MSeqDR Mitochondrial Disease Portal

*:HP: HPO terms, UMDF: 1= Disease, ND: NAMDC terms.
  Most Studied  CPEO, Complex I Deficiency, COXPD1, Leigh, LHON, MELAS, MERRF, Myopathy, SANDO
Disease Browser
Parent Node:
DNA Repair-Deficiency Disorders (D049914)
Parent Node:
Photosensitivity Disorders (D010787)
Parent Node:
Pigmentation Disorders (D010859)
Parent Node:
Precancerous Conditions (D011230)
Parent Node:
Skin Abnormalities (D012868)
Parent Node:
Skin Diseases, Genetic (D012873)
..Starting node
Xeroderma Pigmentosum (D014983)

       Child Nodes:
........expandDe Sanctis-Cacchione syndrome (C535992)
........expandTrichothiodystrophy, Type 1 (C564734)
........expandXeroderma Pigmentosum B-Cockayne Syndrome (C567061)
........expandXeroderma Pigmentosum IX (C564731)
........expandXeroderma Pigmentosum, Autosomal Dominant, Mild (C565989)
........expandXeroderma Pigmentosum, Complementation Group B (C562590)
........expandXeroderma Pigmentosum, Complementation Group C (C567886)
........expandXeroderma Pigmentosum, Complementation Group D (C562591)
........expandXeroderma Pigmentosum, Complementation Group E (C564732)
........expandXeroderma Pigmentosum, Complementation Group F (C562592)
........expandXeroderma Pigmentosum, Complementation Group G (C562593)
........expandXeroderma pigmentosum, type 9 (C536765)
........expandXeroderma Pigmentosum, Type G-Cockayne Syndrome (C566879)
........expandXeroderma pigmentosum, variant type (C536766)
........expandXFE Progeroid Syndrome (C567043)

 Sister Nodes: 
..expandActinic Prurigo (C566780)
..expandAlbinism (D000417) Child30
..expandAmyloidosis IX (C562643)
..expandAmyloidosis, Cutaneous Bullous (C562644)
..expandAmyloidosis, Primary Cutaneous (C562642)
..expandAnnular Erythema (C562461)
..expandArterial Tortuosity Syndrome (C565942)
..expandAtrophia Maculosa Varioliformis Cutis, Familial (C563349)
..expandBasaloid Follicular Hamartoma Syndrome, Generalized, Autosomal Dominant (C565284)
..expandBuschke-Ollendorff syndrome (C537415)
..expandCollagenosis, Familial Reactive Perforating (C565687)
..expandCutis Laxa (D003483) Child17
..expandDarier Disease (D007644) Child7
..expandDermatitis, Atopic (D003876) Child9
..expandDowling-Degos Disease (C562924)
..expandDyschromatosis universalis hereditaria (C535730)
..expandDyschromatosis Universalis Hereditaria 1 (C567273)
..expandDyschromatosis Universalis Hereditaria 2 (C567194)
..expandDyskeratosis Congenita (D019871) Child3
..expandEctodermal Dysplasia (D004476) Child144  LSDB C:1
..expandEhlers-Danlos Syndrome (D004535) Child23
..expandEpidermolysis Bullosa (D004820) Child29
..expandErythrokeratodermia Variabilis (D056266) Child3
..expandErythrokeratodermia with ataxia (C535738)
..expandExfoliative Ichthyosis, Autosomal Recessive, Ichthyosis Bullosa of Siemens-like (C564309)
..expandFingerprints, Absence of (C565010)
..expandFollicular Atrophoderma, Perioral Pigmented, with Milia and Epidermoid Cysts (C566360)
..expandGerodermia osteodysplastica (C537799)
..expandHereditary Autoinflammatory Diseases (D056660) Child10
..expandHistiocytic Dermatoarthritis (C564183)
..expandHyalinosis, Systemic (D057770)
..expandHyaluronan Metabolism, Defect in (C565742)
..expandIchthyosiform Erythroderma, Congenital (D016113) Child18
..expandIchthyosis Bullosa of Siemens (D053560)
..expandIchthyosis Vulgaris (D016112) Child1
..expandIchthyosis, X-Linked (D016114) Child2
..expandIncontinentia Pigmenti (D007184) Child2
..expandJuvenile Spring Eruption of Ears (C566781)
..expandKeratoderma, Palmoplantar (D007645) Child45
..expandKeratolytic winter erythema (C536155)
..expandKeratosis Follicularis Spinulosa Decalvans, X-Linked (C536159)
..expandKeratosis Linearis with Ichthyosis Congenita and Sclerosing Keratoderma (C566600)
..expandLeukokeratosis, Hereditary Mucosal (D053529)
..expandLeukomelanoderma, Infantilism, Mental Retardation, Hypodontia, Hypotrichosis (C565440)
..expandLipoid Proteinosis of Urbach and Wiethe (D008065)
..expandMonilethrix (D056734) Child1
..expandMuir-Torre Syndrome (D055653)
..expandNetherton Syndrome (D056770)
..expandNoduli Cutanei, Multiple, with Urinary Tract Abnormalities (C563512)
..expandOculotrichodysplasia (C564934)
..expandOnychogryposis, Pedal, with Keratosis Plantaris and Coarse Hair (C563506)
..expandOrofaciodigital syndrome 9 (C557818)
..expandOsseous Heteroplasia, Progressive (C562735)
..expandOsteopoikilosis, Isolated (C563484)
..expandParana Hard Skin Syndrome (C564905)
..expandPeeling Skin Syndrome (C564818)
..expandPemphigus, Benign Familial (D016506)
..expandPerifolliculitis Capitis Abscedens Et Suffodiens, Familial (C562486)
..expandPigmentary Disorder, Reticulate, with Systemic Manifestations (C564461)
..expandPlasminogen Deficiency, Type I (C566897)
..expandPoikiloderma, Hereditary Sclerosing (C562824)
..expandPorokeratosis (D017499) Child7
..expandPorphyria, Erythropoietic (D017092)
..expandPorphyrias, Hepatic (D017094) Child14
..expandProlidase Deficiency (D056732)
..expandPseudoxanthoma Elasticum (D011561) Child2
..expandRothmund-Thomson Syndrome (D011038) Child5
..expandSjogren-Larsson Syndrome (D016111) Child1
..expandSkin Fragility-Woolly Hair Syndrome (C564359)
..expandStiff Skin Syndrome (C566112)
..expandStorm Syndrome (C566109)
..expandTrichothiodystrophy Syndromes (D054463) Child5
..expandVitiligo, Progressive, with Mental Retardation and Urethral Duplication (C564739)
..expandVohwinkel Syndrome, Variant Form (C565826)
..expandXeroderma Pigmentosum (D014983) Child16

Human Disease MESH is developed by UMLS.
Further data from MedGen, OMIM,ClinVar, CTD
Term ID:12917
Name:Xeroderma Pigmentosum
Definition:A rare, pigmentary, and atrophic autosomal recessive disease. It is manifested as an extreme photosensitivity to ULTRAVIOLET RAYS as the result of a deficiency in the enzyme that permits excisional repair of ultraviolet-damaged DNA.
Alternative IDs:DO:DOID:0050427|OMIM:278700
TreeNumbers:C04.834.867 |C16.131.831.936 |C16.320.850.970 |C17.800.600.925 |C17.800.621.936 |C17.800.804.936 |C17.800.827.970 |C18.452.284.975
Slim Mappings:Cancer|Congenital abnormality|Genetic disease (inborn)|Metabolic disease|Skin disease
Reference: MedGen: D014983
MeSH: D014983
OMIM: 278700;
Genes: XPA;
1 HP:0000007Autosomal recessive inheritance
2 HP:0001251Ataxia
3 HP:0001266Choreoathetosis
4 HP:0000509Conjunctivitis
5 HP:0000992Cutaneous photosensitivity
6 HP:0003079Defective DNA repair after ultraviolet radiation damage
7 HP:0004334Dermal atrophy
8 HP:0000656Ectropion
9 HP:0000621Entropion
10 HP:0001265Hyporeflexia
11 HP:0001249Intellectual disability
12 HP:0000491Keratitis
13 HP:0001268Mental deterioration
14 HP:0000252Microcephaly
15 HP:0000613Photophobia
16 HP:0001029Poikiloderma
17 HP:0000407Sensorineural hearing impairment
NAMDC:  Sensorineural hearing loss
18 HP:0001257Spasticity
NAMDC:  Spasticity
19 HP:0001009Telangiectasia
Disease Causing ClinVar Variants
NM_000380.4(XPA):c.*439G>C7507XPAUncertain significancers548728905RCV001168954; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100437282100437282CG9:g.100437282C>G-
NM_000380.4(XPA):c.*428T>C7507XPAUncertain significancers143474170RCV000365861; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100437293100437293AG9:g.100437293A>GClinGen:CA10634627C0043346 Xeroderma pigmentosum;
NM_000380.4(XPA):c.*278T>C7507XPABenignrs3176753RCV000390745|RCV001672709; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:910|MedGen:CN5172029100437443100437443AGNC_000009.11:g.100437443A>GClinGen:CA5148630C0043346 Xeroderma pigmentosum;
NM_000380.4(XPA):c.*256G>C7507XPAUncertain significancers886063215RCV000312878; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100437465100437465CGNC_000009.11:g.100437465C>GClinGen:CA10634274C0043346 Xeroderma pigmentosum;
NM_000380.4(XPA):c.*236G>A7507XPAUncertain significancers1828314205RCV001166056; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100437485100437485CT9:g.100437485C>T-
NM_000380.4(XPA):c.*234C>A7507XPABenignrs3176752RCV000277679|RCV001618665; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:910|MedGen:CN5172029100437487100437487GTNC_000009.11:g.100437487G>TClinGen:CA5148635C0043346 Xeroderma pigmentosum;
NM_000380.4(XPA):c.*203C>G7507XPABenignrs3176751RCV000332786|RCV001662345; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:910|MedGen:CN5172029100437518100437518GCNC_000009.11:g.100437518G>CClinGen:CA5148636C0043346 Xeroderma pigmentosum;
NM_000380.4(XPA):c.*178A>C7507XPAUncertain significancers963196708RCV001166057; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100437543100437543TG9:g.100437543T>G-
NM_000380.4(XPA):c.*77C>A7507XPAUncertain significancers886063216RCV000354649; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100437644100437644GTNC_000009.11:g.100437644G>TClinGen:CA10627771C0043346 Xeroderma pigmentosum;
NM_000380.4(XPA):c.*54T>C7507XPAUncertain significancers557709427RCV001166525; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100437667100437667AG9:g.100437667A>G-
NM_000380.4(XPA):c.817dup (p.Met273fs)7507XPAUncertain significancers754458042RCV000674725; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100437725100437726AAT9:g.100437725_100437726insT-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.809_810del (p.Thr269_Tyr270insTer)7507XPAUncertain significancers1554699256RCV000674574; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100437733100437734CATC9:g.100437733_100437734del-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.772_785del (p.Arg258fs)7507XPAPathogenic/Likely pathogenicrs778543124RCV000667095|RCV001291566; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:910|MedGen:CN5172029100437758100437771AGTACAAGTCTTACGA9:g.100437758_100437771del-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.774dup (p.Lys259Ter)7507XPALikely pathogenicrs752573039RCV000674229; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100437768100437769TTA9:g.100437768_100437769insA-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.774T>A (p.Arg258=)7507XPAConflicting interpretations of pathogenicityrs746694561RCV000913206|RCV001166526; NMedGen:CN517202|MONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100437769100437769AT9:g.100437769A>T-
NM_000380.4(XPA):c.772C>T (p.Arg258Cys)7507XPAUncertain significancers188860873RCV000122320|RCV001166527; NMedGen:CN169374|MONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100437771100437771GA9:g.100437771G>AClinGen:CA162844CN169374 not specified;
NM_000380.4(XPA):c.766A>G (p.Met256Val)7507XPABenign/Likely benignrs57519506RCV000122318|RCV000260012|RCV000861170; NMedGen:CN169374|MONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:910|MedGen:CN5172029100437777100437777TC9:g.100437777T>CClinGen:CA162838,UniProtKB:P23025#VAR_061987CN169374 not specified;
NM_000380.4(XPA):c.756AGA[1] (p.Glu253del)7507XPAUncertain significancers758358436RCV000668503; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100437782100437784ATCTA9:g.100437782_100437784del-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.754C>G (p.Leu252Val)7507XPABenign/Likely benignrs3176750RCV000122319|RCV000319809|RCV000860760; NMedGen:CN169374|MONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:910|MedGen:CN5172029100437789100437789GC9:g.100437789G>CClinGen:CA162841,UniProtKB:P23025#VAR_020324CN169374 not specified;
NM_000380.4(XPA):c.732dup (p.Glu245Ter)7507XPAPathogenic/Likely pathogenicrs1554699296RCV000667814|RCV001388621; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:910|MedGen:CN5172029100437810100437811CCA9:g.100437810_100437811insA-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.731A>G (p.His244Arg)7507XPAUncertain significancers144725456RCV000668335; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100437812100437812TCNC_000009.11:g.100437812T>CClinGen:CA5148691,UniProtKB:P23025#VAR_007731C0043346 Xeroderma pigmentosum;
NM_000380.4(XPA):c.690AAG[1] (p.Arg231del)7507XPAUncertain significancers1554699326RCV000671297; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100437848100437850GCTTG9:g.100437848_100437850del-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.683G>A (p.Arg228Gln)7507XPAUncertain significancers1805160RCV000122321|RCV000665473; NMedGen:CN169374|MONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100437860100437860CT9:g.100437860C>TClinGen:CA162847,UniProtKB:P23025#VAR_014799CN169374 not specified;
NM_000380.4(XPA):c.682C>T (p.Arg228Ter)7507XPAPathogenicrs104894132RCV000001050|RCV000781924|RCV000815514; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:910|MONDO:MONDO:0019600,MedGen:C0043346, Orphanet:910|MedGen:CN5172029100437861100437861GA9:g.100437861G>AClinGen:CA251650,OMIM:611153.0004C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.677T>A (p.Leu226Ter)7507XPAPathogenic/Likely pathogenicrs1554699334RCV000670364|RCV001035389; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:910|MedGen:CN5172029100437866100437866AT9:g.100437866A>T-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.673+2T>C7507XPALikely pathogenicrs1019535182RCV000674401; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100447203100447203AG9:g.100447203A>G-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.666dup (p.Val223fs)7507XPAPathogenic/Likely pathogenicrs1554701103RCV000668902|RCV000781922|RCV001230774; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:910|MONDO:MONDO:0019600,MedGen:C0043346, Orphanet:910|MedGen:CN5172029100447211100447212CCT9:g.100447211_100447212insT-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.651G>T (p.Lys217Asn)7507XPAUncertain significance-1RCV001761800; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100447227100447227CA100447227-
NM_000380.4(XPA):c.648_649del (p.Lys217fs)7507XPAPathogenicrs1057519018RCV000415712|RCV001865309; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:910|MedGen:CN5172029100447229100447230TTCT9:g.100447229_100447230delClinGen:CA16043982C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.642_645dup (p.Gln216fs)7507XPAPathogenic/Likely pathogenicrs764582394RCV000674093|RCV001868278; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:910|MedGen:CN5172029100447232100447233GGTTTC9:g.100447232_100447233insTTTC-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.646C>T (p.Gln216Ter)7507XPAPathogenic/Likely pathogenicrs761978351RCV000669338|RCV001855518; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:910|MedGen:CN5172029100447232100447232GA9:g.100447232G>A-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.631dup (p.Arg211fs)7507XPALikely pathogenicrs1554701129RCV000670038; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100447246100447247CCG9:g.100447246_100447247insG-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.631C>T (p.Arg211Ter)7507XPAPathogenic/Likely pathogenicrs149226993RCV000666956|RCV001045901|RCV000781923; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:910|MedGen:CN517202|MONDO:MONDO:0019600,MedGen:C0043346, Orphanet:9109100447247100447247GA9:g.100447247G>A-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.620G>A (p.Arg207Gln)7507XPAUncertain significance-1RCV001761801; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100447258100447258CT100447258-
NM_000380.4(XPA):c.619C>T (p.Arg207Ter)7507XPAPathogenicrs104894133RCV000001051|RCV000657642|RCV001420782; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:910|MedGen:CN517202|MONDO:MONDO:0019600,MedGen:C0043346, Orphanet:9109100447259100447259GA9:g.100447259G>AClinGen:CA251653,OMIM:611153.0005CN517202 not provided;
NM_000380.4(XPA):c.598_609dup (p.Leu200_Ala203dup)7507XPAUncertain significancers1554701135RCV000670857; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100447268100447269TTTGCTTCTTCTAA9:g.100447268_100447269insTGCTTCTTCTAA-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.601_602del (p.Glu201fs)7507XPALikely pathogenicrs1554701139RCV000672325; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100447276100447277TTCT9:g.100447276_100447277del-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.599T>G (p.Leu200Ter)7507XPALikely pathogenicrs755803064RCV000674552; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100447279100447279AC9:g.100447279A>C-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.572_573del (p.Leu191fs)7507XPALikely pathogenicrs1554701144RCV000671796; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100447305100447306CAAC9:g.100447305_100447306del-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.571C>G (p.Leu191Val)7507XPAConflicting interpretations of pathogenicityrs562768588RCV000122316|RCV000665704|RCV000930543; NMedGen:CN169374|MONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:910|MedGen:CN5172029100447307100447307GC9:g.100447307G>CClinGen:CA162832CN169374 not specified;
NM_000380.4(XPA):c.568T>G (p.Ser190Ala)7507XPALikely benignrs555812588RCV000122317|RCV000284878|RCV000907023; NMedGen:CN169374|MONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:910|MedGen:CN5172029100447310100447310AC9:g.100447310A>CClinGen:CA162835CN169374 not specified;
NM_000380.4(XPA):c.563del (p.Lys188fs)7507XPALikely pathogenicrs1554701152RCV000674742; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100447315100447315CTC9:g.100447315_100447315del-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.555+2T>A7507XPALikely pathogenicrs1554701478RCV000668662; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100449376100449376AT9:g.100449376A>T-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.555+1G>A7507XPALikely pathogenicrs1554701481RCV000670923; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100449377100449377CT9:g.100449377C>T-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.555G>C (p.Gln185His)7507XPAPathogenic/Likely pathogenicrs746617574RCV000665444|RCV001174635|RCV001855442; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:910|MONDO:MONDO:0019600,MedGen:C0043346, Orphanet:910|MedGen:CN5172029100449378100449378CG9:g.100449378C>G-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.553C>T (p.Gln185Ter)7507XPAPathogenicrs1828741490RCV001172311|RCV001386670; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:910|MedGen:CN5172029100449380100449380GA9:g.100449380G>A-
NM_000380.4(XPA):c.548del (p.Lys183fs)7507XPALikely pathogenicrs1554701488RCV000665796; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100449385100449385CTC9:g.100449385_100449385del-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.545_546insTA (p.Leu182fs)7507XPAPathogenicrs786205205RCV000170428; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100449387100449388TTTA9:g.100449387_100449388insTAClinGen:CA274751C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.532dup (p.Met178fs)7507XPALikely pathogenicrs1326841833RCV000673845; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100449400100449401AAT9:g.100449400_100449401insT-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.494T>C (p.Ile165Thr)7507XPAUncertain significancers1828743987RCV001166528; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100449439100449439AG9:g.100449439A>G-
NM_000380.4(XPA):c.476_477del (p.Glu159fs)7507XPALikely pathogenicrs781195170RCV000671391; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100449456100449457GCTG9:g.100449456_100449457del-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.472dup (p.Arg158fs)7507XPALikely pathogenicrs1554701520RCV000670758; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100449460100449461CCT9:g.100449460_100449461insT-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.459_460del (p.Cys153_Asp154delinsTer)7507XPAPathogenic/Likely pathogenicrs1240801740RCV000670444|RCV001385775; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:910|MedGen:CN5172029100449473100449474TCAT9:g.100449473_100449474del-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.460G>C (p.Asp154His)7507XPAUncertain significance-1RCV001761802; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100449473100449473CG100449473-
NM_000380.4(XPA):c.452A>G (p.Lys151Arg)7507XPAUncertain significancers983722547RCV001168272; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100449481100449481TC9:g.100449481T>C-
NM_000380.4(XPA):c.451A>T (p.Lys151Ter)7507XPALikely pathogenicrs1554701532RCV000669539; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100449482100449482TA9:g.100449482T>A-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.438_443del (p.Gln146_Tyr148delinsHis)7507XPALikely pathogenicrs1564045331RCV000754105; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100449490100449495ATATTCTANC_000009.11:g.100449491_100449496del-
NM_000380.4(XPA):c.439_441del (p.Glu147del)7507XPAUncertain significancers1554701535RCV000666912; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100449492100449494ATTCA9:g.100449492_100449494del-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.428_429del (p.Glu143fs)7507XPAPathogenic/Likely pathogenicrs1554701540RCV000670791|RCV001861798; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:910|MedGen:CN5172029100449504100449505CCTC9:g.100449504_100449505del-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.397GAT[1] (p.Asp134del)7507XPAUncertain significancers1554701553RCV000674693; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100449531100449533TATCT9:g.100449531_100449533del-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.391del (p.Asp131fs)7507XPALikely pathogenicrs1554701563RCV000673546; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100449542100449542TCT9:g.100449542_100449542del-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.390-1G>C7507XPAPathogenicrs750218942RCV000246304|RCV001063951|RCV001255518; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:910|MedGen:CN517202|MONDO:MONDO:0019600,MedGen:C0043346, Orphanet:9109100449544100449544CG9:g.100449544C>GClinGen:CA5148823,OMIM:611153.0001C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.389+1G>A7507XPALikely pathogenicrs1554701931RCV000673551; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100451815100451815CT9:g.100451815C>T-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.389G>A (p.Arg130Lys)7507XPAUncertain significancers1324310300RCV000666137; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100451816100451816CT9:g.100451816C>T-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.378T>G (p.Cys126Trp)7507XPAUncertain significancers1451780491RCV000668799; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100451827100451827AC9:g.100451827A>C-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.374del (p.Thr125fs)7507XPAPathogenicrs1828818571RCV001172312; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100451831100451831AGA9:g.100451831_100451831del-
NM_000380.4(XPA):c.349_353del (p.Leu117fs)7507XPAPathogenicrs1200172747RCV000001049|RCV000780797|RCV001057886; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:910|MONDO:MONDO:0019600,MedGen:C0043346, Orphanet:910|MedGen:CN5172029100451852100451856CATAAGC9:g.100451852_100451856delClinGen:CA589324705,OMIM:611153.0003C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.348T>A (p.Tyr116Ter)7507XPAPathogenicrs104894134RCV000001052; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100451857100451857AT9:g.100451857A>TOMIM:611153.0006,ClinGen:CA251656C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.344_346del (p.Ser115del)7507XPAUncertain significancers1554701942RCV000672670; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100451859100451861TAAGT9:g.100451859_100451861del-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.338_339del (p.Met113fs)7507XPAPathogenic/Likely pathogenicrs748286715RCV000668826|RCV001855507; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:910|MedGen:CN5172029100451866100451867CCAC9:g.100451866_100451867del-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.335_338delinsCATAAGAAA (p.Phe112_Met113delinsSerTer)7507XPAPathogenicrs886039226RCV000254511; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100451867100451870ATAATTTCTTATG9:g.100451867_100451868insTTCTTATGClinGen:CA10587998C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.331G>T (p.Glu111Ter)7507XPAPathogenicrs769255883RCV000674100|RCV001194216|RCV001230906; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:910|MONDO:MONDO:0019600,MedGen:C0043346, Orphanet:910|MedGen:CN5172029100451874100451874CA9:g.100451874C>A-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.323G>T (p.Cys108Phe)7507XPAUncertain significancers104894131RCV000001048; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100451882100451882CA9:g.100451882C>AUniProtKB:P23025#VAR_007728,OMIM:611153.0002,ClinGen:CA251648C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.323G>A (p.Cys108Tyr)7507XPAConflicting interpretations of pathogenicityrs104894131RCV000492893|RCV000672811; NMedGen:CN517202|MONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100451882100451882CT9:g.100451882C>TClinGen:CA374187825CN517202 not provided;
NM_000380.4(XPA):c.289G>A (p.Val97Ile)7507XPABenign/Likely benignrs10983315RCV000903901|RCV001168273; NMedGen:CN517202|MONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100451916100451916CT9:g.100451916C>T-
NM_000380.4(XPA):c.283+1_283+6del7507XPALikely pathogenicrs1554702597RCV000670391; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100455925100455930ACTTTACA9:g.100455925_100455930del-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.238GAA[3] (p.Glu83_Glu84del)7507XPAUncertain significancers3176652RCV000670938; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100455962100455967GTTCTTCG9:g.100455962_100455967del-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.237_242del (p.Glu83_Glu84del)7507XPAUncertain significancers1554702607RCV000670368; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100455972100455977TTCTTCCT9:g.100455972_100455977del-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.235G>T (p.Glu79Ter)7507XPALikely pathogenicrs1554702608RCV000671257; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100455979100455979CA9:g.100455979C>A-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.197del (p.Pro66fs)7507XPALikely pathogenicrs1554702629RCV000671795; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100456017100456017TGT9:g.100456017_100456017del-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.172+11C>T7507XPALikely benignrs766386535RCV000380374; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100459392100459392GANC_000009.11:g.100459392G>AClinGen:CA5148902C0043346 Xeroderma pigmentosum;
NM_000380.4(XPA):c.172+2T>G7507XPAPathogenicrs1587755557RCV000001053; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100459401100459401AC9:g.100459401A>COMIM:611153.0007C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.172+1G>T7507XPALikely pathogenicrs1554703119RCV000672997; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100459402100459402CA9:g.100459402C>A-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.172+1G>A7507XPALikely pathogenicrs1554703119RCV000667207|RCV001855476; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:910|MedGen:CN5172029100459402100459402CT9:g.100459402C>T-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.152C>G (p.Thr51Arg)7507XPAUncertain significance-1RCV001761803; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100459423100459423GC100459423-
NM_000380.4(XPA):c.122C>T (p.Ala41Val)7507XPAUncertain significance-1RCV001761804; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100459453100459453GA100459453-
NM_000380.4(XPA):c.110T>A (p.Met37Lys)7507XPAUncertain significance-1RCV001761805; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100459465100459465AT100459465-
NM_000380.4(XPA):c.47A>G (p.Gln16Arg)7507XPAUncertain significancers756527969RCV001168274; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100459528100459528TC9:g.100459528T>C-
NM_000380.4(XPA):c.12_38del (p.Asp5_Ala13del)7507XPAUncertain significancers755109935RCV000671878; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100459537100459563AGCCGCCGCCTCCGGCAAAGCCCCGTCGA9:g.100459537_100459563del-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.-4_26del (p.Met1_Pro9del)7507XPALikely pathogenicrs1554703183RCV000672862; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100459549100459578CGGCAAAGCCCCGTCGGCCGCCGCCATCTCTC9:g.100459549_100459578del-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.13G>T (p.Asp5Tyr)7507XPAUncertain significancers574504791RCV001168275; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100459562100459562CA9:g.100459562C>A-
NM_000380.4(XPA):c.10del (p.Ala4fs)7507XPAPathogenic/Likely pathogenicrs779161471RCV000666403|RCV000809436; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:910|MedGen:CN5172029100459565100459565GCGNC_000009.11:g.100459566del-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.2T>C (p.Met1Thr)7507XPALikely pathogenicrs1253496792RCV000666994; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100459573100459573AG9:g.100459573A>G-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_000380.4(XPA):c.-4A>G7507XPABenignrs1800975RCV000170427|RCV000286055|RCV001509817; NMedGen:CN169374|MONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:910|MedGen:CN5172029100459578100459578TC9:g.100459578T>CClinGen:CA199614CN169374 not specified;
NM_000380.4(XPA):c.-43G>A7507XPAUncertain significancers886063217RCV000674155; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100459617100459617CTNC_000009.11:g.100459617C>TClinGen:CA10630695C0043346 Xeroderma pigmentosum;
NM_000380.3(XPA):c.-72_-47del7507XPAUncertain significancers1249073186RCV000672399; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100459621100459646ACTGCACGCCGAGGCGAGCCAGCCGCCA9:g.100459621_100459646del-C0268135 278700 Xeroderma pigmentosum, type 1;
NM_001354975.1(XPA):c.-1199G>T7507XPAUncertain significancers1237254220RCV001169010; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100459624100459624CA9:g.100459624C>A-
NM_000380.3(XPA):c.-66T>G7507XPAUncertain significancers886063218RCV000669719; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100459640100459640ACNC_000009.11:g.100459640A>CClinGen:CA10634281C0043346 Xeroderma pigmentosum;
NM_000380.3(XPA):c.-74A>C7507XPAUncertain significancers3176631RCV000292108; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100459648100459648TG9:g.100459648T>GClinGen:CA5148980C0043346 Xeroderma pigmentosum;
NM_000380.3(XPA):c.-88C>A7507XPAUncertain significancers371959589RCV000347034; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:9109100459662100459662GT9:g.100459662G>TClinGen:CA5148987C0043346 Xeroderma pigmentosum;
NM_004628.5(XPC):c.2034-1G>A7508XPCLikely pathogenicrs869025275RCV000207299; NMONDO:MONDO:0010210,MedGen:C0268135,OMIM:278700, Orphanet:91031419391714193917CTNC_000003.11:g.14193917C>TClinGen:CA353867C0268135 278700 Xeroderma pigmentosum, type 1;
MSeqDR Portal