MSeqDR Mitochondrial Disease Portal


 
*:HP: HPO terms, UMDF: 1= Disease, ND: NAMDC terms.
  Most Studied  CPEO, Complex I Deficiency, COXPD1, Leigh, LHON, MELAS, MERRF, Myopathy, SANDO
Term ID:12924
Name:Xeroderma Pigmentosum, Complementation Group F
Definition:
Alternative IDs:OMIM:278760
ParentIDs:MESH:D014983
TreeNumbers:C04.834.867/C562592 |C16.131.831.936/C562592 |C16.320.850.970/C562592 |C17.800.600.925/C562592 |C17.800.621.936/C562592 |C17.800.804.936/C562592 |C17.800.827.970/C562592 |C18.452.284.975/C562592
Synonyms:Xeroderma Pigmentosum Vi |XERODERMA PIGMENTOSUM VI;XP6 XERODERMA PIGMENTOSUM, TYPE F/COCKAYNE SYNDROME, INCLUDED |XP6 |XPF |XPF/CS, INCLUDED |XP, Group F
Slim Mappings:Cancer|Congenital abnormality|Genetic disease (inborn)|Metabolic disease|Skin disease
Reference: MedGen: C562592
MeSH: C562592
OMIM: 278760;
MSeqDR LSDB:  
Genes: ERCC4;
Phenotypes
1 HP:0000007Autosomal recessive inheritance
2 HP:0000483AstigmatismHP:0040283
3 HP:0001251AtaxiaHP:0040283
4 HP:0012444Brain atrophyHP:0040283
5 HP:0000992Cutaneous photosensitivity
6 HP:0004325Decreased body weightHP:0040283
7 HP:0000490Deeply set eyeHP:0040283
8 HP:0003079Defective DNA repair after ultraviolet radiation damage
9 HP:0000726Dementia
NAMDC:  Dementia
HP:0040283
10 HP:0001371Flexion contractureHP:0040283
11 HP:0000365Hearing impairmentHP:0040283
12 HP:0001249Intellectual disabilityHP:0040283
13 HP:0000252MicrocephalyHP:0040283
14 HP:0002011Morphological abnormality of the central nervous systemHP:0040283
15 HP:0008069Neoplasm of the skinHP:0040283
16 HP:0007587Numerous pigmented freckles
17 HP:0000639NystagmusHP:0040283
18 HP:0200034Papule
19 HP:0003812Phenotypic variability
20 HP:0002650ScoliosisHP:0040283
21 HP:0004322Short stature
NAMDC:  Short stature (patient¡¯s height is below the 3rd percentile)
HP:0040283
22 HP:0001337TremorHP:0040283
Disease Causing ClinVar Variants
Variation_NameGeneIDGeneSymbolClinicalSignificancedbSNPRCVaccessionTestedInGTRPhenotypeIDsChromosomeStartStopHGVS_cHGVS_pHGVS_gOtherIDsDisease_ClinVar
NC_000016.10:g.(?_13821951)_(13937868_?)dup2072ERCC4Uncertain significance-1RCV001031143; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161391580814031725nana-1-
NC_000016.9:g.(?_13915808)_(14724045_?)dup2072ERCC4Uncertain significance-1RCV001997616; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161391580814724045nana-1-
NC_000016.9:g.14013666A>C2072ERCC4Benign-1RCV001510401; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161401366614013666AC14013666-
NC_000016.10:g.(?_13920156)_(13948357_?)del2072ERCC4Pathogenic-1RCV000819225; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161401401314042214nana-
NM_005236.3(ERCC4):c.4G>C (p.Glu2Gln)2072ERCC4Uncertain significancers373789508RCV001219171; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161401402614014026GC16:g.14014026G>C-
NM_005236.3(ERCC4):c.12G>A (p.Gly4=)2072ERCC4Uncertain significancers781417413RCV001121018; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161401403414014034GA16:g.14014034G>A-
NM_005236.3(ERCC4):c.15G>A (p.Gln5=)2072ERCC4Likely benign-1RCV001485566; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161401403714014037GA14014037-
NM_005236.3(ERCC4):c.16C>T (p.Pro6Ser)2072ERCC4Uncertain significancers61760160RCV000120803|RCV000475143|RCV000734582|RCV000989531|RCV001292633; NMedGen:CN169374|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84|MedGen:CN517202|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MONDO:MONDO:0014161401403814014038CT16:g.14014038C>TClinGen:CA158855C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.19G>A (p.Ala7Thr)2072ERCC4Uncertain significancers771117594RCV000688763; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161401404114014041GA16:g.14014041G>A-C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.22C>T (p.Arg8Ter)2072ERCC4Pathogenic-1RCV001389442; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161401404414014044CT14014044-
NM_005236.3(ERCC4):c.22C>A (p.Arg8=)2072ERCC4Likely benign-1RCV002095302; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161401404414014044CA14014044-
NM_005236.3(ERCC4):c.26G>C (p.Arg9Pro)2072ERCC4Uncertain significancers1214498950RCV001059205; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161401404814014048GC16:g.14014048G>C-
NM_005236.3(ERCC4):c.32C>T (p.Ala11Val)2072ERCC4Uncertain significancers753596005RCV001220164; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161401405414014054CT16:g.14014054C>T-
NM_005236.3(ERCC4):c.33C>T (p.Ala11=)2072ERCC4Benign/Likely benignrs3136042RCV000232260|RCV000251617|RCV001565313|RCV001121019; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84|MedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161401405514014055CTNC_000016.9:g.14014055C>TClinGen:CA7910067C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.37G>T (p.Ala13Ser)2072ERCC4Uncertain significancers374243778RCV001056526; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161401405914014059GT16:g.14014059G>T-
NM_005236.3(ERCC4):c.37G>A (p.Ala13Thr)2072ERCC4Uncertain significance-1RCV001764194; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161401405914014059GA14014059-
NM_005236.3(ERCC4):c.41C>G (p.Pro14Arg)2072ERCC4Uncertain significancers754622238RCV000281667; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161401406314014063CGNC_000016.9:g.14014063C>GClinGen:CA10647746C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.41C>T (p.Pro14Leu)2072ERCC4Uncertain significancers754622238RCV000462139; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161401406314014063CTNC_000016.9:g.14014063C>TClinGen:CA7910073C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.42G>A (p.Pro14=)2072ERCC4Likely benign-1RCV001412669; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161401406414014064GA14014064-
NM_005236.3(ERCC4):c.58C>T (p.Arg20Ter)2072ERCC4Pathogenic-1RCV002037756; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161401408014014080CT14014080-
NM_005236.3(ERCC4):c.61C>G (p.Gln21Glu)2072ERCC4Uncertain significancers748499820RCV000334401|RCV001362330; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161401408314014083CGNC_000016.9:g.14014083C>GClinGen:CA7910075C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.69G>A (p.Val23=)2072ERCC4Likely benign-1RCV002156447; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161401409114014091GA14014091-
NM_005236.3(ERCC4):c.79C>T (p.Leu27Phe)2072ERCC4Uncertain significancers587778282RCV000120804|RCV000372597|RCV001340956; NMedGen:CN169374|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161401410114014101CT16:g.14014101C>TClinGen:CA158858CN169374 not specified;
NM_005236.3(ERCC4):c.105C>T (p.Cys35=)2072ERCC4Conflicting interpretations of pathogenicityrs762885804RCV000285190|RCV002061190; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161401412714014127CTNC_000016.9:g.14014127C>TClinGen:CA7910086C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.109C>T (p.Arg37Cys)2072ERCC4Uncertain significancers144602005RCV001066566|RCV001760042; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161401413114014131CT16:g.14014131C>T-
NM_005236.3(ERCC4):c.122C>G (p.Ala41Gly)2072ERCC4Uncertain significancers751095195RCV001201434; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161401414414014144CG16:g.14014144C>G-
NM_005236.3(ERCC4):c.124G>A (p.Asp42Asn)2072ERCC4Uncertain significancers767138486RCV001349621; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161401414614014146GA14014146-
NM_005236.3(ERCC4):c.125A>G (p.Asp42Gly)2072ERCC4Uncertain significance-1RCV001930722; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161401414714014147AG14014147-
NM_005236.3(ERCC4):c.130C>T (p.Leu44Phe)2072ERCC4Uncertain significancers1596616623RCV001298474; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161401415214014152CT14014152-
NM_005236.3(ERCC4):c.132C>T (p.Leu44=)2072ERCC4Likely benign-1RCV001433010; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161401415414014154CT14014154-
NM_005236.3(ERCC4):c.137A>G (p.Tyr46Cys)2072ERCC4Uncertain significance-1RCV001936424; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161401415914014159AG14014159-
NM_005236.3(ERCC4):c.143T>A (p.Phe48Tyr)2072ERCC4Uncertain significance-1RCV001895360; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161401416514014165TA14014165-
NM_005236.3(ERCC4):c.145C>T (p.Leu49Phe)2072ERCC4Uncertain significancers552142099RCV001116100|RCV001359252|RCV001759882; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191|MedGen:CN517202161401416714014167CT16:g.14014167C>T-
NM_005236.3(ERCC4):c.178C>T (p.Leu60=)2072ERCC4Likely benign-1RCV002102669; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161401420014014200CT14014200-
NM_005236.3(ERCC4):c.183G>A (p.Val61=)2072ERCC4Likely benign-1RCV002140107; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161401420514014205GA14014205-
NM_005236.3(ERCC4):c.207+6G>T2072ERCC4Uncertain significance-1RCV001999589; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161401423514014235GT14014235-
NM_005236.3(ERCC4):c.207+11G>A2072ERCC4Benignrs762521RCV000250561|RCV000342604|RCV001660279|RCV001660280|RCV001711702|RCV002058182; NMedGen:CN169374|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MONDO:MONDO:0012590,MedGen:C1970416,OMIM:610965|MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84|MedGen:CN517202|MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO161401424014014240GA16:g.14014240G>AClinGen:CA7910107CN169374 not specified;
NM_005236.3(ERCC4):c.207+13T>A2072ERCC4Uncertain significance-1RCV001764200; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161401424214014242TA14014242-
NM_005236.3(ERCC4):c.207+13T>C2072ERCC4Likely benign-1RCV002182530; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161401424214014242TC14014242-
NM_005236.3(ERCC4):c.208-6A>G2072ERCC4Likely benignrs1596617926RCV000975782|RCV001503287; NMedGen:CN517202|MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161401588214015882AG16:g.14015882A>G-
NM_005236.3(ERCC4):c.208-3T>C2072ERCC4Uncertain significancers773956647RCV001044533; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161401588514015885TC16:g.14015885T>C-
NM_005236.3(ERCC4):c.211T>C (p.Tyr71His)2072ERCC4Uncertain significancers145315496RCV000120818|RCV000728799|RCV001209805|RCV001543122; NMedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014161401589114015891TC16:g.14015891T>CClinGen:CA158897CN169374 not specified;
NM_005236.3(ERCC4):c.214T>C (p.Phe72Leu)2072ERCC4Uncertain significance-1RCV002016424; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161401589414015894TC14015894-
NM_005236.3(ERCC4):c.217A>G (p.Ile73Val)2072ERCC4Uncertain significancers141591400RCV000120816|RCV000475162|RCV001116101|RCV001358031; NMedGen:CN169374|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MedGen:CN517202161401589714015897AG16:g.14015897A>GClinGen:CA158891C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.228G>A (p.Leu76=)2072ERCC4Conflicting interpretations of pathogenicityrs61760162RCV000560297|RCV001116102; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161401590814015908GA16:g.14015908G>AClinGen:CA7910129C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.232A>T (p.Ile78Leu)2072ERCC4Uncertain significance-1RCV001924013; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161401591214015912AT14015912-
NM_005236.3(ERCC4):c.241G>T (p.Val81Phe)2072ERCC4Benign/Likely benignrs55761944RCV000120817|RCV000234335; NMedGen:CN169374|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161401592114015921GT16:g.14015921G>TClinGen:CA158894C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.241G>A (p.Val81Ile)2072ERCC4Uncertain significancers55761944RCV000473210; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161401592114015921GANC_000016.9:g.14015921G>AClinGen:CA7910134C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.250C>T (p.Leu84Phe)2072ERCC4Uncertain significance-1RCV001917719; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161401593014015930CT14015930-
NM_005236.3(ERCC4):c.252C>T (p.Leu84=)2072ERCC4Benign/Likely benignrs3136056RCV000247899|RCV000231873|RCV000401388|RCV001618353; NMedGen:CN169374|MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MedGen:CN517202161401593214015932CT16:g.14015932C>TClinGen:CA7910137C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.256C>T (p.Arg86Cys)2072ERCC4Uncertain significance-1RCV001355944|RCV001762612; NMedGen:CN517202|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161401593614015936CT14015936-
NM_005236.3(ERCC4):c.257G>A (p.Arg86His)2072ERCC4Uncertain significancers187435008RCV000802175|RCV001788354; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84|MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161401593714015937GA16:g.14015937G>A-
NM_005236.3(ERCC4):c.259C>T (p.Arg87Cys)2072ERCC4Uncertain significance-1RCV001370379; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161401593914015939CT14015939-
NM_005236.3(ERCC4):c.260G>A (p.Arg87His)2072ERCC4Uncertain significancers371487368RCV000651472; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161401594014015940GANC_000016.9:g.14015940G>AClinGen:CA7910141C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.275T>G (p.Ile92Ser)2072ERCC4Uncertain significancers556330628RCV000284135; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161401595514015955TGNC_000016.9:g.14015955T>GClinGen:CA7910142C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.325G>A (p.Ala109Thr)2072ERCC4Conflicting interpretations of pathogenicityrs148791570RCV000547965|RCV001117537|RCV001569666|RCV001821617; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MedGen:CN517202|MedGen:CN169374161401600514016005GANC_000016.9:g.14016005G>AClinGen:CA7910153C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.326C>T (p.Ala109Val)2072ERCC4Uncertain significancers767586458RCV001307500; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161401600614016006CT14016006-
NM_005236.3(ERCC4):c.346G>A (p.Val116Ile)2072ERCC4Uncertain significance-1RCV001866388; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161401602614016026GA14016026-
NM_005236.3(ERCC4):c.367A>G (p.Ile123Val)2072ERCC4Uncertain significancers144666685RCV001117538; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161401604714016047AG16:g.14016047A>G-
NM_005236.3(ERCC4):c.376G>C (p.Asp126His)2072ERCC4Uncertain significance-1RCV001912538; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161401605614016056GC14016056-
NM_005236.3(ERCC4):c.377A>T (p.Asp126Val)2072ERCC4Uncertain significance-1RCV001945177; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161401605714016057AT14016057-
NM_005236.3(ERCC4):c.388+13A>G2072ERCC4Likely benign-1RCV002116735; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161401608114016081AG14016081-
NM_005236.3(ERCC4):c.389-9C>A2072ERCC4Uncertain significancers369626998RCV001039603; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402040914020409CA16:g.14020409C>A-
NM_005236.3(ERCC4):c.389-8C>G2072ERCC4Likely benign-1RCV002106599; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402041014020410CG14020410-
NM_005236.3(ERCC4):c.389-5C>T2072ERCC4Benign/Likely benignrs377224276RCV000474414|RCV001821351; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MedGen:CN169374161402041314020413CTNC_000016.9:g.14020413C>TClinGen:CA7910187C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.404G>A (p.Arg135Lys)2072ERCC4Uncertain significancers772606808RCV001348135; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161402043314020433GA14020433-
NM_005236.3(ERCC4):c.413G>A (p.Arg138Lys)2072ERCC4Uncertain significancers1567243693RCV000686055; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402044214020442GA16:g.14020442G>A-C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.420C>T (p.Ile140=)2072ERCC4Likely benignrs138724289RCV002132596; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161402044914020449CT14020449-
NM_005236.3(ERCC4):c.425C>A (p.Ser142Tyr)2072ERCC4Uncertain significancers764093404RCV001348401; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161402045414020454CA14020454-
NM_005236.3(ERCC4):c.457C>T (p.Arg153Cys)2072ERCC4Uncertain significance-1RCV001918774; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402048614020486CT14020486-
NM_005236.3(ERCC4):c.471A>G (p.Lys157=)2072ERCC4Conflicting interpretations of pathogenicityrs3136092RCV000499897|RCV002060112; NMedGen:CN169374|MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161402050014020500AGNC_000016.9:g.14020500A>GClinGen:CA7910208CN169374 not specified;
NM_005236.3(ERCC4):c.472C>T (p.Arg158Cys)2072ERCC4Uncertain significance-1RCV001391663|RCV001849515; NMONDO:MONDO:0012590,MedGen:C1970416,OMIM:610965; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402050114020501CT14020501-
NM_005236.3(ERCC4):c.473G>A (p.Arg158His)2072ERCC4Uncertain significancers1012646362RCV000996214|RCV001119141; NMedGen:CN517202|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402050214020502GA16:g.14020502G>A-
NM_005236.3(ERCC4):c.475G>A (p.Gly159Ser)2072ERCC4Uncertain significance-1RCV001922442; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402050414020504GA14020504-
NM_005236.3(ERCC4):c.484A>G (p.Lys162Glu)2072ERCC4Uncertain significancers2032078220RCV001221247; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402051314020513AG16:g.14020513A>G-
NM_005236.3(ERCC4):c.499A>G (p.Asn167Asp)2072ERCC4Uncertain significancers2032078374RCV001038391; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402052814020528AG16:g.14020528A>G-
NM_005236.3(ERCC4):c.503C>G (p.Ala168Gly)2072ERCC4Uncertain significancers2020961RCV000226103|RCV001294109; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84|MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402053214020532CG16:g.14020532C>GClinGen:CA7910211C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.503C>T (p.Ala168Val)2072ERCC4Conflicting interpretations of pathogenicityrs2020961RCV000862022|RCV001292967; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191|MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402053214020532CT16:g.14020532C>T-
NM_005236.3(ERCC4):c.514G>C (p.Asp172His)2072ERCC4Uncertain significancers1405781900RCV001342660; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402054314020543GC14020543-
NM_005236.3(ERCC4):c.532G>T (p.Val178Leu)2072ERCC4Uncertain significancers149927607RCV000536696|RCV001121126|RCV001764609|RCV001821618; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MedGen:CN517202|MedGen:CN169374161402056114020561GTNC_000016.9:g.14020561G>TClinGen:CA7910213C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.537A>G (p.Glu179=)2072ERCC4Likely benign-1RCV001437611|RCV001820131; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191|MedGen:CN169374161402056614020566AG14020566-
NM_005236.3(ERCC4):c.540A>G (p.Arg180=)2072ERCC4Likely benign-1RCV001890148; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402056914020569AG14020569-
NM_005236.3(ERCC4):c.541G>A (p.Val181Met)2072ERCC4Uncertain significance-1RCV001906094; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402057014020570GA14020570-
NM_005236.3(ERCC4):c.557_558del (p.Phe186fs)2072ERCC4Pathogenic-1RCV001917980; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402058314020584CTTC14020582-
NM_005236.3(ERCC4):c.555T>C (p.Leu185=)2072ERCC4Likely benign-1RCV002084896; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161402058414020584TC14020584-
NM_005236.3(ERCC4):c.576G>C (p.Leu192=)2072ERCC4Conflicting interpretations of pathogenicity-1RCV001820410|RCV002074332; NMedGen:CN169374|MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402060514020605GC14020605-
NM_005236.3(ERCC4):c.580_584+1del2072ERCC4Conflicting interpretations of pathogenicityrs776329282RCV001042569|RCV001819754|RCV001531225; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84|MedGen:CN169374|MedGen:CN517202161402060714020612TGGCCAAT16:g.14020607_14020612del-
NM_005236.3(ERCC4):c.579G>A (p.Trp193Ter)2072ERCC4Pathogenic-1RCV001817844|RCV001869789; NMedGen:CN517202|MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402060814020608GA14020608-
NC_000016.10:g.(?_13928022)_(13928241_?)del2072ERCC4Pathogenic-1RCV000651483; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402187914022098nana-C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.671C>T (p.Ala224Val)2072ERCC4Uncertain significance-1RCV001943600; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402197114021971CT14021971-
NM_005236.3(ERCC4):c.700A>C (p.Asn234His)2072ERCC4Uncertain significance-1RCV001764193; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402200014022000AC14022000-
NM_005236.3(ERCC4):c.703G>A (p.Ala235Thr)2072ERCC4Uncertain significancers141101671RCV000800805|RCV001816859|RCV001766657; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84|MedGen:CN169374|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402200314022003GA16:g.14022003G>A-
NM_005236.3(ERCC4):c.705A>G (p.Ala235=)2072ERCC4Likely benign-1RCV002112262; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402200514022005AG14022005-
NM_005236.3(ERCC4):c.712A>G (p.Lys238Glu)2072ERCC4Uncertain significancers2032105702RCV001345494; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402201214022012AG14022012-
NM_005236.3(ERCC4):c.714G>A (p.Lys238=)2072ERCC4Uncertain significancers780166871RCV000651473; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402201414022014GA16:g.14022014G>AClinGen:CA7910255C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.718C>T (p.Leu240=)2072ERCC4Likely benignrs746904084RCV000469387|RCV001821353; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MedGen:CN169374161402201814022018CTNC_000016.9:g.14022018C>TClinGen:CA16614571C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.728A>G (p.His243Arg)2072ERCC4Uncertain significancers144608823RCV001121127; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402202814022028AG16:g.14022028A>G-
NM_005236.3(ERCC4):c.737C>T (p.Ser246Leu)2072ERCC4Uncertain significance-1RCV001978750; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161402203714022037CT14022037-
NM_005236.3(ERCC4):c.738G>A (p.Ser246=)2072ERCC4Likely benignrs146650135RCV000861402; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161402203814022038GA16:g.14022038G>A-
NM_005236.3(ERCC4):c.751G>A (p.Asp251Asn)2072ERCC4Uncertain significancers2032106630RCV001063955; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402205114022051GA16:g.14022051G>A-
NM_005236.3(ERCC4):c.769G>T (p.Ala257Ser)2072ERCC4Uncertain significance-1RCV001982211; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161402206914022069GT14022069-
NM_005236.3(ERCC4):c.782C>T (p.Pro261Leu)2072ERCC4Uncertain significance-1RCV001371930; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402208214022082CT14022082-
NM_005236.3(ERCC4):c.790A>G (p.Lys264Glu)2072ERCC4Uncertain significancers1463126902RCV000812329; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402209014022090AG16:g.14022090A>G-
NM_005236.3(ERCC4):c.793-17T>C2072ERCC4Likely benign-1RCV002093525; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402455014024550TC14024550-
NM_005236.3(ERCC4):c.793-13A>T2072ERCC4Benign-1RCV002180590; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402455414024554AT14024554-
NM_005236.3(ERCC4):c.793-2A>G2072ERCC4Pathogenicrs2032155264RCV001212995; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402456514024565AG16:g.14024565A>G-
NM_005236.3(ERCC4):c.794C>T (p.Thr265Ile)2072ERCC4Uncertain significance-1RCV001968502; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402456814024568CT14024568-
NM_005236.3(ERCC4):c.798C>G (p.Ile266Met)2072ERCC4Uncertain significancers746106147RCV000807809|RCV001294110; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191|MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402457214024572CG16:g.14024572C>G-
NM_005236.3(ERCC4):c.799C>T (p.Arg267Cys)2072ERCC4Uncertain significance-1RCV001369955; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402457314024573CT14024573-
NM_005236.3(ERCC4):c.800G>A (p.Arg267His)2072ERCC4Uncertain significancers143479220RCV001194779|RCV001863072; NMedGen:CN517202|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161402457414024574GA16:g.14024574G>A-
NM_005236.3(ERCC4):c.800G>T (p.Arg267Leu)2072ERCC4Uncertain significancers143479220RCV001304992; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161402457414024574GT14024574-
NM_005236.3(ERCC4):c.809T>C (p.Leu270Pro)2072ERCC4Uncertain significancers1457864707RCV001240695; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402458314024583TC16:g.14024583T>C-
NM_005236.3(ERCC4):c.816T>A (p.Pro272=)2072ERCC4Likely benign-1RCV001432018; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402459014024590TA14024590-
NM_005236.3(ERCC4):c.823C>T (p.His275Tyr)2072ERCC4Uncertain significance-1RCV001943465; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402459714024597CT14024597-
NM_005236.3(ERCC4):c.830T>C (p.Leu277Pro)2072ERCC4Uncertain significance-1RCV001916265; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161402460414024604TC14024604-
NM_005236.3(ERCC4):c.837C>G (p.Ala279=)2072ERCC4Likely benign-1RCV002176967; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402461114024611CG14024611-
NM_005236.3(ERCC4):c.840G>A (p.Lys280=)2072ERCC4Uncertain significancers886051659RCV000315093; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402461414024614GANC_000016.9:g.14024614G>AClinGen:CA10642903C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.870A>G (p.Ile290Met)2072ERCC4Uncertain significance-1RCV001934428; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402464414024644AG14024644-
NM_005236.3(ERCC4):c.875G>A (p.Arg292Gln)2072ERCC4Uncertain significancers202243691RCV000651474; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402464914024649GANC_000016.9:g.14024649G>AClinGen:CA7910295C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.889T>A (p.Tyr297Asn)2072ERCC4Uncertain significancers778480216RCV000459953; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402466314024663TANC_000016.9:g.14024663T>AClinGen:CA7910298C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.890A>G (p.Tyr297Cys)2072ERCC4Uncertain significancers996851583RCV000697984; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161402466414024664AGNC_000016.9:g.14024664A>G-C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.891T>C (p.Tyr297=)2072ERCC4Uncertain significancers886051660RCV000367452; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402466514024665TCNC_000016.9:g.14024665T>CClinGen:CA10637021C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.906T>C (p.Asp302=)2072ERCC4Likely benignrs148003381RCV000500726|RCV001449127; NMedGen:CN169374|MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161402468014024680TCNC_000016.9:g.14024680T>CClinGen:CA7910301CN169374 not specified;
NM_005236.3(ERCC4):c.913A>T (p.Thr305Ser)2072ERCC4Uncertain significancers772385411RCV001306348; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402468714024687AT14024687-
NM_005236.3(ERCC4):c.915del (p.Asn308fs)2072ERCC4Pathogenic/Likely pathogenicrs772432152RCV000350484|RCV001855213; NMedGen:CN517202|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402468914024689CAC16:g.14024689_14024689delClinGen:CA7910304C0268140 278760 Xeroderma pigmentosum, group F;
NM_005236.3(ERCC4):c.924T>C (p.Asn308=)2072ERCC4Likely benignrs1408777193RCV000913639; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402469814024698TC16:g.14024698T>C-
NM_005236.3(ERCC4):c.934T>G (p.Ser312Ala)2072ERCC4Uncertain significancers200596978RCV001071245; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161402470814024708TG16:g.14024708T>G-
NM_005236.3(ERCC4):c.935C>G (p.Ser312Cys)2072ERCC4Uncertain significancers886051661RCV000275221; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402470914024709CGNC_000016.9:g.14024709C>GClinGen:CA10637022C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.938T>C (p.Leu313Pro)2072ERCC4Uncertain significancers150244523RCV000120819|RCV001762255; NMedGen:CN169374|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402471214024712TC16:g.14024712T>CClinGen:CA158900CN169374 not specified;
NM_005236.3(ERCC4):c.947C>T (p.Thr316Met)2072ERCC4Uncertain significancers1340754747RCV001294508; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402472114024721CT14024721-
NM_005236.3(ERCC4):c.948G>A (p.Thr316=)2072ERCC4Likely benign-1RCV002148199; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161402472214024722GA14024722-
NM_005236.3(ERCC4):c.950A>G (p.Glu317Gly)2072ERCC4Uncertain significance-1RCV001937087; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161402472414024724AG14024724-
NM_005236.3(ERCC4):c.973+7G>A2072ERCC4Likely benign-1RCV002131583; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161402475414024754GA14024754-
NM_005236.3(ERCC4):c.973+11A>T2072ERCC4Conflicting interpretations of pathogenicityrs185779788RCV002069968|RCV001819831|RCV001121129; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84|MedGen:CN169374|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402475814024758AT16:g.14024758A>T-
NM_005236.3(ERCC4):c.974-20_974-16del2072ERCC4Likely benign-1RCV002210313; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402599014025994TTTTTCT14025989-
NM_005236.3(ERCC4):c.974-17T>C2072ERCC4Likely benign-1RCV002080983; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402599714025997TC14025997-
NM_005236.3(ERCC4):c.974-8C>T2072ERCC4Likely benign-1RCV002091490; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402600614026006CT14026006-
NM_005236.3(ERCC4):c.974-7G>A2072ERCC4Benignrs254942RCV000246561|RCV000318579|RCV001520608|RCV001660282|RCV001660281|RCV001689852; NMedGen:CN169374|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191|MONDO:MONDO:0014108,MedGen:C3808161402600714026007GA16:g.14026007G>AClinGen:CA7910327CN169374 not specified;
NM_005236.3(ERCC4):c.974-7_974-6inv2072ERCC4Benign-1RCV000468543|RCV001517902; NMedGen:CN517202|MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402600714026008GTACNC_000016.9:g.14026007_14026008invClinGen:CA16614572C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.974-6T>C2072ERCC4Benign/Likely benignrs201181735RCV000202807|RCV000353369|RCV000964431; NMedGen:CN169374|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161402600814026008TC16:g.14026008T>CClinGen:CA249006CN169374 not specified;
NM_005236.3(ERCC4):c.989A>C (p.Asp330Ala)2072ERCC4Uncertain significance-1RCV001912761; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402602914026029AC14026029-
NM_005236.3(ERCC4):c.991T>A (p.Ser331Thr)2072ERCC4Uncertain significancers762052950RCV001237489|RCV001294210; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402603114026031TA16:g.14026031T>A-
NM_005236.3(ERCC4):c.1001C>T (p.Ser334Leu)2072ERCC4Uncertain significancers750883282RCV000999523|RCV001065281|RCV001819713; NMedGen:CN517202|MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84|MedGen:CN169374161402604114026041CT16:g.14026041C>T-
NM_005236.3(ERCC4):c.1002G>C (p.Ser334=)2072ERCC4Likely benign-1RCV002160178; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161402604214026042GC14026042-
NM_005236.3(ERCC4):c.1004T>C (p.Met335Thr)2072ERCC4Uncertain significance-1RCV002020673; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402604414026044TC14026044-
NM_005236.3(ERCC4):c.1009A>G (p.Ile337Val)2072ERCC4Uncertain significance-1RCV001764206; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402604914026049AG14026049-
NM_005236.3(ERCC4):c.1019G>A (p.Arg340Gln)2072ERCC4Uncertain significancers753728949RCV001068176; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402605914026059GA16:g.14026059G>A-
NM_005236.3(ERCC4):c.1027G>A (p.Val343Ile)2072ERCC4Uncertain significance-1RCV001361039; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402606714026067GA14026067-
NM_005236.3(ERCC4):c.1031A>T (p.Tyr344Phe)2072ERCC4Uncertain significancers145851520RCV000540520|RCV001292941; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402607114026071ATNC_000016.9:g.14026071A>TClinGen:CA7910342C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.1031A>G (p.Tyr344Cys)2072ERCC4Uncertain significance-1RCV001367325; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402607114026071AG14026071-
NM_005236.3(ERCC4):c.1045G>A (p.Ala349Thr)2072ERCC4Uncertain significancers201410515RCV000695372; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161402608514026085GANC_000016.9:g.14026085G>A-C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.1090A>G (p.Lys364Glu)2072ERCC4Uncertain significancers765535723RCV001307701; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402613014026130AG14026130-
NM_005236.3(ERCC4):c.1102G>A (p.Glu368Lys)2072ERCC4Uncertain significancers148933357RCV001316070; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402614214026142GA14026142-
NM_005236.3(ERCC4):c.1102+1G>T2072ERCC4Likely pathogenic-1RCV001377820; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402614314026143GT14026143-
NM_005236.3(ERCC4):c.1102+7T>A2072ERCC4Likely benign-1RCV001424190; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402614914026149TA14026149-
NM_005236.3(ERCC4):c.1102+13G>T2072ERCC4Conflicting interpretations of pathogenicityrs199772721RCV000260868|RCV002061191; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161402615514026155GTNC_000016.9:g.14026155G>TClinGen:CA7910361C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.1102+36dup2072ERCC4Likely benignrs761458435RCV000989532; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402617214026173GGT16:g.14026172_14026173insT-
NM_005236.3(ERCC4):c.1110A>T (p.Lys370Asn)2072ERCC4Uncertain significancers774643449RCV000502790|RCV001857095; NMedGen:CN169374|MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161402805614028056ATNC_000016.9:g.14028056A>TClinGen:CA7910403CN169374 not specified;
NM_005236.3(ERCC4):c.1112A>G (p.Lys371Arg)2072ERCC4Uncertain significancers886051662RCV000323079; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402805814028058AGNC_000016.9:g.14028058A>GClinGen:CA10646960C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.1114G>A (p.Glu372Lys)2072ERCC4Uncertain significancers2032238318RCV001214784; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402806014028060GA16:g.14028060G>A-
NM_005236.3(ERCC4):c.1116A>G (p.Glu372=)2072ERCC4Likely benign-1RCV001909533; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161402806214028062AG14028062-
NM_005236.3(ERCC4):c.1123C>T (p.Leu375=)2072ERCC4Likely benignrs376695854RCV000553160|RCV001455477; NMedGen:CN517202|MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402806914028069CTNC_000016.9:g.14028069C>TClinGen:CA7910406C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.1135C>T (p.Pro379Ser)2072ERCC4Conflicting interpretations of pathogenicityrs1799802RCV000120821|RCV000224511|RCV001083882|RCV001116216; NMedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402808114028081CTNC_000016.9:g.14028081C>TClinGen:CA158906,UniProtKB:Q92889#VAR_013395C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.1162T>G (p.Leu388Val)2072ERCC4Uncertain significance-1RCV001764205; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402810814028108TG14028108-
NM_005236.3(ERCC4):c.1193G>A (p.Ser398Asn)2072ERCC4Uncertain significance-1RCV002008043; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402813914028139GA14028139-
NM_005236.3(ERCC4):c.1201C>T (p.Leu401Phe)2072ERCC4Uncertain significancers147458778RCV001242009|RCV001760270; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402814714028147CT16:g.14028147C>T-
NM_005236.3(ERCC4):c.1210C>T (p.Pro404Ser)2072ERCC4Uncertain significance-1RCV001885951; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402815614028156CT14028156-
NM_005236.3(ERCC4):c.1212A>G (p.Pro404=)2072ERCC4Uncertain significancers752193295RCV000469080; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402815814028158AGNC_000016.9:g.14028158A>GClinGen:CA7910415C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.1214-19T>C2072ERCC4Likely benign-1RCV002210454; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402898414028984TC14028984-
NM_005236.3(ERCC4):c.1214-4T>G2072ERCC4Likely benign-1RCV001466674; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402899914028999TG14028999-
NM_005236.3(ERCC4):c.1217A>G (p.Gln406Arg)2072ERCC4Uncertain significancers762147159RCV000380080|RCV001850680; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161402900614029006AGNC_000016.9:g.14029006A>GClinGen:CA7910427C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.1243C>G (p.Arg415Gly)2072ERCC4Uncertain significancers374470560RCV001303533; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161402903214029032CG14029032-
NM_005236.3(ERCC4):c.1244G>A (p.Arg415Gln)2072ERCC4Benign/Likely benignrs1800067RCV000120828|RCV000283278|RCV001521901|RCV001668273; NMedGen:CN169374|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84|MedGen:CN517202161402903314029033GA16:g.14029033G>AClinGen:CA158927,UniProtKB:Q92889#VAR_013396CN169374 not specified;
NM_005236.3(ERCC4):c.1251T>A (p.Cys417Ter)2072ERCC4Pathogenic-1RCV001919468; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402904014029040TA14029040-
NM_005236.3(ERCC4):c.1258C>T (p.Leu420=)2072ERCC4Likely benign-1RCV001402857; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402904714029047CT14029047-
NM_005236.3(ERCC4):c.1265A>T (p.Asp422Val)2072ERCC4Uncertain significancers767408205RCV000651476; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402905414029054ATNC_000016.9:g.14029054A>TClinGen:CA394809044C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.1268A>G (p.Tyr423Cys)2072ERCC4Uncertain significance-1RCV001967608; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161402905714029057AG14029057-
NM_005236.3(ERCC4):c.1284G>A (p.Ala428=)2072ERCC4Conflicting interpretations of pathogenicityrs3136151RCV000321953|RCV000529282|RCV001820939; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191|MedGen:CN169374161402907314029073GANC_000016.9:g.14029073G>AClinGen:CA7910435C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.1297T>C (p.Leu433=)2072ERCC4Likely benignrs116615540RCV000872336|RCV001858551; NMedGen:CN517202|MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402908614029086TC16:g.14029086T>C-
NM_005236.3(ERCC4):c.1301G>A (p.Arg434Lys)2072ERCC4Uncertain significance-1RCV001989752; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161402909014029090GA14029090-
NM_005236.3(ERCC4):c.1304T>G (p.Leu435Arg)2072ERCC4Uncertain significancers1001540758RCV001055993; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402909314029093TG16:g.14029093T>G-
NM_005236.3(ERCC4):c.1320T>C (p.Phe440=)2072ERCC4Likely benign-1RCV001465921; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402910914029109TC14029109-
NM_005236.3(ERCC4):c.1334A>C (p.Lys445Thr)2072ERCC4Uncertain significancers368559924RCV001248130; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402912314029123AC16:g.14029123A>C-
NM_005236.3(ERCC4):c.1336G>T (p.Ala446Ser)2072ERCC4Uncertain significancers1298488189RCV001341080; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402912514029125GT14029125-
NM_005236.3(ERCC4):c.1342G>C (p.Glu448Gln)2072ERCC4Likely benignrs547209644RCV001117658|RCV002069900; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402913114029131GC16:g.14029131G>C-
NM_005236.3(ERCC4):c.1347C>A (p.Val449=)2072ERCC4Likely benignrs1352012558RCV000861324|RCV001425092; NMedGen:CN517202|MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161402913614029136CA16:g.14029136C>A-
NM_005236.3(ERCC4):c.1347C>G (p.Val449=)2072ERCC4Likely benign-1RCV002146989; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402913614029136CG14029136-
NM_005236.3(ERCC4):c.1364A>G (p.Lys455Arg)2072ERCC4Uncertain significancers759312308RCV001227574; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402915314029153AG16:g.14029153A>G-
NM_005236.3(ERCC4):c.1379A>T (p.Lys460Met)2072ERCC4Uncertain significance-1RCV002048841; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402916814029168AT14029168-
NM_005236.3(ERCC4):c.1391A>T (p.Lys464Ile)2072ERCC4Uncertain significancers780488548RCV001300359; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402918014029180AT14029180-
NM_005236.3(ERCC4):c.1415C>T (p.Pro472Leu)2072ERCC4Conflicting interpretations of pathogenicityrs572439259RCV000120825|RCV000651482|RCV001294104; NMedGen:CN169374|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84|MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402920414029204CT16:g.14029204C>TClinGen:CA158918C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.1432G>A (p.Ala478Thr)2072ERCC4Uncertain significancers886051663RCV000383486; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402922114029221GANC_000016.9:g.14029221G>AClinGen:CA10647747C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.1446A>G (p.Glu482=)2072ERCC4Benignrs114077770RCV000460320|RCV001117659|RCV001821352; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MedGen:CN169374161402923514029235AGNC_000016.9:g.14029235A>GClinGen:CA7910471C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.1452C>A (p.Thr484=)2072ERCC4Likely benign-1RCV002123317; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402924114029241CA14029241-
NM_005236.3(ERCC4):c.1463A>G (p.Lys488Arg)2072ERCC4Uncertain significancers886051664RCV000291469; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402925214029252AG16:g.14029252A>GClinGen:CA10646961C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.1484C>T (p.Thr495Ile)2072ERCC4Uncertain significance-1RCV001374207; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402927314029273CT14029273-
NM_005236.3(ERCC4):c.1488A>T (p.Gln496His)2072ERCC4Likely benignrs146601373RCV000120823|RCV000459235|RCV001034544|RCV001117661; NMedGen:CN169374|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84|MONDO:MONDO:0008310,MedGen:C0033300,OMIM:176670, Orphanet:740|MONDO:MONDO:0010215161402927714029277AT16:g.14029277A>TClinGen:CA158912C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.1488A>C (p.Gln496His)2072ERCC4Uncertain significancers146601373RCV001117660; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402927714029277AC16:g.14029277A>C-
NM_005236.3(ERCC4):c.1493T>C (p.Val498Ala)2072ERCC4Uncertain significance-1RCV001755281|RCV001789790; NMedGen:CN517202|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402928214029282TC14029282-
NM_005236.3(ERCC4):c.1522G>A (p.Gly508Arg)2072ERCC4Uncertain significance-1RCV001929215; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402931114029311GA14029311-
NM_005236.3(ERCC4):c.1544G>A (p.Arg515His)2072ERCC4Uncertain significance-1RCV001354216|RCV001871916; NMedGen:CN517202|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161402933314029333GA14029333-
NM_005236.3(ERCC4):c.1549G>A (p.Glu517Lys)2072ERCC4Uncertain significancers150291286RCV001340828; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402933814029338GA14029338-
NM_005236.3(ERCC4):c.1554A>C (p.Ile518=)2072ERCC4Likely benignrs768020598RCV000908879; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161402934314029343AC16:g.14029343A>C-
NM_005236.3(ERCC4):c.1558_1563del (p.Ser520_Ser521del)2072ERCC4Uncertain significance-1RCV001963720; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402934414029349AAGCAGTA14029343-
NM_005236.3(ERCC4):c.1563C>G (p.Ser521Arg)2072ERCC4Conflicting interpretations of pathogenicityrs41552412RCV000120826|RCV000343662|RCV000546465|RCV000764023|RCV001292825|RCV001355143; NMedGen:CN169374|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84|MONDO:MONDO:0010215,MedGen:C0268161402935214029352CG16:g.14029352C>GClinGen:CA158921C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.1575C>G (p.Cys525Trp)2072ERCC4Uncertain significance-1RCV001776457|RCV002034512; NMedGen:CN517202|MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402936414029364CG14029364-
NM_005236.3(ERCC4):c.1577C>T (p.Pro526Leu)2072ERCC4Uncertain significance-1RCV001869964; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402936614029366CT14029366-
NM_005236.3(ERCC4):c.1581A>T (p.Glu527Asp)2072ERCC4Uncertain significancers200649435RCV001061136|RCV001119236|RCV001292797; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272,161402937014029370AT16:g.14029370A>T-
NM_005236.3(ERCC4):c.1597G>A (p.Glu533Lys)2072ERCC4Uncertain significance-1RCV001764204; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402938614029386GA14029386-
NM_005236.3(ERCC4):c.1606G>C (p.Val536Leu)2072ERCC4Conflicting interpretations of pathogenicityrs143347563RCV000120830|RCV000989533|RCV001854624; NMedGen:CN169374|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402939514029395GC16:g.14029395G>CClinGen:CA158933CN169374 not specified;
NM_005236.3(ERCC4):c.1619C>T (p.Ser540Leu)2072ERCC4Uncertain significancers368830992RCV001043126|RCV001759957; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402940814029408CT16:g.14029408C>T-
NM_005236.3(ERCC4):c.1620G>A (p.Ser540=)2072ERCC4Uncertain significance-1RCV001898957; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402940914029409GA14029409-
NM_005236.3(ERCC4):c.1632C>T (p.Phe544=)2072ERCC4Likely benign-1RCV002135195; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402942114029421CT14029421-
NM_005236.3(ERCC4):c.1633G>A (p.Gly545Arg)2072ERCC4Uncertain significancers773007457RCV000651475; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402942214029422GA16:g.14029422G>AClinGen:CA7910505C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.1647A>C (p.Glu549Asp)2072ERCC4Uncertain significancers886051665RCV000396319; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402943614029436AC16:g.14029436A>CClinGen:CA10637026C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.1648C>T (p.Pro550Ser)2072ERCC4Uncertain significancers139197943RCV001217410; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402943714029437CT16:g.14029437C>T-
NM_005236.3(ERCC4):c.1654A>G (p.Thr552Ala)2072ERCC4Uncertain significance-1RCV001997218; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161402944314029443AG14029443-
NM_005236.3(ERCC4):c.1655C>T (p.Thr552Ile)2072ERCC4Uncertain significance-1RCV001764202|RCV001885122; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161402944414029444CT14029444-
NM_005236.3(ERCC4):c.1657A>G (p.Ile553Val)2072ERCC4Uncertain significancers376216413RCV000120824|RCV001854623; NMedGen:CN169374|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402944614029446AG16:g.14029446A>GClinGen:CA158915CN169374 not specified;
NM_005236.3(ERCC4):c.1676G>A (p.Gly559Asp)2072ERCC4Uncertain significancers370896187RCV000294613|RCV001069081; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161402946514029465GA16:g.14029465G>AClinGen:CA7910510C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.1677T>C (p.Gly559=)2072ERCC4Likely benignrs776049363RCV000472869; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402946614029466TCNC_000016.9:g.14029466T>CClinGen:CA7910511C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.1681A>T (p.Ser561Cys)2072ERCC4Uncertain significancers1443581940RCV000809426; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402947014029470AT16:g.14029470A>T-
NM_005236.3(ERCC4):c.1684G>A (p.Asp562Asn)2072ERCC4Uncertain significancers55736359RCV001058309; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402947314029473GA16:g.14029473G>A-
NM_005236.3(ERCC4):c.1691A>G (p.Tyr564Cys)2072ERCC4Uncertain significancers765254949RCV001044150; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402948014029480AG16:g.14029480A>G-
NM_005236.3(ERCC4):c.1698G>A (p.Leu566=)2072ERCC4Likely benign-1RCV001490164; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402948714029487GA14029487-
NM_005236.3(ERCC4):c.1727G>C (p.Arg576Thr)2072ERCC4Uncertain significancers1800068RCV000120831|RCV000651477|RCV001119237|RCV001294105|RCV001357601|RCV002055332; NMedGen:CN169374|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MONDO:MONDO:0014108,MedGen:C3808161402951614029516GC16:g.14029516G>CClinGen:CA158936,UniProtKB:Q92889#VAR_013397C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.1728A>T (p.Arg576Ser)2072ERCC4Uncertain significancers765454246RCV000351813|RCV001049483|RCV001292598; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191|MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272,161402951714029517AT16:g.14029517A>TClinGen:CA7910523C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.1730dup (p.Tyr577Ter)2072ERCC4Pathogenicrs397509404RCV000049249|RCV001646986|RCV001853034; NMedGen:C3806565|Human Phenotype Ontology:HP:0002497,MONDO:MONDO:0017845,MedGen:C1849156,OMIM:PS108600, Orphanet:316226|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OM161402951814029519TTA16:g.14029518_14029519insAClinGen:CA143940,OMIM:133520.0009C3806565 Xeroderma pigmentosum, type f/Cockayne syndrome;
NM_005236.3(ERCC4):c.1731del (p.Arg576_Tyr577insTer)2072ERCC4Pathogenicrs1555468482RCV000651478; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402952014029520ACA16:g.14029520_14029520delClinGen:CA658798545C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.1739T>C (p.Leu580Pro)2072ERCC4Uncertain significancers2032274770RCV001300231; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161402952814029528TC14029528-
NM_005236.3(ERCC4):c.1740T>G (p.Leu580=)2072ERCC4Uncertain significancers374556359RCV001119238; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402952914029529TG16:g.14029529T>G-
NM_005236.3(ERCC4):c.1746C>G (p.Asp582Glu)2072ERCC4Uncertain significance-1RCV001908288; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402953514029535CG14029535-
NM_005236.3(ERCC4):c.1758C>G (p.Thr586=)2072ERCC4Likely benign-1RCV002195363; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161402954714029547CG14029547-
NM_005236.3(ERCC4):c.1765C>T (p.Arg589Trp)2072ERCC4Pathogenic/Likely pathogenicrs147105770RCV000049250|RCV000700109|RCV000762956; NMedGen:C3806565|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0012590,MedGen:C1970161402955414029554CT16:g.14029554C>TOMIM:133520.0010,ClinGen:CA143941,UniProtKB:Q92889#VAR_070088C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.1787C>A (p.Ala596Glu)2072ERCC4Uncertain significancers751782722RCV000820566; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161402957614029576CA16:g.14029576C>A-
NM_005236.3(ERCC4):c.1788G>A (p.Ala596=)2072ERCC4Likely benign-1RCV002143346; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402957714029577GA14029577-
NM_005236.3(ERCC4):c.1799G>A (p.Gly600Glu)2072ERCC4Uncertain significance-1RCV001359826; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161402958814029588GA14029588-
NM_005236.3(ERCC4):c.1802A>C (p.Lys601Thr)2072ERCC4Uncertain significancers138532294RCV001294384|RCV001819982; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MedGen:CN169374161402959114029591AC14029591-
NM_005236.3(ERCC4):c.1811+9T>G2072ERCC4Likely benign-1RCV002133782; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161402960914029609TG14029609-
NM_005236.3(ERCC4):c.1812-17T>C2072ERCC4Likely benign-1RCV002109787; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161403160614031606TC14031606-
NM_005236.3(ERCC4):c.1812-5T>C2072ERCC4Conflicting interpretations of pathogenicityrs2020952RCV000651479|RCV000989534|RCV001788310; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272,161403161814031618TC16:g.14031618T>CClinGen:CA7910562C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.1830C>T (p.Tyr610=)2072ERCC4Likely benign-1RCV001408598; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161403164114031641CT14031641-
NM_005236.3(ERCC4):c.1853G>A (p.Arg618His)2072ERCC4Uncertain significance-1RCV001819576|RCV002074315|RCV001869700; NMedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161403166414031664GA14031664-
NM_005236.3(ERCC4):c.1860C>G (p.Leu620=)2072ERCC4Likely benignrs758451676RCV001200402|RCV002071856; NMedGen:CN517202|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161403167114031671CG16:g.14031671C>G-
NM_005236.3(ERCC4):c.1870C>T (p.Arg624Trp)2072ERCC4Uncertain significancers766395322RCV001302545; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161403168114031681CT14031681-
NM_005236.3(ERCC4):c.1870C>A (p.Arg624=)2072ERCC4Uncertain significancers766395322RCV001313756; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161403168114031681CA14031681-
NM_005236.3(ERCC4):c.1871G>A (p.Arg624Gln)2072ERCC4Uncertain significance-1RCV001360826; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161403168214031682GA14031682-
NM_005236.3(ERCC4):c.1882_1885del (p.Glu628fs)2072ERCC4Pathogenicrs772899497RCV001239295; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161403169014031693AAAGGA16:g.14031690_14031693del-
NM_005236.3(ERCC4):c.1884A>G (p.Glu628=)2072ERCC4Benignrs2020958RCV000402299|RCV000464997; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161403169514031695AG16:g.14031695A>GClinGen:CA7910583C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.1899C>T (p.Leu633=)2072ERCC4Likely benignrs954215121RCV000458122|RCV001490032; NMedGen:CN517202|MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161403171014031710CTNC_000016.9:g.14031710C>TClinGen:CA16615012C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.1899C>G (p.Leu633=)2072ERCC4Likely benignrs954215121RCV000558977; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161403171014031710CGNC_000016.9:g.14031710C>GClinGen:CA278474131C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.1905-35T>C2072ERCC4Benign-1RCV001661295|RCV001661294|RCV001661293|RCV001676070; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MONDO:MONDO:0012590,MedGen:C1970416,OMIM:610965|MedGen:CN517202161403854514038545TC14038545-
NM_005236.3(ERCC4):c.1905-28G>A2072ERCC4Benign-1RCV001611881|RCV001658327|RCV001658328|RCV001658329; NMedGen:CN517202|MONDO:MONDO:0012590,MedGen:C1970416,OMIM:610965|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161403855214038552GA14038552-
NM_005236.3(ERCC4):c.1905-7C>G2072ERCC4Uncertain significance-1RCV001890453; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161403857314038573CG14038573-
NM_005236.3(ERCC4):c.1917C>A (p.Ser639Arg)2072ERCC4Uncertain significancers377213481RCV001121235; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161403859214038592CA16:g.14038592C>A-
NM_005236.3(ERCC4):c.1921G>C (p.Val641Leu)2072ERCC4Uncertain significance-1RCV001965276; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161403859614038596GC14038596-
NM_005236.3(ERCC4):c.1942G>A (p.Gly648Ser)2072ERCC4Uncertain significancers369471816RCV000312288; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161403861714038617GA16:g.14038617G>AClinGen:CA7910620C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.1971A>G (p.Val657=)2072ERCC4Likely benign-1RCV001482729; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161403864614038646AG14038646-
NM_005236.3(ERCC4):c.1975G>A (p.Gly659Ser)2072ERCC4Uncertain significancers753506602RCV001337796; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161403865014038650GA14038650-
NM_005236.3(ERCC4):c.1976G>A (p.Gly659Asp)2072ERCC4Uncertain significance-1RCV001764201; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161403865114038651GA14038651-
NM_005236.3(ERCC4):c.1983A>G (p.Ala661=)2072ERCC4Likely benignrs373237850RCV000651481; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161403865814038658AGNC_000016.9:g.14038658A>GClinGen:CA7910628C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.1984T>C (p.Ser662Pro)2072ERCC4Benignrs2020955RCV000120806|RCV000355415|RCV000466960|RCV001668272; NMedGen:CN169374|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84|MedGen:CN517202161403865914038659TC16:g.14038659T>CClinGen:CA158864,UniProtKB:Q92889#VAR_014770C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.1998C>T (p.Ser666=)2072ERCC4Likely benign-1RCV001445818; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161403867314038673CT14038673-
NM_005236.3(ERCC4):c.2009G>A (p.Arg670Gln)2072ERCC4Uncertain significance-1RCV002012275; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161403868414038684GA14038684-
NM_005236.3(ERCC4):c.2016C>T (p.Ala672=)2072ERCC4Uncertain significance-1RCV002015265; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161403869114038691CT14038691-
NM_005236.3(ERCC4):c.2017+3G>A2072ERCC4Uncertain significancers1596634140RCV001245969; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161403869514038695GA16:g.14038695G>A-
NM_005236.3(ERCC4):c.2018-18C>G2072ERCC4Likely benign-1RCV002113402; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404145314041453CG14041453-
NM_005236.3(ERCC4):c.2026G>C (p.Glu676Gln)2072ERCC4Uncertain significance-1RCV002005843; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161404147914041479GC14041479-
NM_005236.3(ERCC4):c.2046A>G (p.Gln682=)2072ERCC4Likely benignrs565249189RCV000499736|RCV000530646; NMedGen:CN169374|MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161404149914041499AGNC_000016.9:g.14041499A>GClinGen:CA7910663C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.2065C>A (p.Arg689Ser)2072ERCC4Likely pathogenicrs149364215RCV000049245|RCV001067959; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161404151814041518CA16:g.14041518C>AClinGen:CA143933,UniProtKB:Q92889#VAR_070089,OMIM:133520.0005C3808988 615272 Fanconi anemia, complementation group Q;
NM_005236.3(ERCC4):c.2065C>T (p.Arg689Cys)2072ERCC4Uncertain significancers149364215RCV001121236; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404151814041518CT16:g.14041518C>T-
NM_005236.3(ERCC4):c.2087C>T (p.Pro696Leu)2072ERCC4Uncertain significance-1RCV001391664|RCV001788469|RCV001849516; NMONDO:MONDO:0012590,MedGen:C1970416,OMIM:610965; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84|MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404154014041540CT14041540-
NM_005236.3(ERCC4):c.2101C>T (p.Arg701Cys)2072ERCC4Uncertain significancers772728961RCV001226220; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161404155414041554CT16:g.14041554C>T-
NM_005236.3(ERCC4):c.2102G>A (p.Arg701His)2072ERCC4Uncertain significancers762543560RCV001063937|RCV001760034; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404155514041555GA16:g.14041555G>A-
NM_005236.3(ERCC4):c.2105G>A (p.Arg702Gln)2072ERCC4Uncertain significance-1RCV001901997; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404155814041558GA14041558-
NM_005236.3(ERCC4):c.2108G>T (p.Gly703Val)2072ERCC4Uncertain significance-1RCV001961549; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404156114041561GT14041561-
NM_005236.3(ERCC4):c.2114A>T (p.Asp705Val)2072ERCC4Uncertain significancers2032542117RCV001036389; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161404156714041567AT16:g.14041567A>T-
NM_005236.3(ERCC4):c.2117T>C (p.Ile706Thr)2072ERCC4Conflicting interpretations of pathogenicityrs1800069RCV000120815|RCV000463526|RCV001121237|RCV001332584|RCV001354835|RCV001788036; NMedGen:CN169374|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MONDO:MONDO:0012590,MedGen:C1970161404157014041570TCNC_000016.9:g.14041570T>CClinGen:CA158888,UniProtKB:Q92889#VAR_014771C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.2124C>A (p.Pro708=)2072ERCC4Likely benign-1RCV001432241; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161404157714041577CA14041577-
NM_005236.3(ERCC4):c.2124C>T (p.Pro708=)2072ERCC4Likely benign-1RCV002085698; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161404157714041577CT14041577-
NM_005236.3(ERCC4):c.2125G>A (p.Val709Met)2072ERCC4Uncertain significancers373906926RCV000543207|RCV001821616; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MedGen:CN169374161404157814041578GANC_000016.9:g.14041578G>AClinGen:CA7910685C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.2129C>A (p.Thr710Asn)2072ERCC4Uncertain significance-1RCV001930937; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161404158214041582CA14041582-
NM_005236.3(ERCC4):c.2143G>T (p.Asp715Tyr)2072ERCC4Uncertain significance-1RCV001871279; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161404159614041596GT14041596-
NM_005236.3(ERCC4):c.2156C>A (p.Thr719Asn)2072ERCC4Uncertain significance-1RCV001964260; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404160914041609CA14041609-
NM_005236.3(ERCC4):c.2169C>A (p.Cys723Ter)2072ERCC4Uncertain significancers2020959RCV000822020|RCV001194781; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191|MedGen:CN517202161404162214041622CA16:g.14041622C>A-
NM_005236.3(ERCC4):c.2169C>T (p.Cys723=)2072ERCC4Likely benign-1RCV002189440; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404162214041622CT14041622-
NM_005236.3(ERCC4):c.2175G>A (p.Glu725=)2072ERCC4Likely benign-1RCV001395285; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161404162814041628GA14041628-
NM_005236.3(ERCC4):c.2176C>T (p.Arg726Cys)2072ERCC4Uncertain significancers777184889RCV001045812; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161404162914041629CT16:g.14041629C>T-
NM_005236.3(ERCC4):c.2177G>A (p.Arg726His)2072ERCC4Uncertain significancers368096448RCV000815544; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404163014041630GA16:g.14041630G>A-
NM_005236.3(ERCC4):c.2178C>T (p.Arg726=)2072ERCC4Uncertain significancers1255618541RCV001312489|RCV001121238; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404163114041631CT16:g.14041631C>T-
NM_005236.3(ERCC4):c.2186T>C (p.Ile729Thr)2072ERCC4Uncertain significancers375860375RCV000802491|RCV001816865; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84|MedGen:CN169374161404163914041639TC16:g.14041639T>C-
NM_005236.3(ERCC4):c.2199C>T (p.Ile733=)2072ERCC4Conflicting interpretations of pathogenicityrs372425414RCV000407678|RCV000866955; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MedGen:CN517202161404165214041652CT16:g.14041652C>TClinGen:CA7910701C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.2212A>G (p.Asn738Asp)2072ERCC4Uncertain significancers2032546331RCV001068120; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404166514041665AG16:g.14041665A>G-
NM_005236.3(ERCC4):c.2218C>T (p.Arg740Cys)2072ERCC4Uncertain significancers376688194RCV000488081|RCV001205641; NMedGen:CN517202|MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161404167114041671CTNC_000016.9:g.14041671C>TClinGen:CA7910705CN517202 not provided;
NM_005236.3(ERCC4):c.2223C>T (p.Leu741=)2072ERCC4Likely benign-1RCV001485623; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161404167614041676CT14041676-
NM_005236.3(ERCC4):c.2226C>T (p.Tyr742=)2072ERCC4Likely benign-1RCV002123876; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404167914041679CT14041679-
NM_005236.3(ERCC4):c.2236A>G (p.Ile746Val)2072ERCC4Uncertain significance-1RCV002034990; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161404168914041689AG14041689-
NM_005236.3(ERCC4):c.2238C>G (p.Ile746Met)2072ERCC4Uncertain significance-1RCV001764199; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404169114041691CG14041691-
NM_005236.3(ERCC4):c.2248C>T (p.Arg750Cys)2072ERCC4Conflicting interpretations of pathogenicityrs374978891RCV001211525|RCV001644951; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84|Human Phenotype Ontology:HP:0002497,MONDO:MONDO:0017845,MedGen:C1849156,OMIM:PS108600, Orphanet:3161404170114041701CT16:g.14041701C>T-
NM_005236.3(ERCC4):c.2260C>T (p.Arg754Cys)2072ERCC4Uncertain significance-1RCV001906489; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161404171314041713CT14041713-
NM_005236.3(ERCC4):c.2265C>T (p.Pro755=)2072ERCC4Likely benign-1RCV001444794; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161404171814041718CT14041718-
NM_005236.3(ERCC4):c.2266G>A (p.Val756Met)2072ERCC4Uncertain significancers201501958RCV000297698|RCV001859895; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161404171914041719GA16:g.14041719G>AClinGen:CA7910715C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.2288C>T (p.Pro763Leu)2072ERCC4Uncertain significancers761087753RCV000690508; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404174114041741CTNC_000016.9:g.14041741C>T-C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.2290A>G (p.Ser764Gly)2072ERCC4Uncertain significancers146764714RCV001071450|RCV001819796; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191|MedGen:CN169374161404174314041743AG16:g.14041743A>G-
NM_005236.3(ERCC4):c.2292C>T (p.Ser764=)2072ERCC4Conflicting interpretations of pathogenicityrs139406689RCV000354867|RCV000863529|RCV001820940; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191|MedGen:CN169374161404174514041745CT16:g.14041745C>TClinGen:CA7910719C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.2295G>T (p.Lys765Asn)2072ERCC4Uncertain significancers1567253853RCV000809506; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161404174814041748GT16:g.14041748G>T-
NM_005236.3(ERCC4):c.2304_2307del (p.Thr770fs)2072ERCC4Pathogenicrs869025184RCV000018047; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404175314041756TTCTCTNC_000016.9:g.14041753TC[2]ClinGen:CA351495,OMIM:133520.0001C0268140 278760 Xeroderma pigmentosum, group F;
NM_005236.3(ERCC4):c.2303C>G (p.Ser768Cys)2072ERCC4Uncertain significance-1RCV001764198; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404175614041756CG14041756-
NM_005236.3(ERCC4):c.2307C>T (p.Leu769=)2072ERCC4Likely benign-1RCV002078917; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161404176014041760CT14041760-
NM_005236.3(ERCC4):c.2308A>T (p.Thr770Ser)2072ERCC4Uncertain significancers2032550979RCV001325597; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161404176114041761AT14041761-
NM_005236.3(ERCC4):c.2334G>C (p.Glu778Asp)2072ERCC4Uncertain significancers886051666RCV000267041; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404178714041787GC16:g.14041787G>CClinGen:CA10637050C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.2339C>G (p.Ser780Cys)2072ERCC4Uncertain significance-1RCV001764196; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404179214041792CG14041792-
NM_005236.3(ERCC4):c.2371_2398dup (p.Ile800fs)2072ERCC4Likely pathogenicrs397509401RCV000049246|RCV001310216; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404182314041824TTCTTACACTTCACTTCCCCAGACTACGGA16:g.14041823_14041824insCTTACACTTCACTTCCCCAGACTACGGAClinGen:CA143935,OMIM:133520.0006C3808988 615272 Fanconi anemia, complementation group Q;
NM_005236.3(ERCC4):c.2387C>T (p.Pro796Leu)2072ERCC4Uncertain significance-1RCV001967301; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161404184014041840CT14041840-
NM_005236.3(ERCC4):c.2394A>G (p.Leu798=)2072ERCC4Likely benign-1RCV001449432; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161404184714041847AG14041847-
NM_005236.3(ERCC4):c.2395C>T (p.Arg799Trp)2072ERCC4Conflicting interpretations of pathogenicityrs121913049RCV000018048|RCV000120808|RCV000415873|RCV000467658|RCV000768209|RCV000766208|RCV001034542|RCV001262417|RCV001391196|RCV001787804; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191|MONDO:MONDO:0014161404184814041848CT16:g.14041848C>TClinGen:CA126686,UniProtKB:Q92889#VAR_005850,OMIM:133520.0002,OMIM:133520.0011C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.2421T>C (p.His807=)2072ERCC4Likely benign-1RCV001467063; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404187414041874TC14041874-
NM_005236.3(ERCC4):c.2423C>G (p.Ala808Gly)2072ERCC4Uncertain significancers746576915RCV000812059; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161404187614041876CG16:g.14041876C>G-
NM_005236.3(ERCC4):c.2427G>A (p.Thr809=)2072ERCC4Conflicting interpretations of pathogenicityrs2020960RCV000503360|RCV000651480; NMedGen:CN169374|MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161404188014041880GANC_000016.9:g.14041880G>AClinGen:CA7910736C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.2430G>A (p.Ala810=)2072ERCC4Uncertain significancers770255135RCV001306009; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404188314041883GA14041883-
NM_005236.3(ERCC4):c.2434T>C (p.Leu812=)2072ERCC4Likely benign-1RCV002076886; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161404188714041887TC14041887-
NM_005236.3(ERCC4):c.2436G>A (p.Leu812=)2072ERCC4Likely benign-1RCV001405491; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161404188914041889GA14041889-
NM_005236.3(ERCC4):c.2448G>A (p.Leu816=)2072ERCC4Likely benign-1RCV001474103; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161404190114041901GA14041901-
NM_005236.3(ERCC4):c.2452C>G (p.Gln818Glu)2072ERCC4Uncertain significance-1RCV002006264; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404190514041905CG14041905-
NM_005236.3(ERCC4):c.2463A>G (p.Pro821=)2072ERCC4Benignrs2020953RCV000229024|RCV000324572; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404191614041916AG16:g.14041916A>GClinGen:CA7910745C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.2466G>A (p.Gln822=)2072ERCC4Likely benign-1RCV002183351; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161404191914041919GA14041919-
NM_005236.3(ERCC4):c.2474C>T (p.Ala825Val)2072ERCC4Uncertain significancers765253522RCV001056707; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161404192714041927CT16:g.14041927C>T-
NM_005236.3(ERCC4):c.2475G>A (p.Ala825=)2072ERCC4Likely benignrs200818432RCV000861366|RCV002064432; NMedGen:CN517202|MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161404192814041928GA16:g.14041928G>A-
NM_005236.3(ERCC4):c.2477C>T (p.Ala826Val)2072ERCC4Uncertain significancers141790888RCV000120809|RCV001296332; NMedGen:CN169374|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161404193014041930CT16:g.14041930C>TClinGen:CA158870CN169374 not specified;
NM_005236.3(ERCC4):c.2478G>A (p.Ala826=)2072ERCC4Likely benign-1RCV001444776; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161404193114041931GA14041931-
NM_005236.3(ERCC4):c.2500G>T (p.Asp834Tyr)2072ERCC4Uncertain significancers138583819RCV000358179; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404195314041953GT16:g.14041953G>TClinGen:CA7910754C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.2505T>C (p.Ser835=)2072ERCC4Benignrs1799801RCV000116988|RCV000265728|RCV001514330|RCV001657726|RCV001657727|RCV001650957; NMedGen:CN169374|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191|MONDO:MONDO:0012590,MedGen:C1970161404195814041958TC16:g.14041958T>CClinGen:CA152756CN169374 not specified;
NM_005236.3(ERCC4):c.2514T>C (p.Leu838=)2072ERCC4Uncertain significancers200069811RCV001116323; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404196714041967TC16:g.14041967T>C-
NM_005236.3(ERCC4):c.2517C>T (p.Pro839=)2072ERCC4Likely benignrs200715555RCV000868618|RCV002064590; NMedGen:CN517202|MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404197014041970CT16:g.14041970C>T-
NM_005236.3(ERCC4):c.2519A>C (p.Glu840Ala)2072ERCC4Uncertain significancers761699907RCV000327964; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404197214041972AC16:g.14041972A>CClinGen:CA7910762C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.2534A>G (p.Asn845Ser)2072ERCC4Uncertain significancers377562755RCV001060645; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404198714041987AG16:g.14041987A>G-
NM_005236.3(ERCC4):c.2545C>G (p.Gln849Glu)2072ERCC4Likely benignrs374186605RCV000120810|RCV000535348; NMedGen:CN169374|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161404199814041998CG16:g.14041998C>GClinGen:CA158873C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.2546A>T (p.Gln849Leu)2072ERCC4Uncertain significancers750999717RCV001213577; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161404199914041999AT16:g.14041999A>T-
NM_005236.3(ERCC4):c.2574G>A (p.Val858=)2072ERCC4Likely benign-1RCV002209893; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161404202714042027GA14042027-
NM_005236.3(ERCC4):c.2575A>T (p.Asn859Tyr)2072ERCC4Uncertain significancers2032559742RCV001216191; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161404202814042028AT16:g.14042028A>T-
NM_005236.3(ERCC4):c.2579C>A (p.Ala860Asp)2072ERCC4Likely benignrs4986933RCV000120811|RCV000476568|RCV000989535|RCV001034545; NMedGen:CN169374|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MONDO:MONDO:0008310,MedGen:C0033161404203214042032CA16:g.14042032C>AClinGen:CA158876,UniProtKB:Q92889#VAR_057479C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.2588G>C (p.Cys863Ser)2072ERCC4Uncertain significancers749822053RCV001062344; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404204114042041GC16:g.14042041G>C-
NM_005236.3(ERCC4):c.2590C>T (p.Arg864Cys)2072ERCC4Uncertain significancers587778284RCV000120812|RCV001854622; NMedGen:CN169374|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161404204314042043CT16:g.14042043C>TClinGen:CA158879CN169374 not specified;
NM_005236.3(ERCC4):c.2591G>A (p.Arg864His)2072ERCC4Uncertain significancers1211543560RCV000651471; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161404204414042044GANC_000016.9:g.14042044G>AClinGen:CA394824523C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.2603A>C (p.His868Pro)2072ERCC4Uncertain significancers368064765RCV000800130; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161404205614042056AC16:g.14042056A>C-
NM_005236.3(ERCC4):c.2603A>G (p.His868Arg)2072ERCC4Uncertain significancers368064765RCV000800877; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161404205614042056AG16:g.14042056A>G-
NM_005236.3(ERCC4):c.2607C>T (p.His869=)2072ERCC4Likely benign-1RCV001453717|RCV001820144; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84|MedGen:CN169374161404206014042060CT14042060-
NM_005236.3(ERCC4):c.2617A>G (p.Ile873Val)2072ERCC4Benign/Likely benignrs2020957RCV000120807|RCV000514744|RCV001086582|RCV001117766; NMedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404207014042070AGNC_000016.9:g.14042070A>GClinGen:CA158867,UniProtKB:Q92889#VAR_019201C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.2619C>T (p.Ile873=)2072ERCC4Likely benign-1RCV001503215; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161404207214042072CT14042072-
NM_005236.3(ERCC4):c.2619C>G (p.Ile873Met)2072ERCC4Uncertain significance-1RCV002003930; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404207214042072CG14042072-
NM_005236.3(ERCC4):c.2620G>A (p.Ala874Thr)2072ERCC4Uncertain significancers2032561804RCV001222762; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161404207314042073GA16:g.14042073G>A-
NM_005236.3(ERCC4):c.2621C>T (p.Ala874Val)2072ERCC4Uncertain significancers766946690RCV001207464; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161404207414042074CT16:g.14042074C>T-
NM_005236.3(ERCC4):c.2624A>G (p.Glu875Gly)2072ERCC4Benign/Likely benignrs1800124RCV000116989|RCV000224428|RCV000228558|RCV000210773|RCV001117767; NMedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162161404207714042077AG16:g.14042077A>GClinGen:CA152759,UniProtKB:Q92889#VAR_013408C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.2646C>T (p.Asp882=)2072ERCC4Likely benign-1RCV002133182; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161404209914042099CT14042099-
NM_005236.3(ERCC4):c.2647G>A (p.Glu883Lys)2072ERCC4Likely benignrs201652412RCV000864380|RCV000989536|RCV001358163; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MedGen:CN517202161404210014042100GA16:g.14042100G>A-
NM_005236.3(ERCC4):c.2655G>A (p.Thr885=)2072ERCC4Benignrs16963255RCV000242822|RCV000384807|RCV000464766|RCV001689851; NMedGen:CN169374|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191|MedGen:CN517202161404210814042108GANC_000016.9:g.14042108G>AClinGen:CA7910790C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.2674G>A (p.Ala892Thr)2072ERCC4Uncertain significance-1RCV001911173; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404212714042127GA14042127-
NM_005236.3(ERCC4):c.2677A>G (p.Asn893Asp)2072ERCC4Uncertain significancers201926295RCV000702604|RCV000989537|RCV001785705|RCV001816729; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MedGen:CN517202|MedGen:CN169374161404213014042130AG16:g.14042130A>G-C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.2693A>G (p.Tyr898Cys)2072ERCC4Uncertain significance-1RCV001962849; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161404214614042146AG14042146-
NM_005236.3(ERCC4):c.2694T>C (p.Tyr898=)2072ERCC4Likely benignrs138296474RCV000503387|RCV002060113; NMedGen:CN169374|MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161404214714042147TCNC_000016.9:g.14042147T>CClinGen:CA7910793CN169374 not specified;
NM_005236.3(ERCC4):c.2700C>T (p.Phe900=)2072ERCC4Likely benignrs191674905RCV000862335; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161404215314042153CT16:g.14042153C>T-
NM_005236.3(ERCC4):c.2723T>A (p.Val908Asp)2072ERCC4Uncertain significance-1RCV001918916; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84161404217614042176TA14042176-
NM_005236.3(ERCC4):c.2724C>T (p.Val908=)2072ERCC4Benign/Likely benignrs3136225RCV000246670|RCV000288466|RCV000462759|RCV001531228; NMedGen:CN169374|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191|MedGen:CN517202161404217714042177CTNC_000016.9:g.14042177C>TClinGen:CA7910801C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.2725G>A (p.Val909Ile)2072ERCC4Uncertain significancers140726146RCV000795980|RCV000999524|RCV001270126; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84|MedGen:CN517202|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404217814042178GA16:g.14042178G>A-
NM_005236.3(ERCC4):c.2726T>C (p.Val909Ala)2072ERCC4Uncertain significance-1RCV001764195; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404217914042179TC14042179-
NM_005236.3(ERCC4):c.2734G>A (p.Gly912Arg)2072ERCC4Conflicting interpretations of pathogenicityrs150077735RCV000120814|RCV000474309|RCV001356061; NMedGen:CN169374|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84|MedGen:CN517202161404218714042187GA16:g.14042187G>AClinGen:CA158885C0009207 Cockayne syndrome;
NM_005236.3(ERCC4):c.2735G>A (p.Gly912Glu)2072ERCC4Uncertain significancers2020956RCV001071419; NMONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760; MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191161404218814042188GA16:g.14042188G>A-
NM_005236.3(ERCC4):c.2738A>G (p.Lys913Arg)2072ERCC4Uncertain significancers2032565777RCV001231920; NMONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191; MONDO:MONDO:0014108,MedGen:C3808988,OMIM:615272, Orphanet:84; MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404219114042191AG16:g.14042191A>G-
NM_005236.3(ERCC4):c.*11C>T2072ERCC4Benignrs9929524RCV000250244|RCV000327126|RCV001660278; NMedGen:CN169374|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760|MedGen:CN517202161404221514042215CTNC_000016.9:g.14042215C>TClinGen:CA7910813CN169374 not specified;
NM_005236.3(ERCC4):c.*106A>G2072ERCC4Uncertain significancers983200560RCV001117768; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404231014042310AG16:g.14042310A>G-
NM_005236.3(ERCC4):c.*150T>C2072ERCC4Uncertain significancers886051667RCV000388735; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404235414042354TC16:g.14042354T>CClinGen:CA10637052C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*192T>C2072ERCC4Uncertain significancers536552167RCV000296569; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404239614042396TC16:g.14042396T>CClinGen:CA10637053C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*218A>G2072ERCC4Uncertain significancers879319131RCV001119324; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404242214042422AG16:g.14042422A>G-
NM_005236.3(ERCC4):c.*248G>T2072ERCC4Uncertain significancers541600279RCV000387565; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404245214042452GT16:g.14042452G>TClinGen:CA10642908C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*248G>A2072ERCC4Uncertain significancers541600279RCV000349389; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404245214042452GA16:g.14042452G>AClinGen:CA10646965C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*384A>G2072ERCC4Uncertain significancers886051668RCV000281423; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404258814042588AG16:g.14042588A>GClinGen:CA10642914C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*411C>T2072ERCC4Uncertain significancers141279442RCV001119325; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404261514042615CT16:g.14042615C>T-
NM_005236.3(ERCC4):c.*484G>T2072ERCC4Benignrs3743538RCV000338839; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404268814042688GT16:g.14042688G>TClinGen:CA10646967C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*539G>A2072ERCC4Uncertain significancers565318315RCV000398977; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404274314042743GA16:g.14042743G>AClinGen:CA10637059C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*558A>C2072ERCC4Likely benignrs376791839RCV000303898; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404276214042762ACNC_000016.9:g.14042762A>CClinGen:CA10637063C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*630C>T2072ERCC4Uncertain significancers1408482875RCV001121343; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404283414042834CT16:g.14042834C>T-
NM_005236.3(ERCC4):c.*674G>C2072ERCC4Benignrs1651204RCV000342516; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404287814042878GCNC_000016.9:g.14042878G>CClinGen:CA10647756C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*675G>T2072ERCC4Likely benignrs1651203RCV000399809; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404287914042879GTNC_000016.9:g.14042879G>TClinGen:CA10642923C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*701A>T2072ERCC4Likely benignrs146955145RCV001121344; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404290514042905AT16:g.14042905A>T-
NM_005236.3(ERCC4):c.*712A>G2072ERCC4Uncertain significancers2032580067RCV001121345; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404291614042916AG16:g.14042916A>G-
NM_005236.3(ERCC4):c.*726G>C2072ERCC4Benignrs2276464RCV000302862; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404293014042930GCNC_000016.9:g.14042930G>CClinGen:CA10646969C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*745A>G2072ERCC4Uncertain significancers541739848RCV000364610; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404294914042949AGNC_000016.9:g.14042949A>GClinGen:CA10647757C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*810G>A2072ERCC4Benignrs2276465RCV000269593; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404301414043014GANC_000016.9:g.14043014G>AClinGen:CA10646973C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*859A>C2072ERCC4Uncertain significancers886051669RCV000310630; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404306314043063ACNC_000016.9:g.14043063A>CClinGen:CA10637066C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*875A>G2072ERCC4Uncertain significancers886051670RCV000365263; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404307914043079AGNC_000016.9:g.14043079A>GClinGen:CA10642924C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*947T>C2072ERCC4Likely benignrs117293226RCV000275355; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404315114043151TCNC_000016.9:g.14043151T>CClinGen:CA10637067C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*971C>G2072ERCC4Benignrs2276466RCV000330321; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404317514043175CGNC_000016.9:g.14043175C>GClinGen:CA10637068C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*1056A>G2072ERCC4Likely benignrs72781468RCV001116423; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404326014043260AG16:g.14043260A>G-
NM_005236.3(ERCC4):c.*1251T>C2072ERCC4Uncertain significancers532485638RCV000389588; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404345514043455TCNC_000016.9:g.14043455T>CClinGen:CA10647758C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*1256G>C2072ERCC4Uncertain significancers373479879RCV001116424; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404346014043460GC16:g.14043460G>C-
NM_005236.3(ERCC4):c.*1288G>A2072ERCC4Uncertain significancers143188036RCV001117872; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404349214043492GA16:g.14043492G>A-
NM_005236.3(ERCC4):c.*1353G>A2072ERCC4Likely benignrs77401662RCV001117873; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404355714043557GA16:g.14043557G>A-
NM_005236.3(ERCC4):c.*1421G>T2072ERCC4Benignrs76447723RCV000276328; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404362514043625GTNC_000016.9:g.14043625G>TClinGen:CA10647760C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*1463C>T2072ERCC4Uncertain significancers886051671RCV000317354; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404366714043667CTNC_000016.9:g.14043667C>TClinGen:CA10646974C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*1472C>T2072ERCC4Benignrs112742002RCV001117874; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404367614043676CT16:g.14043676C>T-
NM_005236.3(ERCC4):c.*1478T>C2072ERCC4Uncertain significancers754423213RCV001117875; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404368214043682TC16:g.14043682T>C-
NM_005236.3(ERCC4):c.*1635G>A2072ERCC4Uncertain significancers1466776661RCV001117876; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404383914043839GA16:g.14043839G>A-
NM_005236.3(ERCC4):c.*1676G>A2072ERCC4Uncertain significancers960247338RCV001117877; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404388014043880GA16:g.14043880G>A-
NM_005236.3(ERCC4):c.*1708G>A2072ERCC4Likely benignrs528435639RCV000372133; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404391214043912GANC_000016.9:g.14043912G>AClinGen:CA10642926C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*1774C>T2072ERCC4Uncertain significancers772694607RCV000282313; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404397814043978CTNC_000016.9:g.14043978C>TClinGen:CA10642928C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*1796T>C2072ERCC4Uncertain significancers565142105RCV000337072; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404400014044000TCNC_000016.9:g.14044000T>CClinGen:CA10646976C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*1858C>T2072ERCC4Uncertain significancers775803860RCV000377700; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404406214044062CTNC_000016.9:g.14044062C>TClinGen:CA10647770C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*1880C>T2072ERCC4Benignrs112776898RCV000283078; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404408414044084CTNC_000016.9:g.14044084C>TClinGen:CA10647771C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*1897A>C2072ERCC4Uncertain significancers886051672RCV000342726; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404410114044101ACNC_000016.9:g.14044101A>CClinGen:CA10646978C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*1915A>G2072ERCC4Uncertain significancers910231660RCV001119430; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404411914044119AG16:g.14044119A>G-
NM_005236.3(ERCC4):c.*1981C>T2072ERCC4Uncertain significancers1047686990RCV001119431; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404418514044185CT16:g.14044185C>T-
NM_005236.3(ERCC4):c.*2072T>G2072ERCC4Uncertain significancers2032608833RCV001121420; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404427614044276TG16:g.14044276T>G-
NM_005236.3(ERCC4):c.*2139A>C2072ERCC4Likely benignrs140019040RCV000397371; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404434314044343ACNC_000016.9:g.14044343A>CClinGen:CA10637072C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*2174A>G2072ERCC4Benignrs9925509RCV000307948; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404437814044378AGNC_000016.9:g.14044378A>GClinGen:CA10647774C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*2180G>A2072ERCC4Uncertain significancers886051673RCV000344030; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404438414044384GANC_000016.9:g.14044384G>AClinGen:CA10637076C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*2240A>G2072ERCC4Uncertain significancers886051674RCV000399293; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404444414044444AGNC_000016.9:g.14044444A>GClinGen:CA10647777C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*2255G>A2072ERCC4Uncertain significancers886051675RCV000308598; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404445914044459GANC_000016.9:g.14044459G>AClinGen:CA10647778C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*2415A>G2072ERCC4Uncertain significancers549968233RCV001121421; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404461914044619AG16:g.14044619A>G-
NM_005236.3(ERCC4):c.*2423A>G2072ERCC4Uncertain significancers886051676RCV000367920; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404462714044627AGNC_000016.9:g.14044627A>GClinGen:CA10647780C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*2455G>T2072ERCC4Uncertain significancers1406055423RCV001116526; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404465914044659GT16:g.14044659G>T-
NM_005236.3(ERCC4):c.*2463C>G2072ERCC4Uncertain significancers895959283RCV001116527; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404466714044667CG16:g.14044667C>G-
NM_005236.3(ERCC4):c.*2513C>A2072ERCC4Benignrs11075223RCV000273445; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404471714044717CANC_000016.9:g.14044717C>AClinGen:CA10642929C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*2539A>G2072ERCC4Benignrs115526695RCV001116528; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404474314044743AG16:g.14044743A>G-
NM_005236.3(ERCC4):c.*2572C>G2072ERCC4Uncertain significancers979385159RCV001116529; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404477614044776CG16:g.14044776C>G-
NM_005236.3(ERCC4):c.*2577C>A2072ERCC4Benign/Likely benignrs56012340RCV000194891|RCV000369259; NMedGen:CN169374|MONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404478114044781CANC_000016.9:g.14044781C>AClinGen:CA209356CN169374 not specified;
NM_005236.3(ERCC4):c.*2588A>G2072ERCC4Uncertain significancers188840787RCV000260743; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404479214044792AG16:g.14044792A>GClinGen:CA10646981C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*2659T>C2072ERCC4Uncertain significancers886051677RCV000315948; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404486314044863TC16:g.14044863T>CClinGen:CA10637078C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*2710C>T2072ERCC4Uncertain significancers1009636631RCV001117979; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404491414044914CT16:g.14044914C>T-
NM_005236.3(ERCC4):c.*2712C>T2072ERCC4Uncertain significancers552190642RCV001117980; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404491614044916CT16:g.14044916C>T-
NM_005236.3(ERCC4):c.*2744T>A2072ERCC4Benignrs12325236RCV001117981; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404494814044948TA16:g.14044948T>A-
NM_005236.3(ERCC4):c.*2759C>T2072ERCC4Uncertain significancers776910274RCV000375160; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404496314044963CT16:g.14044963C>TClinGen:CA10647781C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*2816A>T2072ERCC4Likely benignrs146325817RCV001117982; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404502014045020AT16:g.14045020A>T-
NM_005236.3(ERCC4):c.*2825A>T2072ERCC4Uncertain significancers2032623031RCV001117983; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404502914045029AT16:g.14045029A>T-
NM_005236.3(ERCC4):c.*2849G>A2072ERCC4Uncertain significancers567543133RCV001117984; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404505314045053GA16:g.14045053G>A-
NM_005236.3(ERCC4):c.*2872A>C2072ERCC4Uncertain significancers886051678RCV000265952; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404507614045076AC16:g.14045076A>CClinGen:CA10647783C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*2879A>C2072ERCC4Uncertain significancers181178937RCV000321089; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404508314045083ACNC_000016.9:g.14045083A>CClinGen:CA10647785C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*2892C>G2072ERCC4Uncertain significancers376334296RCV001119517; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404509614045096CG16:g.14045096C>G-
NM_005236.3(ERCC4):c.*3032G>T2072ERCC4Benignrs4781562RCV000380253; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404523614045236GT16:g.14045236G>TClinGen:CA10637089C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*3044A>C2072ERCC4Uncertain significancers886051679RCV000285923; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404524814045248AC16:g.14045248A>CClinGen:CA10647790C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*3071T>C2072ERCC4Uncertain significancers886051680RCV000326683; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404527514045275TC16:g.14045275T>CClinGen:CA10642930C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*3125A>G2072ERCC4Benignrs115183774RCV000381289; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404532914045329AG16:g.14045329A>GClinGen:CA10646983C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*3130T>C2072ERCC4Uncertain significancers189232031RCV000291659; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404533414045334TC16:g.14045334T>CClinGen:CA10647791C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*3195G>A2072ERCC4Benignrs4781563RCV000346605; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404539914045399GA16:g.14045399G>AClinGen:CA10647794C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*3200A>G2072ERCC4Likely benignrs8056393RCV000394915; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404540414045404AG16:g.14045404A>GClinGen:CA10646989C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*3230C>G2072ERCC4Uncertain significancers2032630522RCV001121518; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404543414045434CG16:g.14045434C>G-
NM_005236.3(ERCC4):c.*3282C>G2072ERCC4Uncertain significancers2032631201RCV001121519; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404548614045486CG16:g.14045486C>G-
NM_005236.3(ERCC4):c.*3319G>A2072ERCC4Uncertain significancers567578149RCV001121520; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404552314045523GA16:g.14045523G>A-
NM_005236.3(ERCC4):c.*3327A>G2072ERCC4Benignrs535056033RCV000293117; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404553114045531AG16:g.14045531A>GClinGen:CA10646990C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*3439G>A2072ERCC4Likely benignrs192113185RCV000352623; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404564314045643GA16:g.14045643G>AClinGen:CA10637091C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*3443G>A2072ERCC4Uncertain significancers1023910862RCV001121521; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404564714045647GA16:g.14045647G>A-
NM_005236.3(ERCC4):c.*3493T>C2072ERCC4Benignrs79560972RCV000402317; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404569714045697TC16:g.14045697T>CClinGen:CA10647799C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*3537C>T2072ERCC4Likely benignrs113073720RCV000299131; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404574114045741CT16:g.14045741C>TClinGen:CA10637095C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*3542T>C2072ERCC4Uncertain significancers886051681RCV000354023; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404574614045746TC16:g.14045746T>CClinGen:CA10646991C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*3727G>T2072ERCC4Likely benignrs560338292RCV001116634; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404593114045931GT16:g.14045931G>T-
NM_005236.3(ERCC4):c.*3753C>G2072ERCC4Uncertain significancers886051682RCV000401093; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404595714045957CG16:g.14045957C>GClinGen:CA10647800C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*3801C>T2072ERCC4Benignrs113403633RCV000300294; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404600514046005CTNC_000016.9:g.14046005C>TClinGen:CA10646992C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*3818G>A2072ERCC4Uncertain significancers886051683RCV000358724; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404602214046022GANC_000016.9:g.14046022G>AClinGen:CA10647802C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*3911C>T2072ERCC4Likely benignrs552082015RCV001116635; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404611514046115CT16:g.14046115C>T-
NM_005236.3(ERCC4):c.*3913G>C2072ERCC4Benignrs112259692RCV000263984; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404611714046117GCNC_000016.9:g.14046117G>CClinGen:CA10637097C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*3921A>C2072ERCC4Uncertain significancers773246781RCV000323834; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404612514046125ACNC_000016.9:g.14046125A>CClinGen:CA10647806C0043346 Xeroderma pigmentosum;
NM_005236.3(ERCC4):c.*3965G>A2072ERCC4Uncertain significancers1177954651RCV001118077; NMONDO:MONDO:0010215,MedGen:C0268140,OMIM:278760161404616914046169GA16:g.14046169G>A-
MSeqDR Portal