MSeqDR Mitochondrial Disease Portal


 
*:HP: HPO terms, UMDF: 1= Disease, ND: NAMDC terms.
  Most Studied  CPEO, Complex I Deficiency, COXPD1, Leigh, LHON, MELAS, MERRF, Myopathy, SANDO
Term ID:3593
Name:De Sanctis-Cacchione syndrome
Definition:
Alternative IDs:OMIM:278800
ParentIDs:MESH:D004392|MESH:D007006|MESH:D008607|MESH:D014983
TreeNumbers:C04.834.867/C535992 |C05.116.099.343/C535992 |C10.597.606.360/C535992 |C16.131.831.936/C535992 |C16.320.240/C535992 |C16.320.850.970/C535992 |C17.800.600.925/C535992 |C17.800.621.936/C535992 |C17.800.804.936/C535992 |C17.800.827.970/C535992 |C18.452.284.975/C53599
Synonyms:Desanctis-Cacchione Syndrome |Xeroderma pigmentosum, mental deficiency, dwarfism, and gonadal hypoplasia |Xerodermic idiocy of de Sanctis and Cacchione
Slim Mappings:Cancer|Congenital abnormality|Endocrine system disease|Genetic disease (inborn)|Mental disorder|Metabolic disease|Musculoskeletal disease|Nervous system disease|Signs and symptoms|Skin disease
Reference: MedGen: C535992
MeSH: C535992
OMIM: 278800;
MSeqDR LSDB:  
Genes: ERCC6;
Phenotypes
1 HP:0000007Autosomal recessive inheritance
2 HP:0001284Areflexia
3 HP:0001251Ataxia
4 HP:0001272Cerebellar atrophy
5 HP:0001266Choreoathetosis
6 HP:0000509Conjunctivitis
7 HP:0000992Cutaneous photosensitivity
8 HP:0003079Defective DNA repair after ultraviolet radiation damage
9 HP:0004334Dermal atrophy
10 HP:0000656Ectropion
11 HP:0000621Entropion
12 HP:0008639Gonadal hypoplasia
13 HP:0001265Hyporeflexia
14 HP:0001249Intellectual disability
15 HP:0000491Keratitis
16 HP:0001268Mental deterioration
17 HP:0000252Microcephaly
18 HP:0002542Olivopontocerebellar atrophy
19 HP:0000613Photophobia
20 HP:0001029Poikiloderma
21 HP:0000407Sensorineural hearing impairment
NAMDC:  Sensorineural hearing loss
22 HP:0003510Severe short stature
23 HP:0001257Spasticity
NAMDC:  Spasticity
24 HP:0001009Telangiectasia
Disease Causing ClinVar Variants
Variation_NameGeneIDGeneSymbolClinicalSignificancedbSNPRCVaccessionTestedInGTRPhenotypeIDsChromosomeStartStopHGVS_cHGVS_pHGVS_gOtherIDsDisease_ClinVar
NM_000124.4(ERCC6):c.4399C>T (p.Arg1467Ter)2074ERCC6Likely pathogenicrs762976316RCV000669820; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105066694450666944GA10:g.50666944G>A-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.4382C>G (p.Ser1461Ter)2074ERCC6Uncertain significancers1554873743RCV000665498; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105066696150666961GC10:g.50666961G>C-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.4223A>C (p.Glu1408Ala)2074ERCC6Conflicting interpretations of pathogenicityrs61760167RCV000298443|RCV000352090|RCV000397993|RCV000592732|RCV000865073|RCV000988351; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569105066712050667120TG10:g.50667120T>GClinGen:CA5495149CN239231 Cerebrooculofacioskeletal Syndrome;
NM_000124.4(ERCC6):c.4186A>G (p.Arg1396Gly)2074ERCC6Uncertain significancers745352643RCV000170392|RCV000665525|RCV000763653; NMedGen:CN169374|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|7 conditions105066715750667157TC10:g.50667157T>CClinGen:CA199600
NM_000124.4(ERCC6):c.4063-1G>C2074ERCC6Pathogenic/Likely pathogenicrs766980240RCV000664549|RCV000994388|RCV001528150; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MedGen:CN517202|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105066728150667281CG10:g.50667281C>G-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.4063-5T>C2074ERCC6Conflicting interpretations of pathogenicityrs186482480RCV000988352|RCV001443933; NMONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569|MedGen:CN517202105066728550667285AG10:g.50667285A>G-
NM_000124.4(ERCC6):c.4062+2T>A2074ERCC6Likely pathogenicrs1554873950RCV000672776; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105066841750668417AT10:g.50668417A>T-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.3984-2A>G2074ERCC6Likely pathogenicrs1554873973RCV000670109; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105066849950668499TC10:g.50668499T>C-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.3957del (p.Ile1320fs)2074ERCC6Likely pathogenicrs1554874073RCV000674136; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105066942450669424TCT10:g.50669424_50669424del-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.3952_3953del (p.Arg1318fs)2074ERCC6Pathogenic/Likely pathogenicrs765825423RCV000170390|RCV000666483|RCV001231998; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN517202105066942850669429CCTC10:g.50669428_50669429delClinGen:CA274713C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.3914_3925del (p.Leu1305_Ser1309delinsPro)2074ERCC6Uncertain significancers1554874085RCV000674820; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105066945650669467GACACTGCTCCCAG10:g.50669456_50669467del-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.3871dup (p.Gln1291fs)2074ERCC6Pathogenic/Likely pathogenicrs1386369933RCV000666791|RCV001386579; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MedGen:CN517202105066950950669510TTG10:g.50669509_50669510insG-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.3862C>T (p.Arg1288Ter)2074ERCC6Pathogenicrs185142838RCV000024284|RCV000622864|RCV000671085|RCV000733375|RCV000784896; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MeSH:D030342,MedGen:C0950123|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569|MedGe105066951950669519GA10:g.50669519G>AClinGen:CA129817,OMIM:609413.0015
NM_000124.4(ERCC6):c.3778+1G>C2074ERCC6Likely pathogenicrs1554875114RCV000671515; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105067822750678227CG10:g.50678227C>G-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.3634T>A (p.Cys1212Ser)2074ERCC6Uncertain significancers886042655RCV000260044|RCV000664624; NMedGen:CN517202|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569105067837250678372AT10:g.50678372A>TClinGen:CA10604527C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.3627dup (p.Lys1210Ter)2074ERCC6Pathogenic/Likely pathogenicrs1554875154RCV000670522|RCV001382561; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MedGen:CN517202105067837850678379TTA10:g.50678378_50678379insA-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.3614del (p.Lys1205fs)2074ERCC6Likely pathogenicrs1554875155RCV000674969; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105067839250678392CTC10:g.50678392_50678392del-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.3607_3608insGGGCTGGCTGCTTAAGGTCCACCTTA (p.Lys1203fs)2074ERCC6Pathogenic/Likely pathogenicrs786205172RCV000170387|RCV000671320|RCV001092478; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN517202105067839850678399TTTAAGGTGGACCTTAAGCAGCCAGCCC10:g.50678398_50678399insTAAGGTGGACCTTAAGCAGCCAGCCCClinGen:CA274708C0751038 133540 Cockayne syndrome B;
NM_000124.4(ERCC6):c.3591_3592dup (p.Lys1198fs)2074ERCC6Pathogenic/Likely pathogenicrs1287286877RCV000674275|RCV001386142; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN517202105067841350678414TTTC10:g.50678413_50678414insTC-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.3573AGA[2] (p.Glu1194del)2074ERCC6Uncertain significancers1248870490RCV000669145; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105067842550678427CTCTC10:g.50678425_50678427del-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.3536del (p.Tyr1179fs)2074ERCC6Pathogenic/Likely pathogenicrs786205171RCV000170386|RCV000224382|RCV000666242; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN517202|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105067847050678470ATA10:g.50678470_50678470delClinGen:CA274707
NM_000124.4(ERCC6):c.3445G>T (p.Glu1149Ter)2074ERCC6Pathogenicrs1250248245RCV000988353; NMONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569105067856150678561CA10:g.50678561C>A-
NM_000124.4(ERCC6):c.3435_3437dup (p.Ser1146_Ile1147insArg)2074ERCC6Uncertain significancers1435512927RCV000668999; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105067856850678569GGCTT10:g.50678568_50678569insCTT-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.3412dup (p.Thr1138fs)2074ERCC6Pathogenic/Likely pathogenicrs786205170RCV000170385|RCV000668548; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105067859350678594GGT10:g.50678593_50678594insTClinGen:CA274706C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.3284C>G (p.Pro1095Arg)2074ERCC6Conflicting interpretations of pathogenicityrs4253208RCV000001776|RCV000170384|RCV000291488|RCV000345279|RCV000224059|RCV000988354; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN169374|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MedGen:CN517202|MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569105067872250678722GC10:g.50678722G>CClinGen:CA199597,UniProtKB:Q03468#VAR_001222,OMIM:609413.0008CN239231 Cerebrooculofacioskeletal Syndrome;
NM_000124.4(ERCC6):c.3111AAG[1] (p.Arg1039del)2074ERCC6Uncertain significancers1342267719RCV000672557; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105067889050678892CCTTC10:g.50678890_50678892del-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.3113_3114del (p.Arg1038fs)2074ERCC6Likely pathogenicrs1850765501RCV001030756; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105067889250678893TTCT10:g.50678892_50678893del-
NM_000124.4(ERCC6):c.3071-1G>A2074ERCC6Likely pathogenicrs1554875287RCV000666961; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105067893650678936CT10:g.50678936C>T-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.2839C>T (p.Arg947Ter)2074ERCC6Pathogenic/Likely pathogenicrs906755254RCV000592438|RCV000674384; NMedGen:CN517202|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569105068050750680507GA10:g.50680507G>AClinGen:CA206586242C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.2830-2A>G2074ERCC6Pathogenicrs373227647RCV000170381|RCV000397640|RCV000762809|RCV000984002; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN517202|7 conditions|MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569105068051850680518TC10:g.50680518T>CClinGen:CA274705C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.2829+1G>A2074ERCC6Likely pathogenicrs1554875522RCV000669221; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105068095450680954CT10:g.50680954C>T-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.2599-26A>G2074ERCC6Conflicting interpretations of pathogenicityrs4253196RCV000170380|RCV000666576|RCV001236817; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN517202105068165950681659TC10:g.50681659T>CClinGen:CA274704
NM_000124.4(ERCC6):c.2569C>T (p.Arg857Ter)2074ERCC6Pathogenicrs751448793RCV000668815|RCV001057555; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MedGen:CN517202105068210250682102GA10:g.50682102G>A-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.2560C>T (p.Gln854Ter)2074ERCC6Pathogenicrs1554787509RCV000673909; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105068211150682111GA10:g.50682111G>A-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.2551T>C (p.Trp851Arg)2074ERCC6Conflicting interpretations of pathogenicityrs368728467RCV000195010|RCV000675120|RCV001063571; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN517202105068212050682120AG10:g.50682120A>GClinGen:CA277416,UniProtKB:Q03468#VAR_001219C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.2383-1G>A2074ERCC6Likely pathogenicrs1554787554RCV000674266; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105068228950682289CT10:g.50682289C>T-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.2382+33T>C2074ERCC6Benign-1RCV001613875|RCV001658322|RCV001658321|RCV001658319|RCV001658320; NMedGen:CN517202|MONDO:MONDO:0010909,MedGen:C3551173,OMIM:600630, Orphanet:178338|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569105068422850684228AG50684228-
NM_000124.4(ERCC6):c.2287-2A>G2074ERCC6Likely pathogenicrs754978734RCV000666417; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105068435850684358TC10:g.50684358T>C-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.2286+1G>A2074ERCC6Likely pathogenicrs1362935450RCV000665459; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105068639950686399CT10:g.50686399C>T-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.2203C>T (p.Arg735Ter)2074ERCC6Pathogenicrs121917901RCV000001770|RCV000001769|RCV000406377|RCV000521977|RCV000762810|RCV001199022|RCV001287467; NMONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN239385|MedGen:CN517202|7 conditions|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MedGen:CN235283105068648350686483GA10:g.50686483G>AClinGen:CA115152,OMIM:609413.0002C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.2169+1G>A2074ERCC6Likely pathogenicrs1441655600RCV000670497; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105069073250690732CT10:g.50690732C>T-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.2167C>T (p.Gln723Ter)2074ERCC6Pathogenicrs151242354RCV000170378|RCV000256036|RCV000778283|RCV000983999; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN517202|MedGen:CN239385|MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569105069073550690735GA10:g.50690735G>AClinGen:CA274701C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.2096dup (p.Leu700fs)2074ERCC6Pathogenic/Likely pathogenicrs774791374RCV000170377|RCV000668158|RCV001046396; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN517202105069080550690806CCG10:g.50690805_50690806insGClinGen:CA274700
NM_000124.4(ERCC6):c.2073_2074insCCGCTCTTTGACTTC (p.Ile692_Phe693insProLeuPheAspPhe)2074ERCC6Uncertain significancers1554788383RCV000674068; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105069082850690829TTGAAGTCAAAGAGCGG10:g.50690828_50690829insGAAGTCAAAGAGCGG-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.2060C>T (p.Ser687Leu)2074ERCC6Uncertain significancers1026438103RCV000667893|RCV001255758; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105069084250690842GA10:g.50690842G>A-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.2047C>T (p.Arg683Ter)2074ERCC6Pathogenic/Likely pathogenicrs121917904RCV000001781|RCV000333649|RCV000983998|RCV001236985; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MedGen:CN239385|MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569|MedGen:CN517202105069085550690855GA10:g.50690855G>AClinGen:CA115159,OMIM:609413.0012C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.2038A>G (p.Asn680Asp)2074ERCC6Uncertain significancers1554788393RCV000664690; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105069086450690864TC10:g.50690864T>C-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.1992+32A>G2074ERCC6Benignrs4253162RCV000250945|RCV001658155|RCV001658154|RCV001658157|RCV001658156; NMedGen:CN169374|MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0010909,MedGen:C3551173,OMIM:600630, Orphanet:178338|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105069136050691360TC10:g.50691360T>CClinGen:CA5495806CN169374 not specified;
NM_000124.4(ERCC6):c.1954C>T (p.Arg652Ter)2074ERCC6Pathogenic/Likely pathogenicrs767247987RCV000170373|RCV000667169|RCV001227175; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN517202105069143050691430GA10:g.50691430G>AClinGen:CA274694C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.1868_1869dup (p.Ser624fs)2074ERCC6Pathogenicrs1307714476RCV000988356; NMONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569105069151450691515AATG10:g.50691514_50691515insTG-
NM_000124.4(ERCC6):c.1835G>A (p.Arg612Gln)2074ERCC6Uncertain significancers201894064RCV000170372|RCV000668823; NMedGen:CN169374|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105069154950691549CT10:g.50691549C>TClinGen:CA199582
NM_000124.4(ERCC6):c.1834C>T (p.Arg612Ter)2074ERCC6Pathogenicrs376526037RCV000494216|RCV000622933|RCV000664544|RCV000762811|RCV001775125; NMedGen:CN517202|MeSH:D030342,MedGen:C0950123|MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569|7 conditions|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105069155050691550GA10:g.50691550G>AClinGen:CA5495825,ClinVar:998032
NM_000124.4(ERCC6):c.1821+1G>A2074ERCC6Likely pathogenicrs1228919836RCV000671000|RCV001061869; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MedGen:CN517202105070116250701162CT10:g.50701162C>T-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.1821delinsAA (p.Glu608fs)2074ERCC6Likely pathogenicrs1554789393RCV000673910; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105070116350701163CTT10:g.50701163_50701164insT-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.1595A>G (p.Asp532Gly)2074ERCC6Uncertain significancers752712823RCV000670772; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105070867450708674TC10:g.50708674T>C-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.1527-2A>G2074ERCC6Likely pathogenicrs768608345RCV000674964; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105070874450708744TC10:g.50708744T>C-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.1526+1G>T2074ERCC6Pathogenic/Likely pathogenicrs371739894RCV000170365|RCV000723622|RCV000983983|RCV001280930; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN517202|MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569|MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191105071392950713929CA10:g.50713929C>AClinGen:CA274690C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.1398-2A>G2074ERCC6Likely pathogenicrs1317145066RCV000670670|RCV001035343; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MedGen:CN517202105071406050714060TC10:g.50714060T>C-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.1397+1G>C2074ERCC6Likely pathogenicrs1554793174RCV000665527|RCV001266078; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MeSH:D030342,MedGen:C0950123105073207850732078CG10:g.50732078C>G-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.1357C>T (p.Arg453Ter)2074ERCC6Pathogenicrs121917902RCV000001772|RCV000669858|RCV000763212|RCV001384070; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569|7 conditions|MedGen:C105073211950732119GA10:g.50732119G>AClinGen:CA251920,OMIM:609413.0004C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.1322_1324del (p.Glu441del)2074ERCC6Uncertain significancers769020754RCV000672827; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105073215250732154CCTTC10:g.50732152_50732154del-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.1319_1321del (p.Gly440del)2074ERCC6Uncertain significancers779180885RCV000672534; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105073215550732157TCTCT10:g.50732155_50732157del-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.1281C>T (p.Phe427=)2074ERCC6Likely benignrs267602508RCV000666439; NMONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105073219550732195GA10:g.50732195G>A-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.1211_1212insTCA (p.Lys405_Pro406insGln)2074ERCC6Uncertain significancers772545860RCV000674239; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105073226450732265CCTGA10:g.50732264_50732265insTGA-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.1137GGAGGAAGA[1] (p.Glu382_Glu384del)2074ERCC6Uncertain significancers1284316063RCV000596097|RCV000668240; NMedGen:CN517202|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569105073232250732330ATCTTCCTCCA10:g.50732322_50732330delClinGen:CA593780523C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.1134GGA[6] (p.Glu382_Glu384dup)2074ERCC6Uncertain significancers1554793268RCV000668743; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105073233350732334TTTCCTCCTCC10:g.50732333_50732334insTCCTCCTCC-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.1135G>T (p.Glu379Ter)2074ERCC6Pathogenic/Likely pathogenicrs1554793270RCV000670903|RCV001203195; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MedGen:CN517202105073234150732341CA10:g.50732341C>A-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.1062T>A (p.Pro354=)2074ERCC6Likely benignrs764159237RCV000667537; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105073241450732414AT10:g.50732414A>T-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.1009A>T (p.Lys337Ter)2074ERCC6Pathogenic/Likely pathogenicrs1198241866RCV000665546|RCV000809201|RCV001449817; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MedGen:CN517202|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105073246750732467TA10:g.50732467T>A-
NM_000124.4(ERCC6):c.906_923del (p.Thr303_Val308del)2074ERCC6Uncertain significancers765040780RCV000664827; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105073255350732570CACTGGGGCTGGAGGCGTGC10:g.50732553_50732570del-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.779_780dup (p.Arg261fs)2074ERCC6Likely pathogenicrs1254008304RCV000664845; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105073269550732696TTGG10:g.50732695_50732696insGG-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.643G>T (p.Glu215Ter)2074ERCC6Pathogenic/Likely pathogenicrs875989810RCV000211122|RCV000674902|RCV001061726; NMONDO:MONDO:0014843,MedGen:C4310783,OMIM:616946|MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN517202105073647250736472CA10:g.50736472C>AClinGen:CA10576142,OMIM:609413.0017C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.544-2A>G2074ERCC6Likely pathogenicrs1554794073RCV000669337; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105073657350736573TC10:g.50736573T>C-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.526C>T (p.Arg176Ter)2074ERCC6Pathogenic/Likely pathogenicrs771781694RCV000666614|RCV001731863; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MedGen:CN517202105073878350738783GA10:g.50738783G>A-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.466C>T (p.Gln156Ter)2074ERCC6Pathogenicrs751838040RCV000193828|RCV000224212|RCV000984001; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN517202|MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569105073884350738843GA10:g.50738843G>AClinGen:CA277210C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.439del (p.Ser146_Leu147insTer)2074ERCC6Likely pathogenicrs1554794360RCV000672864; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105073887050738870AGA10:g.50738870_50738870del-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.422+1G>A2074ERCC6Likely pathogenicrs1198472093RCV000665499|RCV001376925; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MedGen:CN517202105074058850740588CT10:g.50740588C>T-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.422+1G>C2074ERCC6Likely pathogenicrs1198472093RCV000672335|RCV001238124; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN517202105074058850740588CG10:g.50740588C>G-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.259_260del (p.Ala87fs)2074ERCC6Likely pathogenicrs1554794620RCV000667164; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105074075150740752GGCG10:g.50740751_50740752del-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.214del (p.Leu72fs)2074ERCC6Likely pathogenicrs1554794640RCV000669424; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105074079750740797AGA10:g.50740797_50740797del-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.207dup (p.Pro70fs)2074ERCC6Pathogenic/Likely pathogenicrs1554794641RCV000672932|RCV001172036; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN517202105074080350740804GGC10:g.50740803_50740804insC-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.184G>A (p.Ala62Thr)2074ERCC6Uncertain significancers186839348RCV000664765; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105074082750740827CT10:g.50740827C>T-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.124GAG[1] (p.Glu43del)2074ERCC6Uncertain significancers751610688RCV000672340; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105074088250740884ACTCA10:g.50740882_50740884del-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.61C>T (p.Gln21Ter)2074ERCC6Pathogenic/Likely pathogenicrs577021605RCV000666618|RCV001381278; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MedGen:CN517202105074095050740950GA10:g.50740950G>A-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.-14-2A>G2074ERCC6Uncertain significancers760663515RCV000666837; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105074102650741026TC10:g.50741026T>C-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
MSeqDR Portal