015)
..expandGlycogen Storage Disease, Type IXA2 (C567579)
..expandGlycogen Storage Disease, Type IXD (C564485)
..expandGranulomatous Disease, Chronic (D006105) Child7
..expandHemophilia B (D002836)
..expandHeterotaxy, visceral, X-linked (C538116)
..expandHeterotopia, Periventricular Nodular, with Frontometaphyseal Dysplasia (C564725)
..expandHeterotopia, Periventricular, Ehlers-Danlos Variant (C564492)
..expandHodgkin disease, X-linked pseudoautosomal (C538326)
..expandHydrocephalus With Cerebellar Agenesis (C564407)
..expandHydrocephalus, X-linked (C536078)
..expandHydrocephalus, X-Linked, with Congenital Idiopathic Intestinal Pseudoobstruction (C564408)
..expandHyper-IgM Immunodeficiency Syndrome, Type 1 (D053307) Child1
..expandHyperekplexia and Epilepsy (C564474)
..expandHypertrichosis congenital generalized X-linked (C538388)
..expandHypogammaglobulinemia and Isolated growth hormone deficiency, X-linked (C537149)
..expandHypogammaglobulinemia, X-Linked (C562478)
..expandHypoparathyroidism, X-Linked (C562782)
..expandHypospadias 1, X-Linked (C567482)
..expandHypospadias 2, X-Linked (C567462)
..expandIchthyosis, X-Linked (D016114) Child2
..expandIchthyosis, X-Linked, Complicated (C567443)
..expandImmune Dysregulation, Polyendocrinopathy, Enteropathy, X-Linked Syndrome (C580192)
..expandImmunodeficiency, X-Linked, with Deficiency of 115,000 Dalton Surface Glycoprotein (C564120)
..expandIsolated Noncompaction of the Ventricular Myocardium (D056830) Child5
..expandJoubert Syndrome 10 (C567582)
..expandKeratosis Follicularis Spinulosa Decalvans, X-Linked (C536159)
..expandLeigh Syndrome, X-Linked (C564114)
..expandLeukoencephalopathy With Metaphyseal Chondrodysplasia (C567065)
..expandLiver Glycogenosis, X-Linked, Type II (C564421)
..expandLymphoproliferative Syndrome, X-Linked, 2 (C564469)
..expandMacrothrombocytopenia, X-Linked (C564526)
..expandMacular Dystrophy, X-Linked (C564110)
..expandMajor Affective Disorder 2 (C564108)
..expandMartin-Probst Deafness-Mental Retardation Syndrome (C564495)
..expandMASA (Mental Retardation, Aphasia, Shuffling Gait, Adducted Thumbs) Syndrome (C536029)
..expandMegalocornea (C562829)
..expandMembranoproliferative Glomerulonephritis, X-Linked (C564423)
..expandMental Retardation, Skeletal Dysplasia, and Abducens Palsy (C564101)
..expandMental Retardation, X-Linked (D038901) Child134  LSDB C:4
..expandMental Retardation, X-Linked, Syndromic 12 (C564106)
..expandMental Retardation, X-Linked, Syndromic, Christianson Type (C567484)
..expandMental Retardation, X-Linked, Syndromic, Turner Type (C567476)
..expandMental Retardation, X-Linked, Syndromic, Zdhhc9-Related (C567586)
..expandMental Retardation, X-Linked, With Panhypopituitarism (C567485)
..expandMental Retardation, X-Linked, Znf711-Related (C567583)
..expandMicrophthalmia, Isolated, with Coloboma 1 (C564531)
..expandMicrophthalmia, syndromic 7 (C537466)
..expandMidline Defects, X-Linked (C564054)
..expandModifier, X-Linked, for Neurofunctional Defects (C564098)
..expandMultiple Pterygium Syndrome, X-Linked (C564072)
..expandMuscular Dystrophy, Duchenne (D020388) Child1
..expandMuscular Dystrophy, Emery-Dreifuss (D020389) Child10
..expandMuscular Dystrophy, Progressive Pectorodorsal (C564095)
..expandMyopathy, Reducing Body, X-Linked, Childhood-Onset (C567468)
..expandMyopathy, Reducing Body, X-Linked, Early-Onset, Severe (C567469)
..expandMyopathy, X-Linked, with Excessive Autophagy (C564093)
..expandMyopia 1 (C564091)
..expandMyopia 13 (C564473)
..expandNance-Horan syndrome (C538336)
..expandNasodigitoacoustic syndrome (C538337)
..expandNEMO mutation with immunodeficiency (C538399)
..expandNephrogenic Syndrome of Inappropriate Antidiuresis (C564491)
..expandNephrolithiasis, X-Linked Recessive, with Renal Failure (C562901)
..expandNeural tube defects X-linked (C536410)
..expandNeuropathy, Hereditary Sensory, X-Linked (C564090)
..expandNeutropenia, Severe Congenital, X-Linked (C564539)
..expandNight blindness, congenital stationary (C536122) Child4
..expandNorrie disease (C537849)
..expandNystagmus 5, Infantile Periodic Alternating (C564478)
..expandOculocerebrorenal Syndrome (D009800) Child1
..expandOphthalmoplegia, External, and Myopia (C564087)
..expandOpitz GBBB Syndrome, X-Linked (C567932)
..expandOptic atrophy, X-linked (C537125)
..expandOrnithine Carbamoyltransferase Deficiency Disease (D020163) Child1
..expandOvarian Dysgenesis 2 (C564499)
..expandPanhypopituitarism X-linked (C538613)
..expandParathyroid Glands, Agenesis Of (C563238)
..expandParkinson Disease 12 (C564486)
..expandParkinsonism, early onset with mental retardation (C537179)
..expandPelizaeus-Merzbacher Disease (D020371) Child1
..expandPhosphoglycerate Kinase 1 Deficiency (C567067)
..expandPigmentary Disorder, Reticulate, with Systemic Manifestations (C564461)
..expandPremature Ovarian Failure 2a (C564498)
..expandProgressive hearing loss stapes fixation (C536424)
..expandProperdin Deficiency, Type II (C564075)
..expandProperdin Deficiency, Type III (C564076)
..expandProperdin deficiency, X-linked (C537241)
..expandPROSTATE CANCER, HEREDITARY, X-LINKED 1 (OMIM:300147)
..expandProstate Cancer, Hereditary, X-Linked 2 (C567477)
..expandProtoporphyria, Erythropoietic, X-Linked Dominant (C567464)
..expandProud Syndrome (C563110)
..expandPtosis, Hereditary Congenital 2 (C564553)
..expandRadial Ray Deficiency, X-Linked (C564523)
..expandRadiation Sensitivity of Natural Killer Activity (C564066)
..expandRadius absent anogenital anomalies (C535281)
..expandReticuloendotheliosis, X-linked (C538362)
..expandRetinitis Pigmentosa 3 (C564520)
..expandRetinitis Pigmentosa 34 (C564475)
..expandRetinitis Pigmentosa 6 (C564065)
..expandRetinitis Pigmentosa, X-Linked, And Sinorespiratory Infections, With Or Without Deafness (C567595)
..expandRolandic Epilepsy, Mental Retardation, and Speech Dyspraxia, X-Linked (C564467)
..expandRussell-Silver Syndrome, X-Linked (C562446)
..expandShort Stature, Idiopathic, X-Linked (C564479)
..expandSimpson-Golabi-Behmel syndrome (C537340)
..expandSimpson-Golabi-Behmel Syndrome, Type 2 (C564567)
..expandSketetal dysplasia coarse facies mental retardation (C536671)
..expandSpastic paraplegia 16, X-linked (C536643)
..expandSpastic paraplegia 2, X-linked (C536857)
..expandSpastic Paraplegia 34, X-Linked (C567465)
..expandSpina Bifida, X-Linked (C564459)
..expandSpinal Muscular Atrophy, Distal, X-Linked 3 (C564506)
..expandSpinocerebellar Ataxia, X-Linked 1 (C563134)
..expandSpinocerebellar Ataxia, X-Linked 5 (C567478)
..expandSpinocerebellar ataxia, X-linked, 3 (C537315)
..expandSplit-Hand Foot Malformation 2 (C564056) Child1
..expandSpondyloepimetaphyseal Dysplasia, X-Linked (C564714)
..expandSpondylometaphyseal Dysplasia, X-Linked (C563124)
..expandSurfactant Metabolism Dysfunction, Pulmonary, 4 (C567461)
..expandTERMINAL OSSEOUS DYSPLASIA (OMIM:300244)
..expandTerminal Osseous Dysplasia and Pigmentary Defects (C564554)
..expandTesticular Germ Cell Tumor 1 (C564559)
..expandThrombocytopenia 1 (C564052)
..expandThrombocytopenia, Platelet Dysfunction, Hemolysis, and Imbalanced Globin Synthesis (C564050)
..expandThrombocytopenia, X-Linked, Intermittent (C564053)
..expandThrombocytosis, Familial X-Linked (C564532)
..expandThrombophilia, X-Linked, Due To Factor Ix Defect (C567581)
..expandThyroxine-Binding Globulin Deficiency (C564049)
..expandTooth Agenesis, Selective, X-Linked, 1 (C567060)
..expandTorticollis keloids cryptorchidism renal dysplasia (C536970)
..expandVACTERL Association With Hydrocephalus (C564751)
..expandVasquez Hurst Sotos syndrome (C536533)
..expandVesicoureteral Reflux, X-Linked (C564042)
..expandVon Willebrand Disease, X-Linked Form (C564041)
..expandWells Jankovic syndrome (C536692)
..expandWieacker syndrome (C536703)
..expandWiskott-Aldrich Syndrome (D014923) Child1
..expandX Inactivation, Familial Skewed, 1 (C564716)
..expandX Inactivation, Familial Skewed, 2 (C564572)
..expandX-Linked Chondrodysplasia Punctata 1 (C580533)
..expandX-Linked Combined Immunodeficiency Diseases (D053632) Child1
..expandX-Linked Infantile Nystagmus (C580539)
..expandX-linked sideroblastic anemia (C536761)
..expandX-linked tetra-amelia (C536497)
   

Human Disease MESH is developed by UMLS.
Further data from MedGen, OMIM,ClinVar, CTD
Term ID:6039
Name:Hypogammaglobulinemia and Isolated growth hormone deficiency, X-linked
Definition:
Alternative IDs:OMIM:307200
ParentIDs:MESH:D000361|MESH:D004393|MESH:D040181
TreeNumbers:C05.116.099.343.445/C537149 |C05.116.132.358/C537149 |C10.228.140.617.738.300.300/C537149 |C15.378.147.142/C537149 |C15.604.515.032/C537149 |C16.320.322/C537149 |C19.297.312/C537149 |C19.700.482.311/C537149 |C20.673.088/C537149
Synonyms:Agammaglobulinemia and isolated growth hormone deficiency, X-linked |Fleisher syndrome |Growth Hormone Deficiency with Hypogammaglobulinemia |GROWTH HORMONE DEFICIENCY WITH HYPOGAMMAGLOBULINEMIA, X-LINKED |HYPOGAMMAGLOBULINEMIA AND ISOLATED GROWTH HORMONE DE
Slim Mappings:Blood disease|Endocrine system disease|Genetic disease (inborn)|Immune system disease|Lymphatic disease|Musculoskeletal disease|Nervous system disease
Reference: MedGen: C537149
MeSH: C537149
OMIM: 307200;
MSeqDR LSDB:  
Genes: BTK;
Phenotypes
1 HP:0001419X-linked recessive inheritance
2 HP:0000389Chronic otitis media
3 HP:0000509Conjunctivitis
4 HP:0002750Delayed skeletal maturation
5 HP:0002014Diarrhea
6 HP:0002383Encephalitis
7 HP:0003729Enteroviral dermatomyositis syndrome
8 HP:0001412Enteroviral hepatitis
9 HP:0000031Epididymitis
10 HP:0000824Growth hormone deficiency
11 HP:0000365Hearing impairment
12 HP:0001287Meningitis
13 HP:0003139Panhypogammaglobulinemia
14 HP:0002090Pneumonia
15 HP:0000024Prostatitis
16 HP:0000999Pyoderma
17 HP:0002718Recurrent bacterial infections
18 HP:0002743Recurrent enteroviral infections
19 HP:0000010Recurrent urinary tract infections
20 HP:0003095Septic arthritis
21 HP:0004322Short stature
NAMDC:  Short stature (patient¡¯s height is below the 3rd percentile)
22 HP:0000246Sinusitis
Disease Causing ClinVar Variants
Variation_NameGeneIDGeneSymbolClinicalSignificancedbSNPRCVaccessionTestedInGTRPhenotypeIDsChromosomeStartStopHGVS_cHGVS_pHGVS_gOtherIDsDisease_ClinVar
NM_000061.3(BTK):c.*390G>A695BTKUncertain significancers782012349RCV001253982|RCV001253960; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631|MONDO:MONDO:0010421,MedGen:C0221026,OMIM:300755, Orphanet:229717, Orphanet:47X100604483100604483CTX:g.100604483C>T-
NM_000061.3(BTK):c.*342T>G695BTKUncertain significancers781937023RCV000282023|RCV000371943; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631|MONDO:MONDO:0010421,MedGen:C0221026,OMIM:300755, Orphanet:229717, Orphanet:47X100604531100604531ACX:g.100604531A>CClinGen:CA10653713C0271563 Isolated Growth Hormone Deficiency;
NM_000061.3(BTK):c.*334T>G695BTKBenignrs183674618RCV000318456|RCV000377727; NMONDO:MONDO:0010421,MedGen:C0221026,OMIM:300755, Orphanet:229717, Orphanet:47|MONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100604539100604539ACX:g.100604539A>CClinGen:CA10645814C0271563 Isolated Growth Hormone Deficiency;
NM_000061.3(BTK):c.*221G>T695BTKBenignrs1122765RCV001165567|RCV001165566; NMONDO:MONDO:0010421,MedGen:C0221026,OMIM:300755, Orphanet:229717, Orphanet:47|MONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100604652100604652CAX:g.100604652C>A-
NM_000061.3(BTK):c.*192G>A695BTKBenignrs1057403RCV000283042|RCV000342738; NMONDO:MONDO:0010421,MedGen:C0221026,OMIM:300755, Orphanet:229717, Orphanet:47|MONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100604681100604681CTX:g.100604681C>TClinGen:CA10653714
NM_000061.3(BTK):c.*116A>C695BTKBenignrs700RCV000289032|RCV000407071|RCV001597128; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631|MONDO:MONDO:0010421,MedGen:C0221026,OMIM:300755, Orphanet:229717, Orphanet:47|MedGen:CN517202X100604757100604757TGX:g.100604757T>GClinGen:CA10654228
NC_000023.10:g.(?_100604853)_(100609705_?)del695BTKPathogenic-1RCV001385261; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100604853100609705nana-1-
NM_000061.3(BTK):c.1977C>T (p.Ser659=)695BTKConflicting interpretations of pathogenicityrs782047787RCV001167164|RCV001167165; NMONDO:MONDO:0010421,MedGen:C0221026,OMIM:300755, Orphanet:229717, Orphanet:47|MONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100604876100604876GAX:g.100604876G>A-
NM_000061.3(BTK):c.1932C>G (p.Phe644Leu)695BTKUncertain significancers1926219727RCV001352189; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100604921100604921GC100604921-
NM_000061.3(BTK):c.1922G>A (p.Arg641His)695BTKPathogenicrs1926220192RCV001269826|RCV001386308; NMedGen:CN517202|MONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100604931100604931CTX:g.100604931C>T-
NM_000061.3(BTK):c.1909-9T>C695BTKConflicting interpretations of pathogenicityrs782702231RCV000175387|RCV000637057|RCV001167166; NMedGen:CN169374|MONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631|MONDO:MONDO:0010421,MedGen:C0221026,OMIM:300755, Orphanet:229717, Orphanet:47X100604953100604953AGX:g.100604953A>GClinGen:CA201434CN169374 not specified;
NM_000061.3(BTK):c.1300_1909-813del695BTKLikely pathogenic-1RCV001037029; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100605757100611821TGGCCATGGCCCATAAGCCCCCGAGGTATTTGGTATTTAGTGGTTCAGGGAACATTCATGCCAGAATGCTCTCAATCTGTTAGAACCAATGGTCATCAATTTCTTGATTCTX:g.100605757_100605855del-
NC_000023.11:g.(?_101353174)_(101358716_?)dup695BTKUncertain significance-1RCV001033543; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100608162100613704nana-1-
NC_000023.10:g.(?_100608162)_(100615763_?)del695BTKPathogenic-1RCV001385262; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100608162100615763nana-1-
NM_000061.3(BTK):c.1901G>C (p.Trp634Ser)695BTKLikely pathogenicrs1926352588RCV001057527; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100608189100608189CGX:g.100608189C>G-
NM_000061.3(BTK):c.1899C>T (p.Cys633=)695BTKBenignrs1135363RCV000254181|RCV000343690|RCV000407074; NMedGen:CN169374|MONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631|MONDO:MONDO:0010421,MedGen:C0221026,OMIM:300755, Orphanet:229717, Orphanet:47X100608191100608191GAX:g.100608191G>AClinGen:CA10472960C0271563 Isolated Growth Hormone Deficiency;
NM_000061.3(BTK):c.1868C>T (p.Ser623Leu)695BTKUncertain significancers1926354581RCV001042408; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100608222100608222GAX:g.100608222G>A-
NM_000061.3(BTK):c.1864G>C (p.Ala622Pro)695BTKUncertain significance-1RCV001368905; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100608226100608226CG100608226-
NM_000061.3(BTK):c.1844G>T (p.Arg615Leu)695BTKUncertain significancers1901797830RCV001061157; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100608246100608246CAX:g.100608246C>A-
NM_000061.3(BTK):c.1843C>T (p.Arg615Cys)695BTKUncertain significancers1603001680RCV000788744|RCV000812568; NMedGen:CN517202|MONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100608247100608247GAX:g.100608247G>A-
NM_000061.3(BTK):c.1831G>T (p.Ala611Ser)695BTKLikely benign-1RCV001474912; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100608259100608259CA100608259-
NM_000061.3(BTK):c.1800A>G (p.Arg600=)695BTKLikely benign-1RCV001405566; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100608290100608290TC100608290-
NM_000061.3(BTK):c.1789C>T (p.Pro597Ser)695BTKConflicting interpretations of pathogenicity-1RCV001367344|RCV001548637; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631|MedGen:CN517202X100608301100608301GA100608301-
NM_000061.3(BTK):c.1775C>A (p.Ser592Tyr)695BTKUncertain significancers1926358194RCV001298997; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100608315100608315GT100608315-
NM_000061.3(BTK):c.1774T>C (p.Ser592Pro)695BTKUncertain significancers1603001783RCV000819610; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100608316100608316AGX:g.100608316A>G-
NM_000061.3(BTK):c.1765G>T (p.Glu589Ter)695BTKPathogenicrs1926358858RCV001209246; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100608325100608325CAX:g.100608325C>A-
NM_000061.3(BTK):c.1763G>A (p.Trp588Ter)695BTKPathogenicrs1603001805RCV000799270|RCV000990916; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631|MONDO:MONDO:0010421,MedGen:C0221026,OMIM:300755, Orphanet:229717, Orphanet:47X100608327100608327CTX:g.100608327C>T-
NM_000061.3(BTK):c.1759A>C (p.Met587Leu)695BTKUncertain significancers1603001822RCV000810388; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100608331100608331TGX:g.100608331T>G-
NM_000061.3(BTK):c.1751G>A (p.Gly584Glu)695BTKUncertain significancers1926361058RCV001062111; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100608339100608339CTX:g.100608339C>T-
NM_000061.3(BTK):c.1751-1G>C695BTKPathogenicrs1603001846RCV000798381; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100608340100608340CGX:g.100608340C>G-
NM_000061.3(BTK):c.1750+10T>C695BTKBenign-1RCV001515038; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100608848100608848AG100608848-
NM_000061.3(BTK):c.1750+5G>A695BTKPathogenicrs864321659RCV000012100; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100608853100608853CTX:g.100608853C>TClinGen:CA341083,OMIM:300300.0004C0472813 307200 X-linked agammaglobulinemia with growth hormone deficiency;
NM_000061.3(BTK):c.1747T>G (p.Phe583Val)695BTKLikely pathogenicrs1926378381RCV001057292; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100608861100608861ACX:g.100608861A>C-
NM_000061.3(BTK):c.1743G>T (p.Trp581Cys)695BTKUncertain significancers1603002341RCV000798798; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100608865100608865CAX:g.100608865C>A-
NM_000061.3(BTK):c.1737C>T (p.Asp579=)695BTKLikely benignrs377324584RCV000978912|RCV001489322; NMedGen:CN517202|MONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100608871100608871GAX:g.100608871G>A-
NM_000061.3(BTK):c.1720T>C (p.Phe574Leu)695BTKUncertain significancers1926379592RCV001046707; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100608888100608888AGX:g.100608888A>G-
NM_000061.3(BTK):c.1713_1714dup (p.Ser572fs)695BTKPathogenicrs1603002367RCV000801871; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100608893100608894CCTAX:g.100608893_100608894insTA-
NM_000061.3(BTK):c.1701A>G (p.Glu567=)695BTKBenignrs146681416RCV000898782|RCV001702568; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631|MedGen:CN517202X100608907100608907TCX:g.100608907T>C-
NM_000061.3(BTK):c.1697C>T (p.Pro566Leu)695BTKConflicting interpretations of pathogenicityrs1057521814RCV000438550|RCV000798428; NMedGen:CN517202|MONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100608911100608911GAX:g.100608911G>AClinGen:CA16608699CN517202 not provided;
NM_000061.3(BTK):c.1697C>G (p.Pro566Arg)695BTKPathogenicrs1057521814RCV000801257; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100608911100608911GCX:g.100608911G>C-
NM_000061.3(BTK):c.1696C>T (p.Pro566Ser)695BTKLikely pathogenicrs1603002421RCV000824301; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100608912100608912GAX:g.100608912G>A-
NM_000061.3(BTK):c.1688G>A (p.Trp563Ter)695BTKPathogenicrs1555977474RCV000702940; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100608920100608920CTX:g.100608920C>T-C0472813 307200 X-linked agammaglobulinemia with growth hormone deficiency;
NM_000061.3(BTK):c.1684C>T (p.Arg562Trp)695BTKPathogenicrs128621204RCV000012136|RCV000581337|RCV000816209; NMONDO:MONDO:0010421,MedGen:C0221026,OMIM:300755, Orphanet:229717, Orphanet:47|MONDO:MONDO:0020729,MedGen:C3152144,OMIM:601495|MONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100608924100608924GAX:g.100608924G>AClinGen:CA255833,UniProtKB:Q06187#VAR_006260,OMIM:300300.0042C1832241 601495 Agammaglobulinemia, non-Bruton type;
NM_000061.3(BTK):c.1632-3C>A695BTKUncertain significancers1926384033RCV001063966; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100608979100608979GTX:g.100608979G>T-
NM_000061.3(BTK):c.1631+71C>T695BTKBenign-1RCV001553990|RCV001554073|RCV001597311; NMONDO:MONDO:0010421,MedGen:C0221026,OMIM:300755, Orphanet:229717, Orphanet:47|MONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631|MedGen:CN517202X100609547100609547GA100609547-
NM_000061.3(BTK):c.1631+5G>C695BTKLikely pathogenicrs1926404279RCV001064751; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100609613100609613CGX:g.100609613C>G-
NM_000061.3(BTK):c.1631+2T>C695BTKPathogenicrs1926404536RCV001047903; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100609616100609616AGX:g.100609616A>G-
NM_000061.3(BTK):c.1626G>T (p.Leu542=)695BTKLikely benign-1RCV001434289; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100609623100609623CA100609623-
NM_000061.3(BTK):c.1625T>C (p.Leu542Pro)695BTKConflicting interpretations of pathogenicityrs128621203RCV000012134|RCV001289856; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631|MedGen:CN235283X100609624100609624AGX:g.100609624A>GClinGen:CA121434,UniProtKB:Q06187#VAR_006257,OMIM:300300.0040C0472813 307200 X-linked agammaglobulinemia with growth hormone deficiency;
NM_000061.3(BTK):c.1606A>G (p.Lys536Glu)695BTKUncertain significancers1603003195RCV000805943; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100609643100609643TCX:g.100609643T>C-
NM_000061.3(BTK):c.1590C>T (p.Asn530=)695BTKLikely benignrs375450527RCV000908543; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100609659100609659GAX:g.100609659G>A-
NM_000061.3(BTK):c.1581_1584del (p.Cys527fs)695BTKPathogenicrs1555977592RCV000582912|RCV000637053|RCV001008113; NMONDO:MONDO:0020729,MedGen:C3152144,OMIM:601495|MONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631|MedGen:CN517202X100609665100609668CCAAACX:g.100609665_100609668delClinGen:CA658684320C1832241 601495 Agammaglobulinemia, non-Bruton type;
NM_000061.3(BTK):c.1578C>A (p.Asn526Lys)695BTKUncertain significancers1569291237RCV000700307; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100609671100609671GTX:g.100609671G>T-C0472813 307200 X-linked agammaglobulinemia with growth hormone deficiency;
NM_000061.3(BTK):c.1574G>A (p.Arg525Gln)695BTKPathogenic/Likely pathogenicrs128620183RCV000012095|RCV000581245|RCV001204367|RCV001267912; NMONDO:MONDO:0010421,MedGen:C0221026,OMIM:300755, Orphanet:229717, Orphanet:47|MONDO:MONDO:0020729,MedGen:C3152144,OMIM:601495|MONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631|MedGen:CN517202X100609675100609675CTX:g.100609675C>TClinGen:CA255784,UniProtKB:Q06187#VAR_006255,OMIM:300300.0001C1832241 601495 Agammaglobulinemia, non-Bruton type;
NM_000061.3(BTK):c.1573C>G (p.Arg525Gly)695BTKUncertain significancers886041149RCV000820887; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100609676100609676GCX:g.100609676G>C-
NM_000061.3(BTK):c.1567-2A>G695BTKPathogenicrs1555977598RCV001205797; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100609684100609684TCX:g.100609684T>C-
NM_000061.3(BTK):c.1567-12_1567-9del695BTKUncertain significancers1569291244RCV000686515|RCV001571051; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631|MedGen:CN517202X100609691100609694GCAAAGX:g.100609691_100609694del-C0472813 307200 X-linked agammaglobulinemia with growth hormone deficiency;
NM_000061.3(BTK):c.1559G>A (p.Arg520Gln)695BTKPathogenicrs128621202RCV000012131|RCV000637056; NMONDO:MONDO:0010421,MedGen:C0221026,OMIM:300755, Orphanet:229717, Orphanet:47|MONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100611047100611047CTX:g.100611047C>TClinGen:CA255831,UniProtKB:Q06187#VAR_006251,OMIM:300300.0037C0221026 300755 X-linked agammaglobulinemia;
NM_000061.3(BTK):c.1558C>T (p.Arg520Ter)695BTKPathogenicrs128621201RCV000012130|RCV000378493|RCV000582314|RCV001061773; NMONDO:MONDO:0010421,MedGen:C0221026,OMIM:300755, Orphanet:229717, Orphanet:47|MedGen:CN517202|MONDO:MONDO:0020729,MedGen:C3152144,OMIM:601495|MONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100611048100611048GAX:g.100611048G>AOMIM:300300.0036,ClinGen:CA255828C1832241 601495 Agammaglobulinemia, non-Bruton type;
NM_000061.3(BTK):c.1558C>G (p.Arg520Gly)695BTKLikely pathogenicrs128621201RCV000637052; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100611048100611048GCX:g.100611048G>CClinGen:CA413922963
NM_000061.3(BTK):c.1546C>T (p.Gln516Ter)695BTKPathogenicrs1603004481RCV000799991; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100611060100611060GAX:g.100611060G>A-
NM_000061.3(BTK):c.1526T>C (p.Met509Thr)695BTKPathogenicrs1569291644RCV000692851|RCV001784317; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631|MedGen:CN517202X100611080100611080AGX:g.100611080A>G-C0472813 307200 X-linked agammaglobulinemia with growth hormone deficiency;
NM_000061.3(BTK):c.1516T>C (p.Cys506Arg)695BTKUncertain significancers128621200RCV000012129|RCV001035091; NMONDO:MONDO:0010421,MedGen:C0221026,OMIM:300755, Orphanet:229717, Orphanet:47|MONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100611090100611090AGX:g.100611090A>GClinGen:CA255826,UniProtKB:Q06187#VAR_006247,OMIM:300300.0035C0221026 300755 X-linked agammaglobulinemia;
NM_000061.3(BTK):c.1513G>T (p.Val505Phe)695BTKLikely pathogenicrs1603004514RCV000813278; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100611093100611093CAX:g.100611093C>A-
NM_000061.3(BTK):c.1492C>G (p.Leu498Val)695BTKUncertain significancers1555977807RCV000637055; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100611114100611114GCX:g.100611114G>CClinGen:CA413923755C0472813 307200 X-linked agammaglobulinemia with growth hormone deficiency;
NM_000061.3(BTK):c.1482G>A (p.Gln494=)695BTKLikely benign-1RCV001409995; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100611124100611124CT100611124-
NM_000061.3(BTK):c.1445T>C (p.Leu482Pro)695BTKUncertain significancers1926474231RCV001342007; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100611161100611161AG100611161-
NM_000061.3(BTK):c.1442G>C (p.Cys481Ser)695BTKConflicting interpretations of pathogenicityrs1057519825RCV000430045|RCV000781188|RCV001243610|RCV001269707; NHuman Phenotype Ontology:HP:0010623,Human Phenotype Ontology:HP:0100013,MONDO:MONDO:0021100,MeSH:D001943,MedGen:C1458155|MedGen:CN169374|MONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631|MedGen:CN517202X100611164100611164CGX:g.100611164C>GClinGen:CA16602658C1458155 Neoplasm of the breast;
NM_000061.3(BTK):c.1418T>A (p.Ile473Asn)695BTKUncertain significancers1926475663RCV001035842; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100611188100611188ATX:g.100611188A>T-
NM_000061.3(BTK):c.1379T>A (p.Leu460Ter)695BTKPathogenic-1RCV001384084; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100611227100611227AT100611227-
NM_000061.3(BTK):c.1358C>T (p.Ser453Phe)695BTKUncertain significancers782457670RCV001064611; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100611248100611248GAX:g.100611248G>A-
NM_000061.3(BTK):c.1350-1G>A695BTKPathogenicrs1926477495RCV001203420; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100611257100611257CTX:g.100611257C>T-
NM_000061.3(BTK):c.1350-6C>T695BTKLikely benign-1RCV001500740; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100611262100611262GA100611262-
NM_000061.3(BTK):c.1328T>C (p.Ile443Thr)695BTKUncertain significancers782133950RCV001231977; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100611793100611793AGX:g.100611793A>G-
NM_000061.3(BTK):c.1321G>T (p.Glu441Ter)695BTKPathogenicrs1603005073RCV000813201; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100611800100611800CAX:g.100611800C>A-
NM_000061.3(BTK):c.1276G>A (p.Asp426Asn)695BTKBenign-1RCV001517354; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100611845100611845CT100611845-
NM_000061.3(BTK):c.1262G>A (p.Trp421Ter)695BTKPathogenicrs1603005139RCV000816130; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100611859100611859CTX:g.100611859C>T-
NM_000061.3(BTK):c.1252T>C (p.Tyr418His)695BTKBenign/Likely benignrs144079566RCV000914387|RCV000990917; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631|MONDO:MONDO:0010421,MedGen:C0221026,OMIM:300755, Orphanet:229717, Orphanet:47X100611869100611869AGX:g.100611869A>G-
NM_000061.3(BTK):c.1249A>T (p.Lys417Ter)695BTKPathogenicrs1926503277RCV001053798; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100611872100611872TAX:g.100611872T>A-
NM_000061.3(BTK):c.1239T>C (p.Phe413=)695BTKLikely benign-1RCV001430731; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100611882100611882AG100611882-
NM_000061.3(BTK):c.1229C>T (p.Thr410Ile)695BTKUncertain significancers1603005179RCV000818098; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100611892100611892GAX:g.100611892G>A-
NM_000061.3(BTK):c.1176C>T (p.Tyr392=)695BTKUncertain significancers782429199RCV001209751; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100612498100612498GAX:g.100612498G>A-
NM_000061.3(BTK):c.1140A>G (p.Gln380=)695BTKLikely benign-1RCV001440844; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100612534100612534TC100612534-
NM_000061.3(BTK):c.1138C>T (p.Gln380Ter)695BTKPathogenic/Likely pathogenicrs1569292021RCV000780074|RCV001055303; NMONDO:MONDO:0010421,MedGen:C0221026,OMIM:300755, Orphanet:229717, Orphanet:47|MONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100612536100612536GAX:g.100612536G>A-
NM_000061.3(BTK):c.1125T>G (p.Tyr375Ter)695BTKPathogenicrs128621197RCV000012124; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100612549100612549ACX:g.100612549A>CClinGen:CA121431,OMIM:300300.0030C0472813 307200 X-linked agammaglobulinemia with growth hormone deficiency;
NM_000061.3(BTK):c.1102G>T (p.Gly368Ter)695BTKPathogenic-1RCV001384085; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100613298100613298CA100613298-
NM_000061.3(BTK):c.1083C>T (p.Tyr361=)695BTKLikely benign-1RCV001423793; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100613317100613317GA100613317-
NM_000061.3(BTK):c.1069G>A (p.Glu357Lys)695BTKUncertain significancers1555978130RCV000546608; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100613331100613331CTX:g.100613331C>TClinGen:CA413927847
NM_000061.3(BTK):c.1039G>C (p.Ala347Pro)695BTKUncertain significancers1603006298RCV000803305; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100613361100613361CGX:g.100613361C>G-
NM_000061.3(BTK):c.980C>T (p.Pro327Leu)695BTKUncertain significancers1926556967RCV001236999; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100613420100613420GAX:g.100613420G>A-
NM_000061.3(BTK):c.954T>C (p.Ser318=)695BTKBenignrs5991926RCV000308577|RCV000528107|RCV001001739; NMONDO:MONDO:0010421,MedGen:C0221026,OMIM:300755, Orphanet:229717, Orphanet:47|MONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631|MedGen:CN235283X100613625100613625AGX:g.100613625A>GClinGen:CA10473085C0271563 Isolated Growth Hormone Deficiency;
NM_000061.3(BTK):c.941A>G (p.Lys314Arg)695BTKUncertain significancers1386621585RCV000549821; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100613638100613638TCX:g.100613638T>CClinGen:CA413929005C0472813 307200 X-linked agammaglobulinemia with growth hormone deficiency;
NM_000061.3(BTK):c.934G>C (p.Ala312Pro)695BTKUncertain significancers1926563146RCV001326510; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100613645100613645CG100613645-
NM_000061.3(BTK):c.895-37_928del695BTKPathogenicrs1926563302RCV001234551; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100613651100613721CTGGAGTCTCTGACAATGAAACCTCCTTCTTTCCCCTGAAACAACGAAAAAGAAGCTGTCTGTAGGAGGAAGCX:g.100613651_100613721del-
NM_000061.3(BTK):c.895-1G>T695BTKPathogenicrs1926563964RCV001243870; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100613685100613685CAX:g.100613685C>A-
NM_000061.3(BTK):c.895-10G>A695BTKBenign/Likely benignrs370812397RCV000314569|RCV000405337; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631|MONDO:MONDO:0010421,MedGen:C0221026,OMIM:300755, Orphanet:229717, Orphanet:47X100613694100613694CTX:g.100613694C>TClinGen:CA10473087
NM_000061.3(BTK):c.895-12T>C695BTKUncertain significancers1926564625RCV001197880; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100613696100613696AGX:g.100613696A>G-
NM_000061.3(BTK):c.884T>C (p.Leu295Pro)695BTKLikely pathogenicrs1926588125RCV001245402; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100614291100614291AGX:g.100614291A>G-
NM_000061.3(BTK):c.867T>A (p.Ser289Arg)695BTKUncertain significancers1926588297RCV001215240; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100614308100614308ATX:g.100614308A>T-
NM_000061.3(BTK):c.863G>A (p.Arg288Gln)695BTKPathogenicrs1555978277RCV000584540|RCV000657848|RCV000690161|RCV001001062|RCV001192716; NMONDO:MONDO:0020729,MedGen:C3152144,OMIM:601495|MedGen:CN517202|MONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631|MedGen:CN169374|MONDO:MONDO:0010421,MedGen:C0221026,OMIM:300755, Orphanet:229717, Orphanet:47X100614312100614312CTX:g.100614312C>TClinGen:CA413930070C1832241 601495 Agammaglobulinemia, non-Bruton type;
NM_000061.3(BTK):c.862C>T (p.Arg288Trp)695BTKPathogenic/Likely pathogenicrs128621194RCV000012119|RCV000768159|RCV001384086|RCV001701564; NMONDO:MONDO:0010421,MedGen:C0221026,OMIM:300755, Orphanet:229717, Orphanet:47|MONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631; MONDO:MONDO:0010421,MedGen:C0221026,OMIM:300755, Orphanet:229717, Orphanet:47|MONDO:MONDO:0010615,MedGen:C0472813,OMIMX100614313100614313GAX:g.100614313G>AClinGen:CA255812,UniProtKB:Q06187#VAR_006227,OMIM:300300.0025C0221026 300755 X-linked agammaglobulinemia;
NM_000061.3(BTK):c.852A>G (p.Lys284=)695BTKConflicting interpretations of pathogenicityrs1057515724RCV000260615|RCV000369368; NMONDO:MONDO:0010421,MedGen:C0221026,OMIM:300755, Orphanet:229717, Orphanet:47|MONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100614323100614323TCX:g.100614323T>CClinGen:CA10645817
NM_000061.3(BTK):c.806del (p.Val269fs)695BTKPathogenic/Likely pathogenicrs1926614700RCV001192718|RCV001244642|RCV001546212; NMONDO:MONDO:0010421,MedGen:C0221026,OMIM:300755, Orphanet:229717, Orphanet:47|MONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631|MedGen:CN517202X100615109100615109GAGX:g.100615109_100615109del-
NM_000061.3(BTK):c.777-1G>A695BTKPathogenic/Likely pathogenicrs1603007942RCV000801814|RCV001796233; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631|MONDO:MONDO:0010421,MedGen:C0221026,OMIM:300755, Orphanet:229717, Orphanet:47X100615139100615139CTX:g.100615139C>T-
NM_000061.3(BTK):c.777-2A>G695BTKLikely pathogenicrs193922129RCV000029414|RCV001055502; NMONDO:MONDO:0010421,MedGen:C0221026,OMIM:300755, Orphanet:229717, Orphanet:47|MONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100615140100615140TCX:g.100615140T>CClinGen:CA260195C0221026 300755 X-linked agammaglobulinemia;
NM_000061.3(BTK):c.776+78G>A695BTKBenign-1RCV001554074|RCV001554075|RCV001673200; NMONDO:MONDO:0010421,MedGen:C0221026,OMIM:300755, Orphanet:229717, Orphanet:47|MONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631|MedGen:CN517202X100615478100615478CT100615478-
NM_000061.3(BTK):c.763C>T (p.Arg255Ter)695BTKPathogenicrs128621193RCV000012116|RCV000583310|RCV001221640|RCV001269823; NMONDO:MONDO:0010421,MedGen:C0221026,OMIM:300755, Orphanet:229717, Orphanet:47|MONDO:MONDO:0020729,MedGen:C3152144,OMIM:601495|MONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631|MedGen:CN517202X100615569100615569GAX:g.100615569G>AClinGen:CA255809,OMIM:300300.0022C1832241 601495 Agammaglobulinemia, non-Bruton type;
NM_000061.3(BTK):c.756G>A (p.Trp252Ter)695BTKPathogenicrs1603008349RCV000799583; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100615576100615576CTX:g.100615576C>T-
NM_000061.3(BTK):c.736G>C (p.Glu246Gln)695BTKUncertain significancers1468544899RCV000694949; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100615596100615596CGX:g.100615596C>G-
NM_000061.3(BTK):c.720A>C (p.Glu240Asp)695BTKUncertain significancers141590686RCV000534777; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100615612100615612TGX:g.100615612T>GClinGen:CA10473130
NM_000061.3(BTK):c.707G>A (p.Arg236Gln)695BTKUncertain significancers147036606RCV000556448; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100615625100615625CTX:g.100615625C>TClinGen:CA10473132
NM_000061.3(BTK):c.680del (p.Pro227fs)695BTKPathogenicrs1603008449RCV000806263; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100615652100615652TGTX:g.100615652_100615652del-
NM_000061.3(BTK):c.615G>T (p.Glu205Asp)695BTKBenign/Likely benignrs35877704RCV000308563|RCV000356123|RCV000515112|RCV001085757; NMedGen:CN169374|MONDO:MONDO:0010421,MedGen:C0221026,OMIM:300755, Orphanet:229717, Orphanet:47|MedGen:CN517202|MONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100615717100615717CAX:g.100615717C>AClinGen:CA10473139C0271563 Isolated Growth Hormone Deficiency;
NM_000061.3(BTK):c.609G>A (p.Pro203=)695BTKLikely benign-1RCV001399091; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100615723100615723CT100615723-
NC_000023.11:g.(?_101362153)_(101362709_?)dup695BTKPathogenic-1RCV001032734; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100617141100617697nana-1-
NM_000061.3(BTK):c.588+1G>T695BTKPathogenic/Likely pathogenicrs1569293252RCV000780071|RCV001039149; NMONDO:MONDO:0010421,MedGen:C0221026,OMIM:300755, Orphanet:229717, Orphanet:47|MONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100617160100617160CAX:g.100617160C>A-
NM_000061.3(BTK):c.580G>A (p.Glu194Lys)695BTKUncertain significancers1555978779RCV000696204; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100617169100617169CTX:g.100617169C>T-C0472813 307200 X-linked agammaglobulinemia with growth hormone deficiency;
NM_000061.3(BTK):c.577G>C (p.Glu193Gln)695BTKUncertain significancers1555978783RCV000823320; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100617172100617172CGX:g.100617172C>G-
NM_000061.3(BTK):c.573G>A (p.Thr191=)695BTKLikely benignrs146707427RCV000935649|RCV001411346; NMedGen:CN517202|MONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100617176100617176CTX:g.100617176C>T-
NM_000061.3(BTK):c.564del (p.Pro190fs)695BTKPathogenicrs1603009890RCV000824441; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100617185100617185GAGX:g.100617185_100617185del-
NM_000061.3(BTK):c.557dup (p.Pro187fs)695BTKPathogenicrs864321665RCV000012111|RCV000691136; NMONDO:MONDO:0010421,MedGen:C0221026,OMIM:300755, Orphanet:229717, Orphanet:47|MONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100617191100617192CCTX:g.100617191_100617192insTClinGen:CA341089,OMIM:300300.0017C0221026 300755 X-linked agammaglobulinemia;
NM_000061.3(BTK):c.531T>C (p.Pro177=)695BTKBenign/Likely benignrs148358153RCV000637054|RCV001797768; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631|MedGen:CN169374X100617218100617218AGX:g.100617218A>GClinGen:CA10473155
NM_000061.3(BTK):c.521-1G>A695BTKLikely pathogenicrs1926696248RCV001210457; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100617229100617229CTX:g.100617229C>T-
NM_000061.3(BTK):c.520+15C>T695BTKConflicting interpretations of pathogenicityrs782697907RCV000265905|RCV000320999; NMONDO:MONDO:0010421,MedGen:C0221026,OMIM:300755, Orphanet:229717, Orphanet:47|MONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100617534100617534GAX:g.100617534G>AClinGen:CA10473165
NM_000061.3(BTK):c.520+1G>A695BTKPathogenic-1RCV001389175; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100617548100617548CT100617548-
NM_000061.3(BTK):c.496C>T (p.Gln166Ter)695BTKPathogenicrs1926708861RCV001230353; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100617573100617573GAX:g.100617573G>A-
NM_000061.3(BTK):c.493T>C (p.Cys165Arg)695BTKUncertain significancers1603010344RCV000798950; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100617576100617576AGX:g.100617576A>G-
NM_000061.3(BTK):c.472_475del (p.Thr158fs)695BTKPathogenicrs193922128RCV000029413|RCV000698891; NMONDO:MONDO:0010421,MedGen:C0221026,OMIM:300755, Orphanet:229717, Orphanet:47|MONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100617594100617597GCTGTGX:g.100617594_100617597delClinGen:CA260194C0221026 300755 X-linked agammaglobulinemia;
NM_000061.3(BTK):c.465C>A (p.Cys155Ter)695BTKPathogenicrs1926710166RCV001212558; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100617604100617604GTX:g.100617604G>T-
NM_000061.3(BTK):c.441del (p.Phe146_Trp147insTer)695BTKPathogenicrs1926711302RCV001046699; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100617628100617628TCTX:g.100617628_100617628del-
NM_000061.3(BTK):c.390C>T (p.Asn130=)695BTKUncertain significancers150917517RCV000694646; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100624987100624987GAX:g.100624987G>A-
NM_000061.3(BTK):c.367C>T (p.Arg123Trp)695BTKUncertain significancers1926975244RCV001307025; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100625010100625010GA100625010-
NM_000061.3(BTK):c.363G>A (p.Arg121=)695BTKLikely benignrs781811193RCV000978084|RCV001395441; NMedGen:CN517202|MONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100625014100625014CTX:g.100625014C>T-
NM_000061.3(BTK):c.345C>T (p.Ser115=)695BTKBenignrs782476406RCV000893433; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100625032100625032GAX:g.100625032G>A-
NM_000061.3(BTK):c.336C>G (p.Tyr112Ter)695BTKPathogenicrs1409835623RCV001211890; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100625041100625041GCX:g.100625041G>C-
NM_000061.3(BTK):c.334T>C (p.Tyr112His)695BTKUncertain significancers1926977049RCV001041939; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100625043100625043AGX:g.100625043A>G-
NM_000061.3(BTK):c.319G>T (p.Asp107Tyr)695BTKUncertain significancers1926977202RCV001218381; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100625058100625058CAX:g.100625058C>A-
NM_000061.3(BTK):c.278C>A (p.Ser93Ter)695BTKPathogenicrs1569295678RCV000703916; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100626652100626652GTX:g.100626652G>T-
NM_000061.3(BTK):c.270del (p.Glu90fs)695BTKPathogenicrs1603017538RCV000795926; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100626660100626660GCGX:g.100626660_100626660del-
NM_000061.3(BTK):c.241-1G>C695BTKPathogenic-1RCV001391023; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100626690100626690CG100626690-
NM_000061.3(BTK):c.241-5T>C695BTKLikely benign-1RCV001414223; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100626694100626694AG100626694-
NM_000061.3(BTK):c.240+7A>C695BTKBenignrs782299012RCV000637058; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100629517100629517TGX:g.100629517T>GClinGen:CA10473221
NM_000061.3(BTK):c.232C>T (p.Gln78Ter)695BTKPathogenicrs1603019535RCV000814965; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100629532100629532GAX:g.100629532G>A-
NM_000061.3(BTK):c.215dup (p.Asn72fs)695BTKPathogenicrs886041148RCV000317789|RCV000811748|RCV000781189; NMedGen:CN517202|MONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631|MONDO:MONDO:0010421,MedGen:C0221026,OMIM:300755, Orphanet:229717, Orphanet:47X100629548100629549AATX:g.100629548_100629549insTClinGen:CA10603700
NM_000061.3(BTK):c.216T>G (p.Asn72Lys)695BTKUncertain significancers1555980789RCV001203879; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100629548100629548ACX:g.100629548A>C-
NM_000061.3(BTK):c.189T>C (p.Cys63=)695BTKLikely benign-1RCV001448571; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100629575100629575AG100629575-
NM_000061.3(BTK):c.176AGA[1] (p.Lys60del)695BTKPathogenicrs1603019594RCV000780070|RCV000810868; NMONDO:MONDO:0010421,MedGen:C0221026,OMIM:300755, Orphanet:229717, Orphanet:47|MONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100629583100629585ATCTAX:g.100629583_100629585del-
NM_000061.3(BTK):c.167T>C (p.Ile56Thr)695BTKUncertain significancers1927146374RCV001235566; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100629597100629597AGX:g.100629597A>G-
NM_000061.3(BTK):c.163T>C (p.Ser55Pro)695BTKUncertain significancers1603019607RCV000809057; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100629601100629601AGX:g.100629601A>G-
NM_000061.3(BTK):c.141+11C>T695BTKConflicting interpretations of pathogenicityrs138411530RCV000224614|RCV000445094|RCV000266994|RCV000380244|RCV000660378; NMedGen:CN517202|MedGen:CN169374|MONDO:MONDO:0010421,MedGen:C0221026,OMIM:300755, Orphanet:229717, Orphanet:47|MONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631|MONDO:MONDO:0010421,MedGen:C0221026,OMIM:300755, Orphanet:229717, Orphanet:47; MONDO:MOX100630121100630121GAX:g.100630121G>AClinGen:CA10473231C0271563 Isolated Growth Hormone Deficiency;
NM_000061.3(BTK):c.134_139del (p.Glu45_Arg46del)695BTKLikely pathogenicrs1927166327RCV001334183; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100630134100630139CCACGTTC100630133-
NM_000061.3(BTK):c.119A>G (p.Tyr40Cys)695BTKPathogenicrs1555980875RCV000521066|RCV000707368; NMedGen:CN517202|MONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100630154100630154TCX:g.100630154T>CClinGen:CA413939330CN517202 not provided;
NM_000061.3(BTK):c.100G>A (p.Val34Met)695BTKUncertain significancers141488935RCV001169612|RCV001169613; NMONDO:MONDO:0010421,MedGen:C0221026,OMIM:300755, Orphanet:229717, Orphanet:47|MONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100630173100630173CTX:g.100630173C>T-
NM_000061.3(BTK):c.83G>A (p.Arg28His)695BTKPathogenicrs128620185RCV000012101|RCV000427660|RCV000583846|RCV000819061; NMONDO:MONDO:0010421,MedGen:C0221026,OMIM:300755, Orphanet:229717, Orphanet:47|MedGen:CN517202|MONDO:MONDO:0020729,MedGen:C3152144,OMIM:601495|MONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100630190100630190CTX:g.100630190C>TOMIM:300300.0005,ClinGen:CA255794,UniProtKB:Q06187#VAR_006220C1832241 601495 Agammaglobulinemia, non-Bruton type;
NM_000061.3(BTK):c.83G>T (p.Arg28Leu)695BTKPathogenic-1RCV001389176; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100630190100630190CA100630190-
NM_000061.3(BTK):c.82C>T (p.Arg28Cys)695BTKPathogenicrs1927168815RCV001217971; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100630191100630191GAX:g.100630191G>A-
NM_000061.3(BTK):c.77A>G (p.Lys26Arg)695BTKUncertain significance-1RCV001374321; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100630196100630196TC100630196-
NM_000061.3(BTK):c.62C>A (p.Ser21Ter)695BTKPathogenic-1RCV001381525; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100630211100630211GT100630211-
NM_000061.3(BTK):c.41C>T (p.Ser14Phe)695BTKUncertain significancers1057520682RCV000795113; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100630232100630232GAX:g.100630232G>A-
NM_000061.3(BTK):c.32T>C (p.Leu11Pro)695BTKUncertain significancers1603020228RCV000806755; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100630241100630241AGX:g.100630241A>G-
NM_000061.3(BTK):c.6C>T (p.Ala2=)695BTKLikely benign-1RCV001491074; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100630267100630267GA100630267-
NM_000061.3(BTK):c.3G>A (p.Met1Ile)695BTKPathogenicrs1927172387RCV001070338; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100630270100630270CTX:g.100630270C>T-
NM_000061.3(BTK):c.-31+1G>A695BTKUncertain significancers1927600989RCV001212868; NMONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100641049100641049CTX:g.100641049C>T-
NM_000061.3(BTK):c.-87C>T695BTKUncertain significancers1927601892RCV001169614|RCV001169615; NMONDO:MONDO:0010421,MedGen:C0221026,OMIM:300755, Orphanet:229717, Orphanet:47|MONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100641106100641106GAX:g.100641106G>A-
NM_000061.3(BTK):c.-105G>T695BTKUncertain significancers1034801451RCV000326670|RCV000381316; NMONDO:MONDO:0010421,MedGen:C0221026,OMIM:300755, Orphanet:229717, Orphanet:47|MONDO:MONDO:0010615,MedGen:C0472813,OMIM:307200, Orphanet:631X100641124100641124CAX:g.100641124C>AClinGen:CA10653716
MSeqDR Portal