MSeqDR Mitochondrial Disease Portal


 
*:HP: HPO terms, UMDF: 1= Disease, ND: NAMDC terms.
  Most Studied  CPEO, Complex I Deficiency, COXPD1, Leigh, LHON, MELAS, MERRF, Myopathy, SANDO
Disease Browser
Parent Node:
expand
Contracture (D003286)
Parent Node:
expand
Skin Abnormalities (D012868)
..Starting node
..expand
Tight skin contracture syndrome, lethal (C536920)

       Child Nodes:



 Sister Nodes: 
..expandAcrodermatitis (D000169) Child1
..expandAnetoderma (D057088) Child2
..expandArthropathy, Erosive (C565273)
..expandAUTOINFLAMMATION WITH ARTHRITIS AND DYSKERATOSIS (OMIM:617388)
..expandBarber Say syndrome (C537908)
..expandBlepharophimosis syndrome type 1 (C536233)
..expandBlepharophimosis syndrome type 2 (C536234)
..expandBlepharophimosis with ptosis, syndactyly, and short stature (C536235)
..expandBlepharophimosis, Ptosis, and Epicanthus Inversus (C562419)
..expandBook Syndrome (C562993)
..expandBrittle cornea syndrome 1 (C536192)
..expandC1q DEFICIENCY (OMIM:613652)
..expandCarney Complex (D056733) Child1
..expandCOCOON SYNDROME (OMIM:613630)
..expandComedones, Familial Dyskeratotic (C562838)
..expandCutis Gyrata Syndrome of Beare And Stevenson (C565129)
..expandDermal Ridges, Nelson Syndrome (C565110)
..expandDermal Ridges, Patternless (C565109)
..expandDermoodontodysplasia (C565103)
..expandDyskeratosis Congenita (D019871) Child3
..expandDyskeratosis, Hereditary Benign Intraepithelial (C562551)
..expandEctodermal Dysplasia (D004476) Child144  LSDB C:1
..expandEhlers-Danlos Syndrome (D004535) Child23
..expandEpidermolysis Bullosa (D004820) Child29
..expandEpithelial Squamous Dysplasia, Keratinizing Desquamative, of Urinary Tract (C565584)
..expandFamilial popliteal pterygium syndrome (C535891)
..expandHairy palms and soles (C535620)
..expandHemangiomatosis, Cutaneous, with Associated Features (C562438)
..expandHyperkeratotic Cutaneous Capillary-Venous Malformations Associated With Cerebral Capillary Malformations (C566153)
..expandHypohidrosis with Abnormal Palmar Dermal Ridges (C565481)
..expandIchthyosis (D007057) Child66
..expandIchthyosis-Mental Retardation Syndrome with Large Keratohyalin Granules in the Skin (C563402)
..expandIncontinentia Pigmenti (D007184) Child2
..expandKeratosis Linearis with Ichthyosis Congenita and Sclerosing Keratoderma (C566600)
..expandKOSAKI OVERGROWTH SYNDROME (OMIM:616592)
..expandLINEAR SKIN DEFECTS WITH MULTIPLE CONGENITAL ANOMALIES 3 (OMIM:300952)
..expandMichelin tire baby syndrome (C537575)
..expandMicrophthalmia, syndromic 7 (C537466)
..expandMultiple pterygium syndrome (C537377) Child1
..expandOculocerebrocutaneous syndrome (C538088)
..expandPoikiloderma with Neutropenia (C565820)
..expandPoikiloderma, Hereditary Sclerosing (C562824)
..expandPort-Wine Stain (D019339) Child4
..expandProlidase Deficiency (D056732)
..expandPseudoxanthoma Elasticum (D011561) Child2
..expandPterygium Colli, Isolated (C566741)
..expandRidges-off-the-end syndrome (C531754)
..expandRothmund-Thomson Syndrome (D011038) Child5
..expandSclerema Neonatorum (D012593)
..expandSkin-Hair-Eye Pigmentation, Variation In, 10 (C567376)
..expandSkin-Hair-Eye Pigmentation, Variation In, 11 (C567374)
..expandSkin-Hair-Eye Pigmentation, Variation In, 4 (C567300)
..expandSkin-Hair-Eye Pigmentation, Variation In, 5 (C567119)
..expandSkin-Hair-Eye Pigmentation, Variation In, 6 (C567139)
..expandSkin-Hair-Eye Pigmentation, Variation In, 7 (C567155)
..expandSkin-Hair-Eye Pigmentation, Variation In, 8 (C567096)
..expandSkin-Hair-Eye Pigmentation, Variation In, 9 (C567091)
..expandTight skin contracture syndrome, lethal (C536920)
..expandTrichothiodystrophy Syndromes (D054463) Child5
..expandUrban Schosser Spohn syndrome (C536476)
..expandVascular Hyalinosis (C564750)
..expandWinter Shortland Temple syndrome (C536735)
..expandXeroderma Pigmentosum (D014983) Child16
   

Human Disease MESH is developed by UMLS.
Further data from MedGen, OMIM,ClinVar, CTD
Term ID:12179
Name:Tight skin contracture syndrome, lethal
Definition:
Alternative IDs:DO:DOID:0060762|OMIM:275210
ParentIDs:MESH:D003286|MESH:D012868
TreeNumbers:C05.550.323/C536920 |C05.651.197/C536920 |C16.131.831/C536920 |C17.800.804/C536920
Synonyms:Fetal hypokinesia sequence due to restrictive dermopathy |Hyperkeratosis-contracture syndrome |Restrictive dermopathy, lethal |TIGHT SKIN CONTRACTURE SYNDROME, LETHAL
Slim Mappings:Congenital abnormality|Musculoskeletal disease|Skin disease
Reference: MedGen: C536920
MeSH: C536920
OMIM: 275210;
MSeqDR LSDB:  
Genes: LMNA; ZMPSTE24;
Phenotypes
1 HP:0000007Autosomal recessive inheritance
2 HP:0000377Abnormality of the pinna
3 HP:0000835Adrenal hypoplasia
4 HP:0100840Aplasia/Hypoplasia of the eyebrow
5 HP:0001631Atrial septal defect
6 HP:0000581Blepharophimosis
7 HP:0000453Choanal atresia
8 HP:0006585Congenital pseudoarthrosis of the clavicle
9 HP:0005474Decreased calvarial ossification
10 HP:0001558Decreased fetal movement
11 HP:0000621Entropion
12 HP:0007543Epidermal hyperkeratosis
13 HP:0001371Flexion contracture
14 HP:0001425Heterogeneous
15 HP:0011414Hydropic placenta
16 HP:0000316Hypertelorism
17 HP:0000047Hypospadias
18 HP:0005253Increased anterioposterior diameter of thorax
19 HP:0001511Intrauterine growth retardation
20 HP:0002751Kyphoscoliosis
21 HP:0000239Large fontanelles
22 HP:0000369Low-set ears
23 HP:0000347Micrognathia
24 HP:0000160Narrow mouth
25 HP:0000418Narrow nasal ridge
26 HP:0000695Natal tooth
27 HP:0006391Overtubulated long bones
28 HP:0001643Patent ductus arteriosus
29 HP:0001561Polyhydramnios
30 HP:0001622Premature birth
31 HP:0001788Premature rupture of membranes
32 HP:0007394Prominent superficial blood vessels
33 HP:0002089Pulmonary hypoplasia
34 HP:0001838Rocker bottom foot
35 HP:0001799Short nail
36 HP:0012745Short palpebral fissure
37 HP:0001196Short umbilical cord
38 HP:0200041Skin erosion
39 HP:0000653Sparse eyelashes
40 HP:0003826Stillbirth
41 HP:0000176Submucous cleft hard palate
42 HP:0006645Thin clavicles
43 HP:0000073Ureteral duplication
Disease Causing ClinVar Variants
Variation_NameGeneIDGeneSymbolClinicalSignificancedbSNPRCVaccessionTestedInGTRPhenotypeIDsChromosomeStartStopHGVS_cHGVS_pHGVS_gOtherIDsDisease_ClinVar
NM_170707.4(LMNA):c.-138T>C4000LMNAUncertain significancers886045359RCV000260842|RCV000261874|RCV000300718|RCV000307448|RCV000323133|RCV000347305|RCV000368285|RCV000369173|RCV000393952|RCV000403626|RCV001096152; NMONDO:MONDO:0008310,MedGen:C0033300,OMIM:176670, Orphanet:740|MedGen:CN239184|MONDO:MONDO:0011569,MedGen:C1854154,OMIM:605588, Orphanet:98856|MONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:1662|MONDO:MONDO:0016830,MedGen:C0410189,OMIM:PS310300,O1156084572156084572TCNC_000001.10:g.156084572T>CClinGen:CA10607812C0270914 Charcot-Marie-Tooth disease, type 2;
NM_170707.4(LMNA):c.-62C>A4000LMNAUncertain significancers886045361RCV000261953|RCV000277124|RCV000283250|RCV000279605|RCV000307684|RCV000319491|RCV000323065|RCV000369092|RCV000371719|RCV000379964; NMONDO:MONDO:0016830,MedGen:C0410189,OMIM:PS310300, Orphanet:261|MONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:1662|MedGen:CN239184|MONDO:MONDO:0008310,MedGen:C0033300,OMIM:176670, Orphanet:740|MedGen:CN239352|MONDO:MONDO:0013178,MedGen:C27507851156084648156084648CANC_000001.10:g.156084648C>AClinGen:CA10607818C0270914 Charcot-Marie-Tooth disease, type 2;
NM_170707.4(LMNA):c.-44T>A4000LMNAUncertain significancers1185731069RCV001096249|RCV001096251|RCV001096248|RCV001096250|RCV001096252|RCV001096253|RCV001096254|RCV001096255|RCV001097999|RCV001098000; NMONDO:MONDO:0009557,MedGen:C5399785,OMIM:248370, Orphanet:2457, Orphanet:90153|MONDO:MONDO:0021569,MedGen:C0410190,OMIM:181350, Orphanet:261, Orphanet:264|MONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:1662|MONDO:MONDO:0007269,MedGen:C1449563,OMIM1156084666156084666TA1:g.156084666T>A-
NM_170707.4(LMNA):c.-5C>A4000LMNAUncertain significancers886045362RCV000259413|RCV000287946|RCV000312458|RCV000313589|RCV000319307|RCV000340631|RCV000347563|RCV000391566|RCV000391573|RCV000404736; NMONDO:MONDO:0016830,MedGen:C0410189,OMIM:PS310300, Orphanet:261|MONDO:MONDO:0008310,MedGen:C0033300,OMIM:176670, Orphanet:740|MedGen:CN239184|MONDO:MONDO:0020088,MedGen:C0271694,OMIM:PS151660, Orphanet:98306|MONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210,1156084705156084705CANC_000001.10:g.156084705C>AClinGen:CA10608305C0270914 Charcot-Marie-Tooth disease, type 2;
NM_170707.4(LMNA):c.398G>A (p.Arg133Gln)4000LMNAConflicting interpretations of pathogenicityrs60864230RCV000182356|RCV000204542|RCV001096448|RCV001098186|RCV001098188|RCV001098184|RCV001098185|RCV001098190|RCV001098191|RCV001096449|RCV001098187|RCV001098189|RCV001191911; NMedGen:CN517202|MONDO:MONDO:0018993,MedGen:C0270914, Orphanet:64746|MONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:1662|MONDO:MONDO:0016830,MedGen:C0410189,OMIM:PS310300, Orphanet:261|MONDO:MONDO:0013178,MedGen:C2750785,OMIM:613205, Orphanet:15791156100449156100449GANC_000001.10:g.156100449G>AClinGen:CA018032C0270914 Charcot-Marie-Tooth disease, type 2;
NM_170707.4(LMNA):c.811-13T>A4000LMNAConflicting interpretations of pathogenicityrs80356809RCV000041372|RCV000057470|RCV000268196|RCV000271656|RCV000294723|RCV000301904|RCV000300601|RCV000325561|RCV000335689|RCV000361342|RCV000406740|RCV000406731|RCV000771102|RCV001100168|RCV001173418|RCV002054812; NMedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:1662|MedGen:CN239184|MONDO:MONDO:0011569,MedGen:C1854154,OMIM:605588, Orphanet:98856|MONDO:MONDO:0009557,MedGen:C5399785,OMIM:248370, Orphanet:2457, Orphanet:90153|MON1156104965156104965TA1:g.156104965T>AClinGen:CA018725C0270914 Charcot-Marie-Tooth disease, type 2;
NM_170707.4(LMNA):c.861T>C (p.Ala287=)4000LMNABenignrs538089RCV000041374|RCV000057475|RCV000249986|RCV000281700|RCV000278366|RCV000303946|RCV000332471|RCV000335802|RCV000339029|RCV000374142|RCV000385848|RCV000389150|RCV000408212|RCV000776003|RCV001093907|RCV001102163|RCV001173415; NMedGen:CN169374|MedGen:CN517202|MedGen:CN230736|MONDO:MONDO:0008310,MedGen:C0033300,OMIM:176670, Orphanet:740|MONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:1662|MONDO:MONDO:0007269,MedGen:C1449563,OMIM:115200, Orphanet:300751|MONDO:MONDO:0013171156105028156105028TC1:g.156105028T>CClinGen:CA018770CN230736 Cardiovascular phenotype;
NM_170707.4(LMNA):c.985C>A (p.Arg329Ser)4000LMNAUncertain significancers775159300RCV000284978|RCV000288324|RCV000310763|RCV000313247|RCV000342371|RCV000345676|RCV000348346|RCV000380612|RCV000392349|RCV000400023|RCV001262711|RCV001814979; NMedGen:CN239310|MONDO:MONDO:0018993,MedGen:C0270914, Orphanet:64746|MedGen:CN239184|MONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:1662|MONDO:MONDO:0016584,MedGen:C0432291,OMIM:PS248370, Orphanet:2457|MONDO:MONDO:0008310,MedGen:C0033300,OMIM:1761156105740156105740CANC_000001.10:g.156105740C>AClinGen:CA054980C0270914 Charcot-Marie-Tooth disease, type 2;
NM_170707.4(LMNA):c.1027C>T (p.Arg343Trp)4000LMNAUncertain significancers749784223RCV000812997|RCV001096836|RCV001096841|RCV001096837|RCV001096838|RCV001096839|RCV001096840|RCV001102252|RCV001172615|RCV001096835|RCV001096842|RCV001098596|RCV001823746|RCV001189952|RCV001593004; NMONDO:MONDO:0018993,MedGen:C0270914, Orphanet:64746|MONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:1662|MONDO:MONDO:0009557,MedGen:C5399785,OMIM:248370, Orphanet:2457, Orphanet:90153|MONDO:MONDO:0008310,MedGen:C0033300,OMIM:176670, Orphanet:740|MO1156105782156105782CT1:g.156105782C>T-
NM_170707.4(LMNA):c.1227A>G (p.Thr409=)4000LMNAConflicting interpretations of pathogenicityrs762130433RCV001100367|RCV001100369|RCV001102348|RCV001102350|RCV000865471|RCV001102352|RCV001102353|RCV001100368|RCV001100370|RCV001102349|RCV001102351|RCV001700317|RCV001726349|RCV001191849; NMONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:1662|MONDO:MONDO:0013178,MedGen:C2750785,OMIM:613205, Orphanet:157973|MONDO:MONDO:0021569,MedGen:C0410190,OMIM:181350, Orphanet:261, Orphanet:264|MedGen:CN239184|MONDO:MONDO:0018993,MedGen:C0270914,O1156106074156106074AG1:g.156106074A>G-
NM_170707.4(LMNA):c.1338T>G (p.Asp446Glu)4000LMNAUncertain significancers505058RCV001100501|RCV001100502|RCV001100504|RCV001100503|RCV001100505|RCV001100506|RCV001102450|RCV001102451|RCV001102452|RCV001102453|RCV001186448; NMONDO:MONDO:0008310,MedGen:C0033300,OMIM:176670, Orphanet:740|MONDO:MONDO:0013178,MedGen:C2750785,OMIM:613205, Orphanet:157973|MONDO:MONDO:0009557,MedGen:C5399785,OMIM:248370, Orphanet:2457, Orphanet:90153|MONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210,Orp1156106185156106185TG1:g.156106185T>G-
NM_170707.4(LMNA):c.1584G>A (p.Thr528=)4000LMNABenign/Likely benignrs80356812RCV000041323|RCV000268685|RCV000272639|RCV000276010|RCV000284072|RCV000297337|RCV000312611|RCV000323895|RCV000327741|RCV000370762|RCV000464925|RCV000771807|RCV000827979|RCV001093817|RCV001100808|RCV001172635; NMedGen:CN169374|MONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:1662|MONDO:MONDO:0013178,MedGen:C2750785,OMIM:613205, Orphanet:157973|MedGen:CN239184|MONDO:MONDO:0008310,MedGen:C0033300,OMIM:176670, Orphanet:740|MONDO:MONDO:0007269,MedGen:C1449561156106999156106999GANC_000001.10:g.156106999G>AClinGen:CA017522C0270914 Charcot-Marie-Tooth disease, type 2;
NM_170707.4(LMNA):c.1698+83G>A4000LMNAUncertain significancers555844506RCV001099172|RCV001099173|RCV001099170|RCV001099174|RCV001099171|RCV001101162|RCV001101164|RCV001101161|RCV001101163|RCV001101165; NMONDO:MONDO:0009557,MedGen:C5399785,OMIM:248370, Orphanet:2457, Orphanet:90153|MedGen:CN239184|MONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:1662|MONDO:MONDO:0007906,MedGen:C1720860,OMIM:151660, Orphanet:2348|MONDO:MONDO:0008310,MedGen:C0033300,1156107617156107617GA1:g.156107617G>A-
NM_170707.4(LMNA):c.1698+124C>T4000LMNAUncertain significancers1057516022RCV000260405|RCV000317932|RCV000311797|RCV000315427|RCV000343251|RCV000346677|RCV000353940|RCV000398598|RCV000394847|RCV000405500; NMONDO:MONDO:0008310,MedGen:C0033300,OMIM:176670, Orphanet:740|MONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:1662|MONDO:MONDO:0016584,MedGen:C0432291,OMIM:PS248370, Orphanet:2457|MedGen:CN239352|MONDO:MONDO:0018993,MedGen:C0270914, Orphanet:647461156107658156107658CT1:g.156107658C>TClinGen:CA10654428C0270914 Charcot-Marie-Tooth disease, type 2;
NM_005857.4(ZMPSTE24):c.-185C>G10269ZMPSTE24Uncertain significancers1057515563RCV000265347|RCV000378559; NMONDO:MONDO:0016584,MedGen:C0432291,OMIM:PS248370, Orphanet:2457|MONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:166214072375940723759CGNC_000001.10:g.40723759C>GClinGen:CA10611001C0406585 275210 Lethal tight skin contracture syndrome;
NM_005857.4(ZMPSTE24):c.-181A>G10269ZMPSTE24Uncertain significancers531255312RCV000321205|RCV000385121; NMONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:1662|MONDO:MONDO:0016584,MedGen:C0432291,OMIM:PS248370, Orphanet:245714072376340723763AGNC_000001.10:g.40723763A>GClinGen:CA10610156C0406585 275210 Lethal tight skin contracture syndrome;
NM_005857.4(ZMPSTE24):c.-172A>C10269ZMPSTE24Uncertain significancers151221982RCV000290774|RCV000345711; NMONDO:MONDO:0016584,MedGen:C0432291,OMIM:PS248370, Orphanet:2457|MONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:166214072377240723772ACNC_000001.10:g.40723772A>CClinGen:CA10610157C0406585 275210 Lethal tight skin contracture syndrome;
NM_005857.4(ZMPSTE24):c.-55C>G10269ZMPSTE24Uncertain significancers1057515558RCV000296701|RCV000381739; NMONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:1662|MONDO:MONDO:0016584,MedGen:C0432291,OMIM:PS248370, Orphanet:245714072388940723889CGNC_000001.10:g.40723889C>GClinGen:CA10611002C0406585 275210 Lethal tight skin contracture syndrome;
NM_005857.5(ZMPSTE24):c.-46G>A10269ZMPSTE24Uncertain significancers200527699RCV000351669|RCV000407351|RCV000767313; NMONDO:MONDO:0016584,MedGen:C0432291,OMIM:PS248370, Orphanet:2457|MONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:1662|MedGen:CN51720214072389840723898GANC_000001.10:g.40723898G>AClinGen:CA790865
NM_005857.5(ZMPSTE24):c.-13G>A10269ZMPSTE24Uncertain significancers140415968RCV000312040|RCV000338873; NMONDO:MONDO:0012074,MedGen:C1837756,OMIM:608612, Orphanet:2457, Orphanet:90154|MONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:166214072393140723931GANC_000001.10:g.40723931G>AClinGen:CA790872C0406585 275210 Lethal tight skin contracture syndrome;
NM_005857.5(ZMPSTE24):c.30G>T (p.Leu10Phe)10269ZMPSTE24Uncertain significancers1057515519RCV000299107|RCV000407338; NMONDO:MONDO:0012074,MedGen:C1837756,OMIM:608612, Orphanet:2457, Orphanet:90154|MONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:166214072397340723973GTNC_000001.10:g.40723973G>TClinGen:CA10610160C0406585 275210 Lethal tight skin contracture syndrome;
NM_005857.5(ZMPSTE24):c.50del (p.Lys17fs)10269ZMPSTE24Pathogenicrs281875360RCV000034313|RCV000128743; NMONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:1662|MedGen:CN51720214072399240723992GAG1:g.40723992_40723992delClinGen:CA213066,OMIM:606480.0010C0406585 275210 Lethal tight skin contracture syndrome;
NM_005857.5(ZMPSTE24):c.52C>T (p.Arg18Cys)10269ZMPSTE24Uncertain significancers1472639374RCV001100332|RCV001100333; NMONDO:MONDO:0012074,MedGen:C1837756,OMIM:608612, Orphanet:2457, Orphanet:90154|MONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:166214072399540723995CT1:g.40723995C>T-
NM_005857.5(ZMPSTE24):c.54dup (p.Ile19fs)10269ZMPSTE24Pathogenicrs281875361RCV000023548|RCV000128744; NMONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:1662|MedGen:CN51720214072399640723997GGT1:g.40723996_40723997insTClinGen:CA129354,OMIM:606480.0007C0406585 275210 Lethal tight skin contracture syndrome;
NM_005857.5(ZMPSTE24):c.237C>T (p.Phe79=)10269ZMPSTE24Benign/Likely benignrs115173390RCV000268352|RCV000353857|RCV000894667; NMONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:1662|MONDO:MONDO:0012074,MedGen:C1837756,OMIM:608612, Orphanet:2457, Orphanet:90154|MedGen:CN51720214072662440726624CTNC_000001.10:g.40726624C>TClinGen:CA790935C0406585 275210 Lethal tight skin contracture syndrome;
NM_005857.5(ZMPSTE24):c.325T>G (p.Cys109Gly)10269ZMPSTE24Conflicting interpretations of pathogenicityrs141386841RCV000118907|RCV000304896|RCV000359585; NMedGen:CN517202|MONDO:MONDO:0012074,MedGen:C1837756,OMIM:608612, Orphanet:2457, Orphanet:90154|MONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:166214073351240733512TG1:g.40733512T>GClinGen:CA231664C0406585 275210 Lethal tight skin contracture syndrome;
NM_005857.5(ZMPSTE24):c.453A>G (p.Glu151=)10269ZMPSTE24Benign/Likely benignrs115755400RCV000903674|RCV001102301|RCV001102302; NMedGen:CN517202|MONDO:MONDO:0012074,MedGen:C1837756,OMIM:608612, Orphanet:2457, Orphanet:90154|MONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:166214073418640734186AG1:g.40734186A>G-
NM_005857.5(ZMPSTE24):c.467A>G (p.Asn156Ser)10269ZMPSTE24Uncertain significancers747896764RCV001102303|RCV001102304; NMONDO:MONDO:0012074,MedGen:C1837756,OMIM:608612, Orphanet:2457, Orphanet:90154|MONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:166214073420040734200AG1:g.40734200A>G-
NM_005857.5(ZMPSTE24):c.474G>A (p.Gln158=)10269ZMPSTE24Uncertain significancers777632184RCV001096899|RCV001102305; NMONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:1662|MONDO:MONDO:0012074,MedGen:C1837756,OMIM:608612, Orphanet:2457, Orphanet:9015414073420740734207GA1:g.40734207G>A-
NM_005857.5(ZMPSTE24):c.555A>G (p.Leu185=)10269ZMPSTE24Uncertain significancers1057515520RCV000272347|RCV000327455; NMONDO:MONDO:0012074,MedGen:C1837756,OMIM:608612, Orphanet:2457, Orphanet:90154|MONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:166214073572740735727AGNC_000001.10:g.40735727A>GClinGen:CA10610165C0406585 275210 Lethal tight skin contracture syndrome;
NM_005857.5(ZMPSTE24):c.584_585del (p.Tyr195fs)10269ZMPSTE24Pathogenicrs786205123RCV000034314; NMONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:166214073575540735756CTAC1:g.40735755_40735756delClinGen:CA213067,OMIM:606480.0011C0406585 275210 Lethal tight skin contracture syndrome;
NM_005857.5(ZMPSTE24):c.591dup (p.Ile198fs)10269ZMPSTE24Pathogenicrs281875367RCV000023549|RCV000128745; NMONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:1662|MedGen:CN51720214073575640735757AAT1:g.40735756_40735757insTClinGen:CA129355,OMIM:606480.0008C0406585 275210 Lethal tight skin contracture syndrome;
NM_005857.5(ZMPSTE24):c.627+1G>C10269ZMPSTE24Pathogenicrs312262686RCV000128748|RCV001727596; NMedGen:CN517202|MONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:166214073580040735800GC1:g.40735800G>CClinGen:CA232753CN517202 not provided;
NM_005857.5(ZMPSTE24):c.651T>C (p.Asp217=)10269ZMPSTE24Benignrs2076697RCV000081333|RCV000128752|RCV000268676|RCV000363486; NMedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:1662|MONDO:MONDO:0012074,MedGen:C1837756,OMIM:608612, Orphanet:2457, Orphanet:9015414073758940737589TC1:g.40737589T>CClinGen:CA148423C0406585 275210 Lethal tight skin contracture syndrome;
NM_005857.5(ZMPSTE24):c.715G>T (p.Glu239Ter)10269ZMPSTE24Pathogenicrs267607181RCV000004497|RCV000128755; NMONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:1662|MedGen:CN51720214073765340737653GT1:g.40737653G>TOMIM:606480.0006,ClinGen:CA116757C0406585 275210 Lethal tight skin contracture syndrome;
NM_005857.5(ZMPSTE24):c.715G>A (p.Glu239Lys)10269ZMPSTE24Uncertain significancers267607181RCV001096901|RCV001096900|RCV001856310; NMONDO:MONDO:0012074,MedGen:C1837756,OMIM:608612, Orphanet:2457, Orphanet:90154|MONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:1662|MedGen:CN51720214073765340737653GA1:g.40737653G>A-
NM_005857.5(ZMPSTE24):c.770-14T>C10269ZMPSTE24Conflicting interpretations of pathogenicityrs770003597RCV000333363|RCV000387860|RCV002059479; NMONDO:MONDO:0012074,MedGen:C1837756,OMIM:608612, Orphanet:2457, Orphanet:90154|MONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:1662|MedGen:CN51720214074700140747001TCNC_000001.10:g.40747001T>CClinGen:CA791083C0406585 275210 Lethal tight skin contracture syndrome;
NM_005857.5(ZMPSTE24):c.951_954+2del10269ZMPSTE24Conflicting interpretations of pathogenicityrs747563189RCV000293484|RCV000329774|RCV000597416; NMONDO:MONDO:0016584,MedGen:C0432291,OMIM:PS248370, Orphanet:2457|MONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:1662|MedGen:CN51720214074719040747195CTAAAGTCNC_000001.10:g.40747190TAAAGT[1]ClinGen:CA791114C0406585 275210 Lethal tight skin contracture syndrome;
NM_005857.5(ZMPSTE24):c.990C>T (p.Leu330=)10269ZMPSTE24Benignrs116284141RCV000128762|RCV001098656|RCV001098657; NMedGen:CN517202|MONDO:MONDO:0012074,MedGen:C1837756,OMIM:608612, Orphanet:2457, Orphanet:90154|MONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:166214075163240751632CT1:g.40751632C>TClinGen:CA232771CN517202 not provided;
NM_005857.5(ZMPSTE24):c.1028G>A (p.Gly343Glu)10269ZMPSTE24Uncertain significancers554224406RCV001098658|RCV001098659|RCV001873479; NMONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:1662|MONDO:MONDO:0012074,MedGen:C1837756,OMIM:608612, Orphanet:2457, Orphanet:90154|MedGen:CN51720214075167040751670GA1:g.40751670G>A-
NM_005857.5(ZMPSTE24):c.1050T>C (p.Ile350=)10269ZMPSTE24Uncertain significancers1057515559RCV000280702|RCV000375255; NMONDO:MONDO:0012074,MedGen:C1837756,OMIM:608612, Orphanet:2457, Orphanet:90154|MONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:166214075169240751692TCNC_000001.10:g.40751692T>CClinGen:CA10611142C0406585 275210 Lethal tight skin contracture syndrome;
NM_005857.5(ZMPSTE24):c.1060-6_1085del10269ZMPSTE24Pathogenicrs1569668526RCV000986288; NMONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:166214075651940756550CTTTCTAGATGAATTCTTTCCTGTGTTTTTTTTC1:g.40756519_40756550del-
NM_005857.5(ZMPSTE24):c.1085dup (p.Leu362fs)10269ZMPSTE24Pathogenicrs137854889RCV000004492|RCV000023547|RCV000128723|RCV000335839; NMONDO:MONDO:0012074,MedGen:C1837756,OMIM:608612, Orphanet:2457, Orphanet:90154|MONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:1662|MedGen:CN517202|MedGen:CN23942514075654240756543GGT1:g.40756542_40756543insTClinGen:CA116749,OMIM:606480.0001C0406585 275210 Lethal tight skin contracture syndrome;
NM_005857.5(ZMPSTE24):c.1106G>A (p.Arg369Gln)10269ZMPSTE24Conflicting interpretations of pathogenicityrs41268053RCV000286716|RCV000402216|RCV000900421|RCV001820854; NMONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:1662|MONDO:MONDO:0012074,MedGen:C1837756,OMIM:608612, Orphanet:2457, Orphanet:90154|MedGen:CN517202|MedGen:CN16937414075657240756572GANC_000001.10:g.40756572G>AClinGen:CA791174C0406585 275210 Lethal tight skin contracture syndrome;
NM_005857.5(ZMPSTE24):c.1165T>C (p.Leu389=)10269ZMPSTE24Conflicting interpretations of pathogenicityrs138014589RCV000899944|RCV001100458|RCV001100459; NMedGen:CN517202|MONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:1662|MONDO:MONDO:0012074,MedGen:C1837756,OMIM:608612, Orphanet:2457, Orphanet:9015414075663140756631TC1:g.40756631T>C-
NM_005857.5(ZMPSTE24):c.1259C>G (p.Ala420Gly)10269ZMPSTE24Uncertain significancers200751802RCV001100461|RCV001100460; NMONDO:MONDO:0012074,MedGen:C1837756,OMIM:608612, Orphanet:2457, Orphanet:90154|MONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:166214075817240758172CG1:g.40758172C>G-
NM_005857.5(ZMPSTE24):c.1277G>A (p.Gly426Glu)10269ZMPSTE24Uncertain significancers371030454RCV001100462|RCV001100463; NMONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:1662|MONDO:MONDO:0012074,MedGen:C1837756,OMIM:608612, Orphanet:2457, Orphanet:9015414075819040758190GA1:g.40758190G>A-
NM_005857.5(ZMPSTE24):c.*38T>C10269ZMPSTE24Uncertain significancers374249092RCV001100464|RCV001102413; NMONDO:MONDO:0012074,MedGen:C1837756,OMIM:608612, Orphanet:2457, Orphanet:90154|MONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:166214075837940758379TC1:g.40758379T>C-
NM_005857.5(ZMPSTE24):c.*59C>A10269ZMPSTE24Benignrs193076795RCV000341728|RCV000408280; NMONDO:MONDO:0012074,MedGen:C1837756,OMIM:608612, Orphanet:2457, Orphanet:90154|MONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:166214075840040758400CANC_000001.10:g.40758400C>AClinGen:CA10609902C0406585 275210 Lethal tight skin contracture syndrome;
NM_005857.5(ZMPSTE24):c.*181GAAT[1]10269ZMPSTE24Uncertain significancers1040401350RCV000303317|RCV000364977; NMONDO:MONDO:0016584,MedGen:C0432291,OMIM:PS248370, Orphanet:2457|MONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:166214075852140758524CTGAACNC_000001.10:g.40758522GAAT[1]ClinGen:CA10609909C0406585 275210 Lethal tight skin contracture syndrome;
NM_005857.5(ZMPSTE24):c.*212G>T10269ZMPSTE24Uncertain significancers1057515560RCV000306674|RCV000408275; NMONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:1662|MONDO:MONDO:0012074,MedGen:C1837756,OMIM:608612, Orphanet:2457, Orphanet:9015414075855340758553GTNC_000001.10:g.40758553G>TClinGen:CA10611143C0406585 275210 Lethal tight skin contracture syndrome;
NM_005857.5(ZMPSTE24):c.*248G>A10269ZMPSTE24Uncertain significancers1200838897RCV001102414|RCV001102415; NMONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:1662|MONDO:MONDO:0012074,MedGen:C1837756,OMIM:608612, Orphanet:2457, Orphanet:9015414075858940758589GA1:g.40758589G>A-
NM_005857.5(ZMPSTE24):c.*296T>C10269ZMPSTE24Uncertain significancers990763063RCV000276054|RCV000363740; NMONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:1662|MONDO:MONDO:0012074,MedGen:C1837756,OMIM:608612, Orphanet:2457, Orphanet:9015414075863740758637TCNC_000001.10:g.40758637T>CClinGen:CA10610168C0406585 275210 Lethal tight skin contracture syndrome;
NM_005857.5(ZMPSTE24):c.*521A>G10269ZMPSTE24Benignrs75622994RCV000333378|RCV000367157; NMONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:1662|MONDO:MONDO:0012074,MedGen:C1837756,OMIM:608612, Orphanet:2457, Orphanet:9015414075886240758862AGNC_000001.10:g.40758862A>GClinGen:CA10610169C0406585 275210 Lethal tight skin contracture syndrome;
NM_005857.5(ZMPSTE24):c.*536C>T10269ZMPSTE24Uncertain significancers1057515564RCV000274919|RCV000318105; NMONDO:MONDO:0012074,MedGen:C1837756,OMIM:608612, Orphanet:2457, Orphanet:90154|MONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:166214075887740758877CTNC_000001.10:g.40758877C>TClinGen:CA10610172C0406585 275210 Lethal tight skin contracture syndrome;
NM_005857.5(ZMPSTE24):c.*663T>G10269ZMPSTE24Uncertain significancers1254121202RCV001097010|RCV001097011; NMONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:1662|MONDO:MONDO:0012074,MedGen:C1837756,OMIM:608612, Orphanet:2457, Orphanet:9015414075900440759004TG1:g.40759004T>G-
NM_005857.5(ZMPSTE24):c.*678G>C10269ZMPSTE24Likely benignrs67294434RCV000278101|RCV000375075; NMONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:1662|MONDO:MONDO:0012074,MedGen:C1837756,OMIM:608612, Orphanet:2457, Orphanet:9015414075901940759019GCNC_000001.10:g.40759019G>CClinGen:CA10610173C0406585 275210 Lethal tight skin contracture syndrome;
NM_005857.5(ZMPSTE24):c.*696A>G10269ZMPSTE24Uncertain significancers1057515522RCV000316798|RCV000378621; NMONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:1662|MONDO:MONDO:0012074,MedGen:C1837756,OMIM:608612, Orphanet:2457, Orphanet:9015414075903740759037AGNC_000001.10:g.40759037A>GClinGen:CA10610177C0406585 275210 Lethal tight skin contracture syndrome;
NM_005857.5(ZMPSTE24):c.*702C>T10269ZMPSTE24Uncertain significancers900182370RCV000286528|RCV000339111; NMONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:1662|MONDO:MONDO:0016584,MedGen:C0432291,OMIM:PS248370, Orphanet:245714075904340759043CTNC_000001.10:g.40759043C>TClinGen:CA10609910C0406585 275210 Lethal tight skin contracture syndrome;
NM_005857.5(ZMPSTE24):c.*710T>C10269ZMPSTE24Uncertain significancers1643862310RCV001098749|RCV001098750; NMONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:1662|MONDO:MONDO:0012074,MedGen:C1837756,OMIM:608612, Orphanet:2457, Orphanet:9015414075905140759051TC1:g.40759051T>C-
NM_005857.5(ZMPSTE24):c.*723C>T10269ZMPSTE24Benignrs10489431RCV000128710|RCV000291891|RCV000399297; NMedGen:CN517202|MONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:1662|MONDO:MONDO:0012074,MedGen:C1837756,OMIM:608612, Orphanet:2457, Orphanet:9015414075906440759064CT1:g.40759064C>TClinGen:CA232707C0406585 275210 Lethal tight skin contracture syndrome;
NM_005857.5(ZMPSTE24):c.*733A>G10269ZMPSTE24Likely benignrs75849141RCV001098751|RCV001100566; NMONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:1662|MONDO:MONDO:0012074,MedGen:C1837756,OMIM:608612, Orphanet:2457, Orphanet:9015414075907440759074AG1:g.40759074A>G-
NM_005857.5(ZMPSTE24):c.*800T>C10269ZMPSTE24Uncertain significancers1643862681RCV001100568|RCV001100567; NMONDO:MONDO:0012074,MedGen:C1837756,OMIM:608612, Orphanet:2457, Orphanet:90154|MONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:166214075914140759141TC1:g.40759141T>C-
NM_005857.5(ZMPSTE24):c.*890A>G10269ZMPSTE24Benignrs10489432RCV000128711|RCV000344466|RCV000392477; NMedGen:CN517202|MONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:1662|MONDO:MONDO:0012074,MedGen:C1837756,OMIM:608612, Orphanet:2457, Orphanet:9015414075923140759231AG1:g.40759231A>GClinGen:CA232708C0406585 275210 Lethal tight skin contracture syndrome;
NM_005857.5(ZMPSTE24):c.*909G>A10269ZMPSTE24Uncertain significancers770029830RCV001100570|RCV001100569; NMONDO:MONDO:0012074,MedGen:C1837756,OMIM:608612, Orphanet:2457, Orphanet:90154|MONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:166214075925040759250GA1:g.40759250G>A-
NM_005857.5(ZMPSTE24):c.*1042G>A10269ZMPSTE24Uncertain significancers1643863795RCV001100571|RCV001102508; NMONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:1662|MONDO:MONDO:0012074,MedGen:C1837756,OMIM:608612, Orphanet:2457, Orphanet:9015414075938340759383GA1:g.40759383G>A-
NM_005857.5(ZMPSTE24):c.*1140T>C10269ZMPSTE24Uncertain significancers1057515452RCV000314242|RCV000371246; NMONDO:MONDO:0012074,MedGen:C1837756,OMIM:608612, Orphanet:2457, Orphanet:90154|MONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:166214075948140759481TCNC_000001.10:g.40759481T>CClinGen:CA10611004C0406585 275210 Lethal tight skin contracture syndrome;
NM_005857.5(ZMPSTE24):c.*1240A>G10269ZMPSTE24Likely benignrs181730348RCV001102509|RCV001102510; NMONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:1662|MONDO:MONDO:0012074,MedGen:C1837756,OMIM:608612, Orphanet:2457, Orphanet:9015414075958140759581AG1:g.40759581A>G-
NM_005857.5(ZMPSTE24):c.*1313T>C10269ZMPSTE24Uncertain significancers975014449RCV000312710|RCV000392483; NMONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:1662|MONDO:MONDO:0012074,MedGen:C1837756,OMIM:608612, Orphanet:2457, Orphanet:9015414075965440759654TCNC_000001.10:g.40759654T>CClinGen:CA10609913C0406585 275210 Lethal tight skin contracture syndrome;
NM_005857.5(ZMPSTE24):c.*1462A>C10269ZMPSTE24Uncertain significancers907545770RCV001097103|RCV001102511; NMONDO:MONDO:0012074,MedGen:C1837756,OMIM:608612, Orphanet:2457, Orphanet:90154|MONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:166214075980340759803AC1:g.40759803A>C-
NM_005857.5(ZMPSTE24):c.*1492A>G10269ZMPSTE24Uncertain significancers1057515561RCV000263864|RCV000355792; NMONDO:MONDO:0012074,MedGen:C1837756,OMIM:608612, Orphanet:2457, Orphanet:90154|MONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:166214075983340759833AGNC_000001.10:g.40759833A>GClinGen:CA10611148C0406585 275210 Lethal tight skin contracture syndrome;
NM_005857.5(ZMPSTE24):c.*1503G>A10269ZMPSTE24Uncertain significancers899307859RCV001097104|RCV001097105; NMONDO:MONDO:0012074,MedGen:C1837756,OMIM:608612, Orphanet:2457, Orphanet:90154|MONDO:MONDO:0010143,MedGen:C0406585,OMIM:275210, Orphanet:166214075984440759844GA1:g.40759844G>A-
MSeqDR Portal