MSeqDR Mitochondrial Disease Portal


 
*:HP: HPO terms, UMDF: 1= Disease, ND: NAMDC terms.
  Most Studied  CPEO, Complex I Deficiency, COXPD1, Leigh, LHON, MELAS, MERRF, Myopathy, SANDO
Disease Browser
Parent Node:
expand
Corneal Dystrophies, Hereditary (D003317)
..Starting node
..expand
Corneal Dystrophy, Posterior Polymorphous, 1 (C562745)

       Child Nodes:



 Sister Nodes: 
..expandBietti Crystalline Dystrophy (C535440)
..expandBrachymesomelia renal syndrome (C537096)
..expandChorioretinal atrophy, progressive bifocal (C535356)
..expandCongenital Corneal Opacities, Cornea Guttata, and Corectopia (C563921)
..expandCorneal cerebellar syndrome (C535472)
..expandCorneal Degeneration, Ribbonlike, with Deafness (C565157)
..expandCorneal dystrophy and perceptive deafness (C535473)
..expandCorneal dystrophy Avellino type (C535474)
..expandCorneal dystrophy of Bowman layer, type 1 (C535476)
..expandCorneal Dystrophy, Band-Shaped (C562399)
..expandCorneal Dystrophy, Central Type (C563262)
..expandCorneal Dystrophy, Congenital Stromal (C566452)
..expandCorneal Dystrophy, Crystalline, of Schnyder (C535475)
..expandCorneal Dystrophy, Endothelial, X-Linked (C567587)
..expandCorneal Dystrophy, Fleck (C563256)
..expandCorneal dystrophy, gelatinous drop-like (C535480)
..expandCorneal Dystrophy, Juvenile Epithelial of Meesmann (D053559)
..expandCorneal Dystrophy, Lattice Type IIIA (C563923)
..expandCorneal Dystrophy, Lisch Epithelial (C567588)
..expandCorneal Dystrophy, Posterior Amorphous (C567546)
..expandCorneal Dystrophy, Posterior Polymorphous, 1 (C562745)
..expandCorneal Dystrophy, Posterior Polymorphous, 2 (C565176)
..expandCorneal Dystrophy, Posterior Polymorphous, 3 (C563788)
..expandCorneal Dystrophy, Subepithelial Mucinous (C567547)
..expandCorneal dystrophy, Thiel-Behnke type (C535942)
..expandCorneal Endothelial Dystrophy 1 (C565156)
..expandCorneal endothelial dystrophy type 2 (C536439)
..expandCorneodermatoosseous syndrome (C536444)
..expandDermochondrocorneal dystrophy of FrančŽ½ois (C535375)
..expandEDICT SYNDROME (OMIM:614303)
..expandEndothelial Dystrophy, Congenital Hereditary, with Nail Hypoplasia (C565591)
..expandEpithelial Recurrent Erosion Dystrophy (C565155)
..expandFuchs' Endothelial Dystrophy (D005642) Child10
..expandGroenouw type I corneal dystrophy (C537304)
..expandIchthyosiform erythroderma, corneal involvement, deafness (C537363)
..expandJudge Misch Wright syndrome (C537692)
..expandKuster Majewski Hammerstein syndrome (C538125)
..expandLattice corneal dystrophy type 1 (C537881)
..expandMacular Corneal Dystrophy, Type II (C563270)
..expandMacular dystrophy, corneal type 1 (C537834)
..expandMacular Dystrophy, Fenestrated Sheen Type (C563607)
..expandMacular dystrophy, retinal, 1, North Carolina type (C537835)
..expandMacular Dystrophy, Retinal, 2 (C562746)
..expandMeretoja syndrome (C537459)
..expandMICROCORNEA, MYOPIC CHORIORETINAL ATROPHY, AND TELECANTHUS (OMIM:615458)
..expandMousa Al din Al Nassar syndrome (C536989)
..expandO'Donnell Pappas syndrome (C537858)
..expandOculodental syndrome Rutherfurd syndrome (C537732)
..expandPseudoinflammatory fundus dystrophy, Finnish type (C535828)
..expandSammartino De Crecchio Syndrome (C537229)
..expandSpondyloepiphyseal Dysplasia With Punctate Corneal Dystrophy (C566660)
..expandSveinsson Chorioretinal Atrophy (C566236)
   

Human Disease MESH is developed by UMLS.
Further data from MedGen, OMIM,ClinVar, CTD
Term ID:3030
Name:Corneal Dystrophy, Posterior Polymorphous, 1
Definition:
Alternative IDs:DO:DOID:0060457|OMIM:122000
ParentIDs:MESH:D003317
TreeNumbers:C11.204.236/C562745 |C11.270.162/C562745 |C16.320.290.162/C562745
Synonyms:CHED1, FORMERLY |Corneal Dystrophy, Hereditary Polymorphous Posterior |CORNEAL ENDOTHELIAL DYSTROPHY 1, AUTOSOMAL DOMINANT, FORMERLY |MAUMENEE CORNEAL DYSTROPHY |Posterior Polymorphous Corneal Dystrophy |PPCD |PPCD1
Slim Mappings:Eye disease|Genetic disease (inborn)
Reference: MedGen: C562745
MeSH: C562745
OMIM: 122000;
MSeqDR LSDB:  
Genes: VSX1;
Phenotypes
1 HP:0000006Autosomal dominant inheritance
2 HP:0011483Anterior synechiae of the anterior chamber
3 HP:0000585Band keratopathy
4 HP:0009918Ectopia pupillaeHP:0040283
5 HP:0009926Epiphora
6 HP:0000501Glaucoma
7 HP:0001089Iris atrophyHP:0040283
8 HP:0000613Photophobia
9 HP:0007915Polymorphous posterior corneal dystrophy
10 HP:0031159Thinning of Descemet membraneHP:0040283
11 HP:0025358Uveal ectropion
Disease Causing ClinVar Variants
Variation_NameGeneIDGeneSymbolClinicalSignificancedbSNPRCVaccessionTestedInGTRPhenotypeIDsChromosomeStartStopHGVS_cHGVS_pHGVS_gOtherIDsDisease_ClinVar
NM_021220.4(OVOL2):c.-274T>G58495OVOL2Pathogenicrs869320630RCV000210412; NGene:8197,MONDO:MONDO:0007378,MedGen:C1852555,OMIM:122000, Orphanet:98973201803855218038552AC20:g.18038552A>COMIM:616441.0004,ClinGen:CA358740
NM_001303461.1(OVOL2):c.-297+949T>C58495OVOL2Pathogenicrs869320629RCV000210427; NGene:8197,MONDO:MONDO:0007378,MedGen:C1852555,OMIM:122000, Orphanet:98973201803858518038585AG20:g.18038585A>GClinGen:CA358742,OMIM:616441.0003CN029625 122000 Posterior polymorphous corneal dystrophy 1;
NM_001303461.1(OVOL2):c.-297+895_-297+916dup58495OVOL2Pathogenicrs869320627RCV000210432; NGene:8197,MONDO:MONDO:0007378,MedGen:C1852555,OMIM:122000, Orphanet:98973201803861718038618AACCGGTTCCGGCGGCCGGGGCTG20:g.18038617_18038618insCCGGTTCCGGCGGCCGGGGCTGClinGen:CA358743,OMIM:616441.0001CN029625 122000 Posterior polymorphous corneal dystrophy 1;
NM_001303461.1(OVOL2):c.-297+886T>C58495OVOL2Pathogenicrs869320628RCV000210419; NGene:8197,MONDO:MONDO:0007378,MedGen:C1852555,OMIM:122000, Orphanet:98973201803864818038648AG20:g.18038648A>GOMIM:616441.0002,ClinGen:CA358741
NM_001174089.2(SLC4A11):c.2496G>A (p.Met832Ile)83959SLC4A11Conflicting interpretations of pathogenicityrs34224785RCV000948021|RCV000991066|RCV001143497|RCV001276999; NMedGen:CN517202|Gene:8197,MONDO:MONDO:0007378,MedGen:C1852555,OMIM:122000, Orphanet:98973|Human Phenotype Ontology:HP:0001131,Human Phenotype Ontology:HP:0007775,MONDO:MONDO:0018102,MedGen:C0010036, Orphanet:34533|MONDO:MONDO:0009015,MedGen:C1857572,OMIM:2032089673208967CT20:g.3208967C>T-
NM_014588.5(VSX1):c.479G>A (p.Gly160Asp)30813VSX1Conflicting interpretations of pathogenicityrs74315433RCV000005560|RCV000358879|RCV000454465; NGene:8197,MONDO:MONDO:0007378,MedGen:C1852555,OMIM:122000, Orphanet:98973|Human Phenotype Ontology:HP:0007915,MONDO:MONDO:0020364,MedGen:C0339284,OMIM:PS122000, Orphanet:98973|MedGen:CN169374202506009625060096CT20:g.25060096C>TClinGen:CA117355,UniProtKB:Q9NZR4#VAR_014245,OMIM:605020.0002CN169374 not specified;
MSeqDR Portal