MSeqDR Mitochondrial Disease Portal


 
*:HP: HPO terms, UMDF: 1= Disease, ND: NAMDC terms.
  Most Studied  CPEO, Complex I Deficiency, COXPD1, Leigh, LHON, MELAS, MERRF, Myopathy, SANDO
Disease Browser
Parent Node:
expand
Muscle Spasticity (D009128)
Parent Node:
expand
Spinocerebellar Ataxias (D020754)
..Starting node
..expand
Spastic ataxia Charlevoix-Saguenay type (C536787)

       Child Nodes:



 Sister Nodes: 
..expandAnemia, sideroblastic spinocerebellar ataxia (C536358)
..expandAtaxia Telangiectasia (D001260) Child6
..expandChorioretinal Dystrophy, Spinocerebellar Ataxia, and Hypogonadotropic Hypogonadism (C565850)
..expandGemignani syndrome (C537678)
..expandMachado-Joseph Disease (D017827) Child1
..expandMITOCHONDRIAL DNA DEPLETION SYNDROME 7 (HEPATOCEREBRAL TYPE) (OMIM:271245)  LSDB  L: 00036;
..expandSpastic Ataxia (C564815)
..expandSpastic ataxia Charlevoix-Saguenay type (C536787)
..expandSpinocerebellar Ataxia 10 (C566874)
..expandSpinocerebellar Ataxia 11 (C565772)
..expandSpinocerebellar Ataxia 12 (C565790)
..expandSpinocerebellar ataxia 13 (C537195)
..expandSpinocerebellar ataxia 14 (C537196)
..expandSpinocerebellar Ataxia 15 (C564685)
..expandSpinocerebellar Ataxia 17 (C564616)
..expandSpinocerebellar ataxia 20 (C537199)
..expandSpinocerebellar ataxia 25 (C537202)
..expandSpinocerebellar ataxia 26 (C537203)
..expandSpinocerebellar ataxia 28 (C537205)  LSDB  L: 00498;
..expandSpinocerebellar ataxia 30 (C575214)
..expandSpinocerebellar Ataxia 31 (C566146)
..expandSpinocerebellar Ataxia And Plaque-Like Deposits (C566671)
..expandSpinocerebellar Ataxia with Dysmorphism (C564802)
..expandSpinocerebellar Ataxia with Epilepsy (C564395)
..expandSpinocerebellar Ataxia With Rigidity And Peripheral Neuropathy (C566669)
..expandSpinocerebellar ataxia, autosomal recessive 1 (C537308)
..expandSpinocerebellar Ataxia, Autosomal Recessive 7 (C563753)
..expandSpinocerebellar Ataxia, Autosomal Recessive 8 (C565188)
..expandSpinocerebellar Ataxia, Autosomal Recessive 9 (C567436)
..expandSpinocerebellar Ataxia, X-Linked 1 (C563134)
..expandSpinocerebellar Ataxia, X-Linked 5 (C567478)
   

Human Disease MESH is developed by UMLS.
Further data from MedGen, OMIM,ClinVar, CTD
Term ID:11365
Name:Spastic ataxia Charlevoix-Saguenay type
Definition:
Alternative IDs:DO:DOID:0050946|OMIM:270550
ParentIDs:MESH:D009128|MESH:D020754
TreeNumbers:C05.651.512/C536787 |C10.228.140.252.190.530/C536787 |C10.228.140.252.700.700/C536787 |C10.228.854.787.875/C536787 |C10.574.500.825.700/C536787 |C10.597.350.090.500.530/C536787 |C10.597.613.550.550/C536787 |C16.320.400.780.875/C536787 |C23.888.592.608.550.550/C5
Synonyms:ARSACS |Autosomal recessive spastic ataxia of Charlevoix-Saguenay |Charlevoix-Saguenay spastic ataxia |SACS |Spastic ataxia 6, autosomal recessive |Spastic Ataxia, Charlevoix-Saguenay Type |Spastic ataxia of Charlevoix-Saguenay |SPAX6
Slim Mappings:Genetic disease (inborn)|Musculoskeletal disease|Nervous system disease|Signs and symptoms
Reference: MedGen: C536787
MeSH: C536787
OMIM: 270550;
MSeqDR LSDB:  
Genes: SACS;
Phenotypes
1 HP:0000007Autosomal recessive inheritance
2 HP:0003593Infantile onset
3 HP:0003438Absent Achilles reflex
4 HP:0003487Babinski sign
5 HP:0006855Cerebellar vermis atrophy
6 HP:0003431Decreased motor nerve conduction velocity
7 HP:0003387Decreased number of large peripheral myelinated nerve fibers
8 HP:0003448Decreased sensory nerve conduction velocity
9 HP:0003693Distal amyotrophy
10 HP:0002460Distal muscle weakness
NAMDC:  Muscle weakness: distal
11 HP:0002936Distal sensory impairment
12 HP:0001260Dysarthria
NAMDC:  Dysarthria
13 HP:0001310Dysmetria
14 HP:0002527Falls
15 HP:0001765Hammertoe
16 HP:0007922Hypermyelinated retinal nerve fibers
17 HP:0001347Hyperreflexia
NAMDC:  Hyperreactive reflexes (incl. Babinski sign, Hoffman sign)
18 HP:0007772Impaired smooth pursuit
19 HP:0002166Impaired vibration sensation in the lower limbs
20 HP:0001249Intellectual disability
21 HP:0007001Loss of Purkinje cells in the cerebellar vermis
22 HP:0000639Nystagmus
23 HP:0001761Pes cavus
24 HP:0007240Progressive gait ataxia
25 HP:0007221Progressive truncal ataxia
26 HP:0002168Scanning speech
27 HP:0002497Spastic ataxia
28 HP:0001257Spasticity
NAMDC:  Spasticity
29 HP:0006150Swan neck-like deformities of the fingers
30 HP:0000012Urinary urgency
Disease Causing ClinVar Variants
Variation_NameGeneIDGeneSymbolClinicalSignificancedbSNPRCVaccessionTestedInGTRPhenotypeIDsChromosomeStartStopHGVS_cHGVS_pHGVS_gOtherIDsDisease_ClinVar
NM_014363.6(SACS):c.*1292A>T26278SACSUncertain significancers147476665RCV000289553; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390298323902983TANC_000013.10:g.23902983T>AClinGen:CA10639209C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.*1200A>G26278SACSUncertain significancers558041482RCV000346825; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390307523903075TC13:g.23903075T>CClinGen:CA10639211C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.*1162C>G26278SACSUncertain significancers1883303203RCV001113250; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390311323903113GC13:g.23903113G>C-
NM_014363.6(SACS):c.*1142G>A26278SACSUncertain significancers1883304820RCV001113251; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390313323903133CT13:g.23903133C>T-
NM_014363.6(SACS):c.*1108G>A26278SACSUncertain significancers139956143RCV001113252; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390316723903167CT13:g.23903167C>T-
NM_014363.6(SACS):c.*1039C>T26278SACSUncertain significancers1593117762RCV001113253; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390323623903236GA13:g.23903236G>A-
NM_014363.6(SACS):c.*942A>G26278SACSUncertain significancers886050068RCV000312018; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390333323903333TC13:g.23903333T>CClinGen:CA10643102C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.*919T>C26278SACSUncertain significancers1883315768RCV001114617; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390335623903356AG13:g.23903356A>G-
NM_014363.6(SACS):c.*916T>A26278SACSUncertain significancers75389729RCV001114618; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390335923903359AT13:g.23903359A>T-
NM_014363.6(SACS):c.*882A>C26278SACSUncertain significancers886050069RCV000350556; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390339323903393TG13:g.23903393T>GClinGen:CA10643104C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.*821A>G26278SACSUncertain significancers145184122RCV001114619|RCV001847160; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MONDO:MONDO:0019064,MedGen:C0037773,OMIM:PS303350, Orphanet:685132390345423903454TC13:g.23903454T>C-
NM_014363.6(SACS):c.*777T>C26278SACSUncertain significancers77645021RCV001114620; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390349823903498AG13:g.23903498A>G-
NM_014363.6(SACS):c.*716T>G26278SACSUncertain significancers1883326909RCV001114621; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390355923903559AC13:g.23903559A>C-
NM_014363.6(SACS):c.*711A>G26278SACSUncertain significancers368233436RCV001114622; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390356423903564TC13:g.23903564T>C-
NM_014363.6(SACS):c.*625T>A26278SACSUncertain significancers186505479RCV001108988; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390365023903650AT13:g.23903650A>T-
NM_014363.6(SACS):c.*569G>A26278SACSUncertain significancers554938605RCV001108989; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390370623903706CT13:g.23903706C>T-
NM_014363.6(SACS):c.*461G>A26278SACSUncertain significancers1003496096RCV001108990; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390381423903814CT13:g.23903814C>T-
NM_014363.6(SACS):c.*394G>A26278SACSUncertain significancers956360764RCV001108991; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390388123903881CT13:g.23903881C>T-
NM_014363.6(SACS):c.*307A>G26278SACSUncertain significancers576860445RCV000353517; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390396823903968TC13:g.23903968T>CClinGen:CA10644005C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.*222T>C26278SACSUncertain significancers577703833RCV001111338; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390405323904053AG13:g.23904053A>G-
NM_014363.6(SACS):c.*218T>C26278SACSUncertain significancers907847986RCV001111339; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390405723904057AG13:g.23904057A>G-
NM_014363.6(SACS):c.*20del26278SACSLikely benignrs143617437RCV000669879|RCV001571217; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202132390425523904255CTC13:g.23904255_23904255del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.13738_13739del (p.Ter4580LysextTer?)26278SACSUncertain significancers776682685RCV000599242|RCV000822418|RCV001274914; NMedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390427623904277TCATNC_000013.10:g.23904277AC[1]ClinGen:CA6909924
NM_014363.6(SACS):c.13717A>C (p.Asn4573His)26278SACSConflicting interpretations of pathogenicityrs34382952RCV000254363|RCV000515968|RCV000488235|RCV000674768|RCV001082378; NMedGen:CN169374|MONDO:MONDO:0019064,MedGen:C0037773,OMIM:PS303350, Orphanet:685|MedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:H132390429823904298TG13:g.23904298T>GClinGen:CA239310C0037773 Hereditary spastic paraplegia;
NM_014363.6(SACS):c.13694C>A (p.Ala4565Asp)26278SACSUncertain significancers375722463RCV001207368|RCV001833823; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390432123904321GT13:g.23904321G>T-
NM_014363.6(SACS):c.13645A>G (p.Asn4549Asp)26278SACSUncertain significancers1178912631RCV000669953; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390437023904370TC13:g.23904370T>C-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.13614C>G (p.Tyr4538Ter)26278SACSUncertain significancers927804920RCV000671783; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390440123904401GC13:g.23904401G>C-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.13614C>A (p.Tyr4538Ter)26278SACSLikely pathogenicrs927804920RCV001045016|RCV001832428; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390440123904401GT13:g.23904401G>T-
NM_014363.6(SACS):c.13588G>T (p.Gly4530Cys)26278SACSUncertain significance-1RCV001526398; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390442723904427CA23904427-
NM_014363.6(SACS):c.13574C>G (p.Thr4525Arg)26278SACSUncertain significancers750412600RCV000527900|RCV001834755; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390444123904441GCNC_000013.10:g.23904441G>CClinGen:CA6909943C0037772 Spastic paraplegia;
NM_014363.6(SACS):c.13563T>C (p.Asn4521=)26278SACSConflicting interpretations of pathogenicityrs766497653RCV001111340|RCV001490674; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132390445223904452AG13:g.23904452A>G-
NM_014363.6(SACS):c.13540C>T (p.Gln4514Ter)26278SACSUncertain significancers1555249133RCV000674771; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390447523904475GA13:g.23904475G>A-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.13538G>A (p.Ser4513Asn)26278SACSUncertain significancers138328181RCV000413289|RCV001274915; NMedGen:CN169374|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390447723904477CT13:g.23904477C>TClinGen:CA6909946CN169374 not specified;
NM_014363.6(SACS):c.13527dup (p.Glu4510fs)26278SACSPathogenicrs797045936RCV000194514; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390448723904488CCTNC_000013.10:g.23904488dupClinGen:CA277338C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.13512A>G (p.Ala4504=)26278SACSUncertain significancers886050070RCV000261019; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390450323904503TC13:g.23904503T>CClinGen:CA10644012C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.13509T>G (p.Thr4503=)26278SACSLikely benignrs745361567RCV001277474|RCV001495788; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132390450623904506AC13:g.23904506A>C-
NM_014363.6(SACS):c.13506A>G (p.Pro4502=)26278SACSLikely benignrs1593119067RCV000928492|RCV001272177; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390450923904509TC13:g.23904509T>C-
NM_014363.6(SACS):c.13476G>C (p.Val4492=)26278SACSConflicting interpretations of pathogenicity-1RCV001475170|RCV001578939; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390453923904539CG23904539-
NM_014363.6(SACS):c.13454T>C (p.Leu4485Ser)26278SACSPathogenicrs1566054340RCV000761525; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390456123904561AGNC_000013.10:g.23904561A>G-
NM_014363.6(SACS):c.13409A>G (p.Asn4470Ser)26278SACSUncertain significancers757326594RCV001113352; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390460623904606TC13:g.23904606T>C-
NM_014363.6(SACS):c.13405G>C (p.Ala4469Pro)26278SACSLikely pathogenicrs745961541RCV000672222; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390461023904610CG13:g.23904610C>G-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.13393del (p.Leu4465fs)26278SACSUncertain significancers1555249211RCV000669780; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390462223904622AGA13:g.23904622_23904622del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.13360del (p.Ala4454fs)26278SACSUncertain significancers1555249223RCV000674757; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390465523904655GCG13:g.23904655_23904655del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.13349G>A (p.Trp4450Ter)26278SACSUncertain significancers1555249236RCV000667694; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390466623904666CT13:g.23904666C>T-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.13344C>T (p.Arg4448=)26278SACSConflicting interpretations of pathogenicityrs200157359RCV001113353|RCV001514077; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132390467123904671GA13:g.23904671G>A-
NM_014363.6(SACS):c.13320G>A (p.Ser4440=)26278SACSUncertain significancers759847087RCV001277475|RCV001880227; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132390469523904695CT13:g.23904695C>T-
NM_014363.6(SACS):c.13283dup (p.Tyr4428Ter)26278SACSLikely pathogenicrs1057517123RCV000409320|RCV001218630; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132390473123904732GGT13:g.23904731_23904732insTClinGen:CA16041596C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.13284C>A (p.Tyr4428Ter)26278SACSLikely pathogenicrs753277514RCV000670810; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390473123904731GT13:g.23904731G>T-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.13284C>T (p.Tyr4428=)26278SACSLikely benignrs753277514RCV000906846|RCV001272178; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390473123904731GA13:g.23904731G>A-
NM_014363.6(SACS):c.13282T>G (p.Tyr4428Asp)26278SACSUncertain significancers886050071RCV000299853; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390473323904733AC13:g.23904733A>CClinGen:CA10644016C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.13281T>A (p.Thr4427=)26278SACSUncertain significancers1360709632RCV001113354; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390473423904734AT13:g.23904734A>T-
NM_014363.6(SACS):c.13276C>T (p.Gln4426Ter)26278SACSLikely pathogenicrs1555249276RCV000673080; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390473923904739GA13:g.23904739G>A-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.13273G>A (p.Gly4425Arg)26278SACSUncertain significancers754693143RCV000992778|RCV001832305; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390474223904742CT13:g.23904742C>T-
NM_014363.6(SACS):c.13272C>T (p.Ala4424=)26278SACSBenignrs567495567RCV000862462|RCV001272179; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390474323904743GA13:g.23904743G>A-
NM_014363.6(SACS):c.13269A>T (p.Ser4423=)26278SACSConflicting interpretations of pathogenicityrs1180908312RCV000517276|RCV001430724|RCV001783016; NMedGen:CN169374|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390474623904746TANC_000013.10:g.23904746T>AClinGen:CA483157685CN169374 not specified;
NM_014363.6(SACS):c.13225A>G (p.Lys4409Glu)26278SACSUncertain significance-1RCV001360855|RCV001826003; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390479023904790TC23904790-
NM_014363.6(SACS):c.13178_13185dup (p.Arg4396fs)26278SACSLikely pathogenicrs1555249326RCV000672108; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390482923904830TTCTGAAATG13:g.23904829_23904830insCTGAAATG-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.13132C>T (p.Arg4378Ter)26278SACSPathogenic/Likely pathogenicrs747868017RCV000410263|RCV001865265; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132390488323904883GA13:g.23904883G>AClinGen:CA16041597C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.13120_13121del (p.Arg4374fs)26278SACSLikely pathogenicrs1555249338RCV000666183; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390489423904895CCTC13:g.23904894_23904895del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.13119C>T (p.Asp4373=)26278SACSLikely benignrs368124828RCV000869013|RCV001835993; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390489623904896GA13:g.23904896G>A-
NM_014363.6(SACS):c.13106A>G (p.Asp4369Gly)26278SACSUncertain significancers770895110RCV000688293|RCV001830494; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390490923904909TCNC_000013.10:g.23904909T>C-C0037772 Spastic paraplegia;
NM_014363.6(SACS):c.13039A>G (p.Ile4347Val)26278SACSConflicting interpretations of pathogenicityrs200939906RCV000516513|RCV001412104|RCV001783015; NMedGen:CN169374|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390497623904976TCNC_000013.10:g.23904976T>CClinGen:CA6910031CN169374 not specified;
NM_014363.6(SACS):c.13036G>A (p.Asp4346Asn)26278SACSUncertain significancers372359781RCV000337604|RCV000765117; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390497923904979CT13:g.23904979C>TClinGen:CA6910032CN169374 not specified;
NM_014363.6(SACS):c.13031A>G (p.Asn4344Ser)26278SACSUncertain significancers886050072RCV000357075; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390498423904984TC13:g.23904984T>CClinGen:CA10644017C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.13027G>A (p.Glu4343Lys)26278SACSUncertain significancers749383532RCV000593745|RCV000671806; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390498823904988CT13:g.23904988C>TClinGen:CA6910035CN169374 not specified;
NM_014363.6(SACS):c.12991C>T (p.Arg4331Trp)26278SACSUncertain significancers1555249369RCV000669194; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390502423905024GA13:g.23905024G>A-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.12980del (p.Lys4327fs)26278SACSPathogenic/Likely pathogenicrs1555249371RCV000671013|RCV001380633; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132390503523905035CTC13:g.23905035_23905035del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.12973C>T (p.Arg4325Ter)26278SACSPathogenic/Likely pathogenicrs762947018RCV000169272|RCV001850396; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132390504223905042GANC_000013.10:g.23905042G>AClinGen:CA274116C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.12923_12927del (p.Lys4308fs)26278SACSPathogenic/Likely pathogenicrs1057517294RCV000409460; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390508823905092CTTCTTC13:g.23905088_23905092delClinGen:CA16041598C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.12905C>A (p.Ser4302Tyr)26278SACSUncertain significancers778808568RCV000701275|RCV001274916; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390511023905110GTNC_000013.10:g.23905110G>T-C0037772 Spastic paraplegia;
NM_014363.6(SACS):c.12884C>T (p.Pro4295Leu)26278SACSUncertain significancers781029021RCV000821880|RCV001825662; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390513123905131GA13:g.23905131G>A-
NM_014363.6(SACS):c.12851_12854del (p.Glu4284fs)26278SACSLikely pathogenicrs786204628RCV000169401; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390516123905164GCTCTGNC_000013.10:g.23905161CT[2]ClinGen:CA274258C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.12835_12837del (p.Leu4279del)26278SACSUncertain significancers1555249424RCV000668420; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390517823905180AAAGA13:g.23905178_23905180del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.12835_12836del (p.Leu4279fs)26278SACSPathogenic/Likely pathogenicrs1555249425RCV000674839|RCV001381028; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132390517923905180AAGA13:g.23905179_23905180del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.12830CTC[1] (p.Pro4278del)26278SACSUncertain significancers764766520RCV000673532; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390518023905182AGAGA13:g.23905180_23905182del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.12829C>T (p.Pro4277Ser)26278SACSConflicting interpretations of pathogenicityrs370655945RCV000867623|RCV001113355|RCV001288702|RCV001847073; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN169374|MONDO:MONDO:00190132390518623905186GA13:g.23905186G>A-
NM_014363.6(SACS):c.12816C>T (p.Gly4272=)26278SACSUncertain significancers142643824RCV001113356; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390519923905199GA13:g.23905199G>A-
NM_014363.6(SACS):c.12813T>G (p.Pro4271=)26278SACSConflicting interpretations of pathogenicityrs146376949RCV000712961|RCV001114727|RCV001529134|RCV001081835|RCV001848920; NMedGen:CN169374|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|M132390520223905202AC13:g.23905202A>CClinGen:CA6910078C0037772 Spastic paraplegia;
NM_014363.6(SACS):c.12812C>T (p.Pro4271Leu)26278SACSUncertain significancers779668584RCV001114728; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390520323905203GA13:g.23905203G>A-
NM_014363.6(SACS):c.12779del (p.Ser4260fs)26278SACSLikely pathogenicrs1555249460RCV000666945; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390523623905236AGA13:g.23905236_23905236del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.12775_12777del (p.Pro4259del)26278SACSUncertain significancers1555249469RCV000668231; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390523823905240AAGGA13:g.23905238_23905240del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.12766del (p.Asp4256fs)26278SACSLikely pathogenicrs1555249479RCV000669007; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390524923905249TCT13:g.23905249_23905249del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.12765G>A (p.Arg4255=)26278SACSConflicting interpretations of pathogenicityrs139692779RCV001114729|RCV001416509; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132390525023905250CT13:g.23905250C>T-
NM_014363.6(SACS):c.12762C>T (p.Ser4254=)26278SACSConflicting interpretations of pathogenicityrs11554397RCV000633091|RCV001114730|RCV001288701|RCV001571934|RCV001849009; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN169374|MedGen:CN517202|M132390525323905253GANC_000013.10:g.23905253G>AClinGen:CA6910094C0037772 Spastic paraplegia;
NM_014363.6(SACS):c.12700T>C (p.Tyr4234His)26278SACSUncertain significancers886050073RCV000264951; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390531523905315AG13:g.23905315A>GClinGen:CA10639217C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.12693T>C (p.Tyr4231=)26278SACSUncertain significancers1163399365RCV001114731; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390532223905322AG13:g.23905322A>G-
NM_014363.6(SACS):c.12688G>A (p.Gly4230Ser)26278SACSUncertain significancers746194271RCV000671127; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390532723905327CT13:g.23905327C>T-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.12661C>G (p.Leu4221Val)26278SACSUncertain significancers767622491RCV000670973; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390535423905354GC13:g.23905354G>C-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.12649A>G (p.Asn4217Asp)26278SACSConflicting interpretations of pathogenicityrs35799469RCV000224626|RCV000322346|RCV000251185|RCV001847950|RCV001079358; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN169374|MONDO:MONDO:0019064,MedGen:C0037773,OMIM:PS303350, Orphanet:685|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:H132390536623905366TC13:g.23905366T>CClinGen:CA6910119,UniProtKB:Q9NZJ4#VAR_059721CN517202 not provided;
NM_014363.6(SACS):c.12647A>G (p.Asp4216Gly)26278SACSConflicting interpretations of pathogenicityrs550068559RCV001114732|RCV001419743; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132390536823905368TC13:g.23905368T>C-
NM_014363.6(SACS):c.12635G>A (p.Arg4212Lys)26278SACSUncertain significancers1490155590RCV001277476; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390538023905380CT13:g.23905380C>T-
NM_014363.6(SACS):c.12622C>T (p.Gln4208Ter)26278SACSPathogenic/Likely pathogenicrs1555249555RCV000668994|RCV001232544; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132390539323905393GA13:g.23905393G>A-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.12606A>C (p.Thr4202=)26278SACSLikely benignrs780674369RCV000869829|RCV001825750; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390540923905409TG13:g.23905409T>G-
NM_014363.6(SACS):c.12597A>G (p.Pro4199=)26278SACSConflicting interpretations of pathogenicityrs112630127RCV000228765|RCV000379249|RCV000516975|RCV001560895|RCV001847972; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN169374|MedGen:CN517202|M132390541823905418TC13:g.23905418T>CClinGen:CA6910129CN169374 not specified;
NM_014363.6(SACS):c.12540del (p.Glu4180fs)26278SACSLikely pathogenicrs1057516347RCV000412310; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390547523905475ATANC_000013.10:g.23905476delClinGen:CA16041599C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.12538G>T (p.Glu4180Ter)26278SACSPathogenic-1RCV001391383; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390547723905477CA23905477-
NM_014363.6(SACS):c.12500C>T (p.Thr4167Ile)26278SACSUncertain significancers764098635RCV001217357|RCV001828724; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390551523905515GA13:g.23905515G>A-
NM_014363.6(SACS):c.12451C>T (p.Leu4151=)26278SACSBenign-1RCV001513906|RCV001826362; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390556423905564GA23905564-
NM_014363.6(SACS):c.12438G>A (p.Ser4146=)26278SACSConflicting interpretations of pathogenicityrs150959878RCV000268383|RCV000861751|RCV001848096; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0019064,MedGen:C00377132390557723905577CT13:g.23905577C>TClinGen:CA6910143C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.12434_12435del (p.Ser4145fs)26278SACSLikely pathogenicrs1555249599RCV000670397; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390558023905581AAGA13:g.23905580_23905581del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.12407_12411del (p.Leu4136fs)26278SACSLikely pathogenicrs1555249607RCV000666804; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390560423905608TGTCAAT13:g.23905604_23905608del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.12323C>G (p.Ser4108Ter)26278SACSLikely pathogenicrs1555249633RCV000671025; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390569223905692GC13:g.23905692G>C-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.12304T>C (p.Leu4102=)26278SACSBenign/Likely benignrs2737699RCV000118230|RCV000325147|RCV000676348|RCV001517093|RCV001847718; NMedGen:CN169374|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|M132390571123905711AG13:g.23905711A>GClinGen:CA155040CN517202 not provided;
NM_014363.6(SACS):c.12268C>A (p.His4090Asn)26278SACSPathogenic-1RCV001391382; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390574723905747GT23905747-
NM_014363.6(SACS):c.12260A>G (p.Tyr4087Cys)26278SACSUncertain significancers373478772RCV000712960|RCV001274917; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390575523905755TCNC_000013.10:g.23905755T>C-
NM_014363.6(SACS):c.12232C>T (p.Arg4078Ter)26278SACSPathogenic/Likely pathogenicrs141315518RCV000169220|RCV001850393; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132390578323905783GA13:g.23905783G>AClinGen:CA274060C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.12232C>A (p.Arg4078=)26278SACSLikely benignrs141315518RCV000861383|RCV001272180; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390578323905783GT13:g.23905783G>T-
NM_014363.6(SACS):c.12220G>C (p.Ala4074Pro)26278SACSPathogenicrs137853016RCV000005849; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390579523905795CG13:g.23905795C>GClinGen:CA253511,UniProtKB:Q9NZJ4#VAR_064822,OMIM:604490.0003C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.12218_12219del (p.Phe4073fs)26278SACSPathogenic/Likely pathogenicrs1555249648RCV000673405|RCV001861822; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132390579623905797CAAC13:g.23905796_23905797del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.12216T>A (p.Thr4072=)26278SACSConflicting interpretations of pathogenicityrs574182225RCV000382122|RCV000518146|RCV000865044; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN169374|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132390579923905799AT13:g.23905799A>TClinGen:CA6910164CN169374 not specified;
NM_014363.6(SACS):c.12190C>A (p.Pro4064Thr)26278SACSUncertain significancers200707453RCV001288699|RCV001835372; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390582523905825GT23905825-
NM_014363.6(SACS):c.12160C>T (p.Gln4054Ter)26278SACSPathogenic/Likely pathogenicrs281865120RCV000032008|RCV000487627|RCV001044731; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132390585523905855GA13:g.23905855G>AClinGen:CA343113CN517202 not provided;
NM_014363.6(SACS):c.12150del (p.Phe4050fs)26278SACSLikely pathogenicrs1555249662RCV000669297; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390586523905865CAC13:g.23905865_23905865del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.12148T>C (p.Phe4050Leu)26278SACSLikely benignrs147013767RCV001049336|RCV001274918|RCV001644778; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN169374132390586723905867AGNC_000013.10:g.23905867A>G-
NM_014363.6(SACS):c.12130G>C (p.Gly4044Arg)26278SACSUncertain significancers753511073RCV001288698|RCV001835371; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390588523905885CG23905885-
NM_014363.6(SACS):c.12075T>G (p.Asn4025Lys)26278SACSUncertain significancers778310483RCV001037235|RCV001277477; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390594023905940AC13:g.23905940A>C-
NM_014363.6(SACS):c.12063T>C (p.His4021=)26278SACSConflicting interpretations of pathogenicityrs886050074RCV000290073|RCV002056363; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132390595223905952AG13:g.23905952A>GClinGen:CA10643105C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.12059A>G (p.Lys4020Arg)26278SACSUncertain significancers1328721442RCV000798545|RCV001825572; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390595623905956TC13:g.23905956T>C-
NM_014363.6(SACS):c.12054del (p.Ile4018_Met4019insTer)26278SACSLikely pathogenicrs1555249695RCV000668875; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390596123905961TAT13:g.23905961_23905961del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.12035T>C (p.Ile4012Thr)26278SACSUncertain significancers1883497856RCV001109105; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390598023905980AG13:g.23905980A>G-
NM_014363.6(SACS):c.12020C>T (p.Ser4007Phe)26278SACSUncertain significancers1314135259RCV000673945; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390599523905995GA13:g.23905995G>A-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.12011_12019del (p.Leu4004_Leu4006del)26278SACSLikely pathogenic-1RCV001542778; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390599623906004GACAAGAGTAG23905995-
NM_014363.6(SACS):c.12014T>C (p.Leu4005Pro)26278SACSPathogenic-1RCV001391381; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390600123906001AG23906001-
NM_014363.6(SACS):c.11941C>T (p.Gln3981Ter)26278SACSPathogenicrs1593121484RCV000988964|RCV001858698; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132390607423906074GA13:g.23906074G>A-
NM_014363.6(SACS):c.11935G>T (p.Glu3979Ter)26278SACSLikely pathogenicrs1555249745RCV000674023; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390608023906080CA13:g.23906080C>A-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.11928T>C (p.Ser3976=)26278SACSConflicting interpretations of pathogenicityrs145680118RCV000347323|RCV000862657|RCV001660625; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MedGen:CN169374132390608723906087AG13:g.23906087A>GClinGen:CA6910201C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.11927G>A (p.Ser3976Asn)26278SACSUncertain significancers1883504909RCV001277478; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390608823906088CT13:g.23906088C>T-
NM_014363.6(SACS):c.11901A>G (p.Gln3967=)26278SACSUncertain significancers572068106RCV000517047|RCV001835833; NMedGen:CN169374|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390611423906114TCNC_000013.10:g.23906114T>CClinGen:CA6910208CN169374 not specified;
NM_014363.6(SACS):c.11887A>G (p.Met3963Val)26278SACSUncertain significancers375613914RCV001288697|RCV001830099; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390612823906128TC23906128-
NM_014363.6(SACS):c.11886A>G (p.Ile3962Met)26278SACSUncertain significance-1RCV001663546|RCV001832844; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390612923906129TC23906129-
NM_014363.6(SACS):c.11884A>T (p.Ile3962Leu)26278SACSConflicting interpretations of pathogenicityrs746953932RCV000413922|RCV000863721|RCV001111441; NMedGen:CN169374|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390613123906131TA13:g.23906131T>AClinGen:CA6910211CN169374 not specified;
NM_014363.6(SACS):c.11877dup (p.Lys3960Ter)26278SACSLikely pathogenicrs1555249766RCV000665628; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390613723906138TTA13:g.23906137_23906138insA-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.11857_11859del (p.Lys3953del)26278SACSUncertain significancers1555249772RCV000667378; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390615623906158CTTTC13:g.23906156_23906158del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.11853A>G (p.Leu3951=)26278SACSUncertain significancers1883510768RCV001288696|RCV001835370; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390616223906162TC23906162-
NM_014363.6(SACS):c.11792A>G (p.Lys3931Arg)26278SACSUncertain significancers764554878RCV000385354; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390622323906223TC13:g.23906223T>CClinGen:CA6910218C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.11780C>T (p.Ala3927Val)26278SACSUncertain significancers142926244RCV001242971|RCV001835147; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390623523906235GA13:g.23906235G>A-
NM_014363.6(SACS):c.11772dup (p.Asp3925Ter)26278SACSLikely pathogenicrs1555249789RCV000671109; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390624223906243CCA13:g.23906242_23906243insA-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.11738A>T (p.Asp3913Val)26278SACSUncertain significancers1236705431RCV000815522|RCV001825639; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390627723906277TA13:g.23906277T>A-
NM_014363.6(SACS):c.11737G>C (p.Asp3913His)26278SACSUncertain significancers746782589RCV000494097|RCV001829412; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390627823906278CGNC_000013.10:g.23906278C>GClinGen:CA6910228
NM_014363.6(SACS):c.11731del (p.Ser3911fs)26278SACSLikely pathogenicrs1057517232RCV000411930; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390628423906284CTCNC_000013.10:g.23906285delClinGen:CA16041600C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.11717C>T (p.Ala3906Val)26278SACSUncertain significancers375961779RCV000538311|RCV001835845; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390629823906298GA13:g.23906298G>AClinGen:CA6910234C0037772 Spastic paraplegia;
NM_014363.6(SACS):c.11713del (p.Ala3906fs)26278SACSLikely pathogenicrs1555249797RCV000667644; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390630223906302AGA13:g.23906302_23906302del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.11707C>T (p.Arg3903Ter)26278SACSPathogenicrs774906736RCV000458276|RCV000624366|RCV001785620; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MeSH:D030342,MedGen:C0950123|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390630823906308GANC_000013.10:g.23906308G>AClinGen:CA6910236C0950123 Inborn genetic diseases;
NM_014363.6(SACS):c.11688G>A (p.Arg3896=)26278SACSConflicting interpretations of pathogenicityrs116791509RCV000233808|RCV000293354|RCV000518611|RCV001563142|RCV001847971; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN169374|MedGen:CN517202|M132390632723906327CT13:g.23906327C>TClinGen:CA6910240CN169374 not specified;
NM_014363.6(SACS):c.11684T>G (p.Val3895Gly)26278SACSUncertain significancers766487632RCV001303997|RCV001835466; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390633123906331AC23906331-
NM_014363.6(SACS):c.11637_11638del (p.Arg3879fs)26278SACSPathogenicrs1593121924RCV000850595; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390637723906378ACTA13:g.23906377_23906378del-
NM_014363.6(SACS):c.11627_11628del (p.Thr3876fs)26278SACSLikely pathogenicrs1555249826RCV000671709; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390638723906388CTGC13:g.23906387_23906388del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.11624G>A (p.Arg3875His)26278SACSLikely pathogenicrs863224916RCV001843500|RCV001848018; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MONDO:MONDO:0019064,MedGen:C0037773,OMIM:PS303350, Orphanet:685132390639123906391CTNC_000013.10:g.23906391C>TClinVar:424796,ClinGen:CA351289C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.11576G>A (p.Arg3859His)26278SACSUncertain significancers149427669RCV001336179; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390643923906439CT23906439-
NM_014363.6(SACS):c.11535A>G (p.Glu3845=)26278SACSLikely benign-1RCV001506234|RCV001832673; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390648023906480TC23906480-
NM_014363.6(SACS):c.11506_11521del (p.His3836fs)26278SACSLikely pathogenicrs1555249878RCV000674360; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390649423906509TGTTTGAACAACTGGTGT13:g.23906494_23906509del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.11509C>T (p.Gln3837Ter)26278SACSLikely pathogenicrs1555249881RCV000669284; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390650623906506GA13:g.23906506G>A-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.11432T>C (p.Val3811Ala)26278SACSUncertain significance-1RCV001579248; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390658323906583AG23906583-
NM_014363.6(SACS):c.11428dup (p.Glu3810fs)26278SACSLikely pathogenicrs1555249894RCV000674129; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390658623906587TTC13:g.23906586_23906587insC-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.11409G>T (p.Trp3803Cys)26278SACSUncertain significancers886050075RCV000350663; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390660623906606CA13:g.23906606C>AClinGen:CA10643107C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.11380G>T (p.Val3794Phe)26278SACSUncertain significancers753844954RCV000712957|RCV001825423; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390663523906635CANC_000013.10:g.23906635C>A-
NM_014363.6(SACS):c.11374C>T (p.Arg3792Ter)26278SACSPathogenicrs565203731RCV000411243|RCV001310676; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202132390664123906641GA13:g.23906641G>AClinGen:CA16041601C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.11373dup (p.Arg3792fs)26278SACSLikely pathogenicrs1555249904RCV000673091; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390664123906642GGC13:g.23906641_23906642insC-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.11327T>C (p.Ile3776Thr)26278SACSUncertain significancers145188410RCV000698539|RCV001111442; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390668823906688AGNC_000013.10:g.23906688A>G-C0037772 Spastic paraplegia;
NM_014363.6(SACS):c.11309C>G (p.Ala3770Gly)26278SACSUncertain significancers1170997950RCV000992776|RCV001827137; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390670623906706GC13:g.23906706G>C-
NM_014363.6(SACS):c.11302A>G (p.Thr3768Ala)26278SACSUncertain significancers774463808RCV000992775|RCV001827136; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390671323906713TC13:g.23906713T>C-
NM_014363.6(SACS):c.11301A>T (p.Lys3767Asn)26278SACSUncertain significancers762041995RCV000992774|RCV001274919|RCV001858755; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132390671423906714TA13:g.23906714T>A-
NM_014363.6(SACS):c.11291A>C (p.Glu3764Ala)26278SACSUncertain significancers1593122374RCV000815122|RCV001825638; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390672423906724TG13:g.23906724T>G-
NM_014363.6(SACS):c.11282del (p.Leu3761fs)26278SACSLikely pathogenic-1RCV001588048; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390673323906733CAC23906732-
NM_014363.6(SACS):c.11265_11266del (p.Ile3755fs)26278SACSPathogenicrs1400601705RCV000664974|RCV001291595|RCV001387161; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132390674923906750CATC13:g.23906749_23906750del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.11264T>C (p.Ile3755Thr)26278SACSUncertain significancers781590547RCV001050310|RCV001827317; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390675123906751AG13:g.23906751A>G-
NM_014363.6(SACS):c.11247_11250del (p.Asn3750fs)26278SACSLikely pathogenicrs753205260RCV000411155; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390676523906768TATTGT13:g.23906765_23906768delClinGen:CA6910317C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.11249A>G (p.Asn3750Ser)26278SACSUncertain significance-1RCV001507814|RCV001785821|RCV001847284|RCV001865926; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MONDO:MONDO:0019064,MedGen:C0037773,OMIM:PS303350, Orphanet:685|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human 132390676623906766TC23906766-
NM_014363.6(SACS):c.11215G>A (p.Val3739Ile)26278SACSUncertain significancers1027336196RCV000992773|RCV001273193; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390680023906800CT13:g.23906800C>T-
NM_014363.6(SACS):c.11207T>C (p.Met3736Thr)26278SACSUncertain significance-1RCV001663544|RCV001827568; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390680823906808AG23906808-
NM_014363.6(SACS):c.11185C>T (p.Gln3729Ter)26278SACSLikely pathogenicrs1057516398RCV000409109; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390683023906830GA13:g.23906830G>AClinGen:CA16041602C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.11179C>T (p.Gln3727Ter)26278SACSLikely pathogenicrs1555249966RCV000666271; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390683623906836GA13:g.23906836G>A-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.11161G>A (p.Gly3721Ser)26278SACSUncertain significancers780789569RCV000712956|RCV001830583; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390685423906854CTNC_000013.10:g.23906854C>T-
NM_014363.6(SACS):c.11149_11150insT (p.Lys3717fs)26278SACSLikely pathogenicrs1555249977RCV000666783; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390686523906866TTA13:g.23906865_23906866insA-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.11150A>T (p.Lys3717Ile)26278SACSUncertain significancers1883567634RCV001296954|RCV001830141; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390686523906865TA23906865-
NM_014363.6(SACS):c.11116A>G (p.Ile3706Val)26278SACSUncertain significancers748237614RCV001208129|RCV001828667; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390689923906899TC13:g.23906899T>C-
NM_014363.6(SACS):c.11109C>T (p.Ser3703=)26278SACSConflicting interpretations of pathogenicityrs1883570677RCV001288695|RCV001454515|RCV001780235; NMedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390690623906906GA23906906-
NM_014363.6(SACS):c.11101T>C (p.Trp3701Arg)26278SACSAffectsrs773588375RCV000757941; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390691423906914AGNC_000013.10:g.23906914A>G-
NM_014363.6(SACS):c.11081dup (p.Cys3694fs)26278SACSLikely pathogenicrs1057516856RCV000410800; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390693323906934AAC13:g.23906933_23906934insCClinGen:CA16041603C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.11066C>A (p.Pro3689Gln)26278SACSUncertain significancers148925505RCV000761851|RCV001111443|RCV001241078|RCV001849092; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:00190132390694923906949GTNC_000013.10:g.23906949G>T-
NM_014363.6(SACS):c.11049T>C (p.Asn3683=)26278SACSConflicting interpretations of pathogenicityrs773770705RCV000973335|RCV001664583|RCV001832214|RCV001847118; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MedGen:CN169374|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MONDO:MONDO:00190132390696623906966AG13:g.23906966A>G-
NM_014363.6(SACS):c.11048A>G (p.Asn3683Ser)26278SACSConflicting interpretations of pathogenicityrs138609508RCV001200357|RCV001491334|RCV001780106; NMedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390696723906967TC13:g.23906967T>C-
NM_014363.6(SACS):c.11042dup (p.Phe3682fs)26278SACSLikely pathogenicrs756597098RCV000412102; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390697223906973CCT13:g.23906972_23906973insTClinGen:CA6910349C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.11039_11040insTA (p.Phe3682fs)26278SACSLikely pathogenicrs1555250016RCV000674086; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390697523906976TTTA13:g.23906975_23906976insTA-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.11032C>G (p.Pro3678Ala)26278SACSBenign/Likely benignrs17078601RCV000254240|RCV000676350|RCV000398344|RCV000456504|RCV001848026; NMedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|M132390698323906983GCNC_000013.10:g.23906983G>CClinGen:CA6910351,UniProtKB:Q9NZJ4#VAR_059720CN517202 not provided;
NM_014363.6(SACS):c.11027C>T (p.Thr3676Ile)26278SACSUncertain significancers1883575875RCV001113444; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390698823906988GA13:g.23906988G>A-
NM_014363.6(SACS):c.10993_11002dup (p.Pro3668fs)26278SACSLikely pathogenicrs1555250022RCV000664740; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390701223907013GGGATGAAATCT13:g.23907012_23907013insGATGAAATCT-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.11003C>G (p.Pro3668Arg)26278SACSUncertain significancers1883577094RCV001277479; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390701223907012GC13:g.23907012G>C-
NM_014363.6(SACS):c.10983G>A (p.Ala3661=)26278SACSLikely benignrs200900703RCV001277480|RCV001644967; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN169374132390703223907032CT13:g.23907032C>T-
NM_014363.6(SACS):c.10982C>T (p.Ala3661Val)26278SACSConflicting interpretations of pathogenicityrs36061856RCV000193480|RCV000230933|RCV000278445|RCV001079338|RCV001847870; NMedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|M132390703323907033GANC_000013.10:g.23907033G>AClinGen:CA207002CN169374 not specified;
NM_014363.6(SACS):c.10980C>T (p.Pro3660=)26278SACSConflicting interpretations of pathogenicityrs141353693RCV000861725|RCV001825710|RCV001849148; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MONDO:MONDO:0019064,MedGen:C00377132390703523907035GA13:g.23907035G>A-
NM_014363.6(SACS):c.10967C>G (p.Pro3656Arg)26278SACSUncertain significancers886050076RCV000335796; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390704823907048GC13:g.23907048G>CClinGen:CA10643108C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.10954C>A (p.Pro3652Thr)26278SACSUncertain significancers201505036RCV000466695|RCV001288373|RCV001833594; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390706123907061GTNC_000013.10:g.23907061G>TClinGen:CA6910364C0037772 Spastic paraplegia;
NM_014363.6(SACS):c.10932dup (p.Leu3645fs)26278SACSPathogenic-1RCV001391627; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390708223907083GGA23907082-
NM_014363.6(SACS):c.10909A>G (p.Met3637Val)26278SACSConflicting interpretations of pathogenicityrs150309559RCV000863055|RCV001113445; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390710623907106TC13:g.23907106T>C-
NM_014363.6(SACS):c.10907G>A (p.Arg3636Gln)26278SACSUncertain significancers281865119RCV000032007|RCV001244900; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132390710823907108CT13:g.23907108C>TClinGen:CA343112,UniProtKB:Q9NZJ4#VAR_064818C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.10906C>T (p.Arg3636Ter)26278SACSPathogenic/Likely pathogenicrs780247476RCV000192438|RCV000633059; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132390710923907109GANC_000013.10:g.23907109G>AClinGen:CA276970C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.10896A>G (p.Ile3632Met)26278SACSConflicting interpretations of pathogenicityrs35256065RCV000392204|RCV000633069|RCV000518679|RCV001573868; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MedGen:CN169374|MedGen:CN517202132390711923907119TC13:g.23907119T>CClinGen:CA6910375CN169374 not specified;
NM_014363.6(SACS):c.10864C>T (p.Gln3622Ter)26278SACSLikely pathogenicrs1057516578RCV000412194; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390715123907151GA13:g.23907151G>AClinGen:CA16041604C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.10854del (p.Glu3619fs)26278SACSLikely pathogenicrs1057516773RCV000410993; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390716123907161CTC13:g.23907161_23907161delClinGen:CA16041605C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.10822_10823del (p.Ser3608fs)26278SACSPathogenic/Likely pathogenicrs1555250082RCV000673586|RCV000734417; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202132390719223907193ACTANC_000013.10:g.23907192_23907193del-
NM_014363.6(SACS):c.10821C>A (p.Ile3607=)26278SACSConflicting interpretations of pathogenicityrs113595574RCV000226968|RCV000516532|RCV001113446|RCV001847970|RCV001689760; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MedGen:CN169374|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MONDO:MONDO:00190132390719423907194GTNC_000013.10:g.23907194G>TClinGen:CA6910385CN169374 not specified;
NM_014363.6(SACS):c.10819A>G (p.Ile3607Val)26278SACSUncertain significancers372494676RCV001278819; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390719623907196TC13:g.23907196T>C-
NM_014363.6(SACS):c.10813A>T (p.Lys3605Ter)26278SACSPathogenicrs1360298758RCV000625786; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390720223907202TA13:g.23907202T>AClinGen:CA387511366C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.10804C>T (p.Gln3602Ter)26278SACSPathogenic/Likely pathogenicrs1057517002RCV000411733|RCV001861386; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132390721123907211GA13:g.23907211G>AClinGen:CA16041606C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.10790A>G (p.Gln3597Arg)26278SACSUncertain significance-1RCV001359227|RCV001825992; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390722523907225TC23907225-
NM_014363.6(SACS):c.10787C>T (p.Ser3596Phe)26278SACSUncertain significancers755172172RCV001288372|RCV001836255; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390722823907228GA23907228-
NM_014363.6(SACS):c.10780A>T (p.Ile3594Leu)26278SACSUncertain significancers994425261RCV001333045; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390723523907235TA23907235-
NM_014363.6(SACS):c.10755_10757del (p.Phe3585del)26278SACSUncertain significancers771277098RCV000671400; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390725823907260TAAGT13:g.23907258_23907260del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.10737G>A (p.Met3579Ile)26278SACSUncertain significancers199970621RCV000992771|RCV001274920; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390727823907278CT13:g.23907278C>T-
NM_014363.6(SACS):c.10731A>C (p.Thr3577=)26278SACSLikely benignrs759287298RCV000980730|RCV001395880|RCV001827103; NMedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390728423907284TG13:g.23907284T>G-
NM_014363.6(SACS):c.10716C>G (p.Pro3572=)26278SACSConflicting interpretations of pathogenicityrs886050077RCV000300713|RCV001493823; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132390729923907299GCNC_000013.10:g.23907299G>CClinGen:CA10644019C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.10705C>T (p.Leu3569Phe)26278SACSUncertain significancers1883603870RCV001113447; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390731023907310GA13:g.23907310G>A-
NM_014363.6(SACS):c.10699G>A (p.Glu3567Lys)26278SACSUncertain significancers886050078RCV000358026; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390731623907316CTNC_000013.10:g.23907316C>TClinGen:CA10644020C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.10686_10689del (p.Phe3562fs)26278SACSLikely pathogenicrs779338945RCV000410430; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390732623907329TAAAGT13:g.23907326_23907329delClinGen:CA6910411C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.10675C>G (p.Pro3559Ala)26278SACSUncertain significancers767704103RCV000518436|RCV000633011|RCV001783014; NMedGen:CN169374|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390734023907340GCNC_000013.10:g.23907340G>CClinGen:CA6910413CN169374 not specified;
NM_014363.6(SACS):c.10668G>A (p.Leu3556=)26278SACSConflicting interpretations of pathogenicityrs139517699RCV000676351|RCV001086031|RCV001783099; NMedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390734723907347CT13:g.23907347C>TClinGen:CA6910414CN517202 not provided;
NM_014363.6(SACS):c.10651_10656del (p.Met3551_Leu3552del)26278SACSUncertain significancers1555250156RCV000664815; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390735923907364GAAGCATG13:g.23907359_23907364del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.10644del (p.Phe3548fs)26278SACSPathogenicrs1555250160RCV000625764; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390737123907371CAC13:g.23907371_23907371delClinGen:CA658798030C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.10634_10635del (p.Val3545fs)26278SACSPathogenic-1RCV001391626; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390738023907381TCAT23907379-
NM_014363.6(SACS):c.10622A>G (p.Tyr3541Cys)26278SACSUncertain significancers747013127RCV000517352|RCV001829472; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390739323907393TCNC_000013.10:g.23907393T>CClinGen:CA6910422CN169374 not specified;
NM_014363.6(SACS):c.10611A>G (p.Ala3537=)26278SACSConflicting interpretations of pathogenicityrs137856939RCV000516579|RCV000392205|RCV001079473|RCV000710203|RCV001847969; NMedGen:CN169374|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MedGen:CN517202|M132390740423907404TCNC_000013.10:g.23907404T>CClinGen:CA6910424CN169374 not specified;
NM_014363.6(SACS):c.10576A>G (p.Ile3526Val)26278SACSConflicting interpretations of pathogenicityrs199881455RCV000304456|RCV001504069; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132390743923907439TCNC_000013.10:g.23907439T>CClinGen:CA6910428C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.10546C>T (p.Gln3516Ter)26278SACSLikely pathogenicrs1593123432RCV001004402; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390746923907469GA13:g.23907469G>A-
NM_014363.6(SACS):c.10536del (p.Ile3513fs)26278SACSLikely pathogenicrs1555250183RCV000673391; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390747923907479TCT13:g.23907479_23907479del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.10534G>C (p.Glu3512Gln)26278SACSUncertain significancers1883614344RCV001114842; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390748123907481CG13:g.23907481C>G-
NM_014363.6(SACS):c.10515A>C (p.Ser3505=)26278SACSUncertain significancers1883615412RCV001114843; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390750023907500TG13:g.23907500T>G-
NM_014363.6(SACS):c.10513T>C (p.Ser3505Pro)26278SACSUncertain significancers1883615724RCV001114844; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390750223907502AG13:g.23907502A>G-
NM_014363.6(SACS):c.10508_10510del (p.Arg3503_Leu3504delinsIle)26278SACSUncertain significancers1555250190RCV000673787; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390750523907507AATCA13:g.23907505_23907507del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.10501_10505del (p.Leu3500_Lys3501insTer)26278SACSLikely pathogenicrs1555250191RCV000674437; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390751023907514ATTCTTA13:g.23907510_23907514del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.10497C>A (p.Tyr3499Ter)26278SACSPathogenic/Likely pathogenicrs755186798RCV000409179|RCV001861363; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132390751823907518GT13:g.23907518G>TClinGen:CA16041607C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.10485G>A (p.Glu3495=)26278SACSConflicting interpretations of pathogenicityrs757255802RCV001114845|RCV001472210; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132390753023907530CT13:g.23907530C>T-
NM_014363.6(SACS):c.10482A>G (p.Leu3494=)26278SACSBenignrs149643158RCV000868694|RCV001273194|RCV001664505; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN169374132390753323907533TC13:g.23907533T>C-
NM_014363.6(SACS):c.10466_10467del (p.Ser3489fs)26278SACSLikely pathogenicrs786204416RCV000168999; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390754823907549AAGANC_000013.10:g.23907549GA[2]ClinGen:CA273875C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.10461_10462delinsAA (p.Asn3487_Leu3488delinsLysIle)26278SACSUncertain significancers886043821RCV000303594|RCV001782778; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390755323907554GATTNC_000013.10:g.23907553_23907554delinsTTClinGen:CA10605992CN169374 not specified;
NM_014363.6(SACS):c.10443C>G (p.Leu3481=)26278SACSConflicting interpretations of pathogenicityrs144087359RCV000361442|RCV000862081|RCV001723893|RCV001288370|RCV001848097; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MedGen:CN169374|MedGen:CN517202|M132390757223907572GCNC_000013.10:g.23907572G>CClinGen:CA6910450C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.10438C>T (p.His3480Tyr)26278SACSUncertain significancers761189797RCV001243104|RCV001829014; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390757723907577GA13:g.23907577G>A-
NM_014363.6(SACS):c.10424_10426del (p.Glu3475del)26278SACSUncertain significancers1555250217RCV000672202; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390758923907591ACCTA13:g.23907589_23907591del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.10387T>C (p.Tyr3463His)26278SACSUncertain significancers1883623876RCV001238280|RCV001834064; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390762823907628AG13:g.23907628A>G-
NM_014363.6(SACS):c.10379_10383del (p.Lys3460fs)26278SACSLikely pathogenicrs1555250255RCV000668473; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390763223907636GTTCTTG13:g.23907632_23907636del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.10338G>A (p.Gln3446=)26278SACSBenignrs2737701RCV000118229|RCV000270430|RCV000676352|RCV001509973|RCV001847717; NMedGen:CN169374|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|M132390767723907677CT13:g.23907677C>TClinGen:CA155038CN517202 not provided;
NM_014363.6(SACS):c.10305T>C (p.Ser3435=)26278SACSConflicting interpretations of pathogenicityrs35670472RCV000633092|RCV001288369|RCV001109204|RCV001558026|RCV001849010; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MedGen:CN169374|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202|M132390771023907710AGNC_000013.10:g.23907710A>GClinGen:CA6910469C0037772 Spastic paraplegia;
NM_014363.6(SACS):c.10298C>G (p.Thr3433Arg)26278SACSUncertain significancers200991790RCV000460462|RCV001823002; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390771723907717GCNC_000013.10:g.23907717G>CClinGen:CA16613791C0037772 Spastic paraplegia;
NM_014363.6(SACS):c.10298C>T (p.Thr3433Ile)26278SACSConflicting interpretations of pathogenicityrs200991790RCV000862368|RCV001109205; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390771723907717GA13:g.23907717G>A-
NM_014363.6(SACS):c.10291G>C (p.Val3431Leu)26278SACSConflicting interpretations of pathogenicityrs144179865RCV000862183|RCV001109206|RCV001086035; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132390772423907724CG13:g.23907724C>G-
NM_014363.6(SACS):c.10274A>G (p.Lys3425Arg)26278SACSConflicting interpretations of pathogenicityrs147317123RCV000327882|RCV000329092|RCV001082514; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN169374|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132390774123907741TC13:g.23907741T>CClinGen:CA6910476CN169374 not specified;
NM_014363.6(SACS):c.10268T>C (p.Ile3423Thr)26278SACSUncertain significance-1RCV001578934; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390774723907747AG23907747-
NM_014363.6(SACS):c.10256G>A (p.Arg3419His)26278SACSUncertain significance-1RCV001663543|RCV001827567; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390775923907759CT23907759-
NM_014363.6(SACS):c.10255C>T (p.Arg3419Cys)26278SACSUncertain significance-1RCV001663542|RCV001832843; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390776023907760GA23907760-
NM_014363.6(SACS):c.10227A>G (p.Ser3409=)26278SACSLikely benignrs1593123878RCV000902674|RCV001825815; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390778823907788TC13:g.23907788T>C-
NM_014363.6(SACS):c.10221A>G (p.Leu3407=)26278SACSBenignrs143243372RCV000867076|RCV001288368|RCV001830893; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MedGen:CN169374|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390779423907794TC13:g.23907794T>C-
NM_014363.6(SACS):c.10205A>G (p.Asp3402Gly)26278SACSUncertain significancers543563990RCV000802657|RCV001274921|RCV001662833; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202132390781023907810TC13:g.23907810T>C-
NM_014363.6(SACS):c.10181A>G (p.Asn3394Ser)26278SACSConflicting interpretations of pathogenicityrs375898103RCV000712954|RCV001491310|RCV001273195; NMedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390783423907834TCNC_000013.10:g.23907834T>C-
NM_014363.6(SACS):c.10158A>G (p.Ala3386=)26278SACSConflicting interpretations of pathogenicityrs775633710RCV001288367|RCV001398932|RCV001780234; NMedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390785723907857TC23907857-
NM_014363.6(SACS):c.10136T>G (p.Leu3379Ter)26278SACSPathogenic/Likely pathogenicrs1057517250RCV000412241|RCV000992769|RCV001861393; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132390787923907879AC13:g.23907879A>CClinGen:CA16041608C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.10118C>T (p.Thr3373Ile)26278SACSUncertain significancers200591364RCV000517432|RCV000676353|RCV001834668; NMedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390789723907897GANC_000013.10:g.23907897G>AClinGen:CA6910502CN517202 not provided;
NM_014363.6(SACS):c.10106T>C (p.Val3369Ala)26278SACSBenign/Likely benignrs17078605RCV000118228|RCV000366246|RCV000676354|RCV001517094|RCV001847716; NMedGen:CN169374|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|M132390790923907909AG13:g.23907909A>GClinGen:CA155036,UniProtKB:Q9NZJ4#VAR_010296CN517202 not provided;
NM_014363.6(SACS):c.10096C>T (p.His3366Tyr)26278SACSUncertain significancers1388546547RCV001111537; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390791923907919GA13:g.23907919G>A-
NM_014363.6(SACS):c.10090del (p.Ala3364fs)26278SACSLikely pathogenicrs1057517383RCV000410438; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390792523907925GCG13:g.23907925_23907925delClinGen:CA16041609C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.10087A>T (p.Lys3363Ter)26278SACSLikely pathogenicrs1555250359RCV000673894; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390792823907928TA13:g.23907928T>A-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.10076C>T (p.Thr3359Ile)26278SACSUncertain significancers368089670RCV001246542|RCV001328751; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390793923907939GA13:g.23907939G>A-
NM_014363.6(SACS):c.10064T>G (p.Ile3355Arg)26278SACSUncertain significancers372488932RCV000273799; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390795123907951ACNC_000013.10:g.23907951A>CClinGen:CA6910515C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.10050del (p.His3351fs)26278SACSLikely pathogenicrs1555250383RCV000665203; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390796523907965GAG13:g.23907965_23907965del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.10047A>G (p.Ser3349=)26278SACSLikely benignrs138909482RCV000876569|RCV001273196|RCV001805926; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202132390796823907968TC13:g.23907968T>C-
NM_014363.6(SACS):c.10034T>C (p.Val3345Ala)26278SACSUncertain significancers767926148RCV000672333; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390798123907981AG13:g.23907981A>G-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.10024_10025del (p.Ser3342fs)26278SACSLikely pathogenicrs1555250395RCV000672515; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390799023907991ACTA13:g.23907990_23907991del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.10011C>G (p.Ile3337Met)26278SACSUncertain significance-1RCV001578945; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390800423908004GC23908004-
NM_014363.6(SACS):c.10008A>G (p.Lys3336=)26278SACSConflicting interpretations of pathogenicityrs148971954RCV000862514|RCV001111538|RCV001664493|RCV001593072; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN169374|MedGen:CN517202132390800723908007TC13:g.23908007T>C-
NM_014363.6(SACS):c.9981T>C (p.Ala3327=)26278SACSBenign/Likely benignrs2737700RCV000118235|RCV000331174|RCV000676355|RCV001509974|RCV001847723; NMedGen:CN169374|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|M132390803423908034AG13:g.23908034A>GClinGen:CA155050CN517202 not provided;
NM_014363.6(SACS):c.9912C>T (p.Leu3304=)26278SACSConflicting interpretations of pathogenicityrs1593124372RCV000979103|RCV001410507|RCV001578937; NMedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390810323908103GA13:g.23908103G>A-
NM_014363.6(SACS):c.9903G>T (p.Leu3301=)26278SACSConflicting interpretations of pathogenicityrs563145604RCV001111539|RCV001477623|RCV001664692; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MedGen:CN169374132390811223908112CA13:g.23908112C>A-
NM_014363.6(SACS):c.9898_9900del (p.Val3300del)26278SACSUncertain significancers762506287RCV000665073; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390811523908117GAACG13:g.23908115_23908117del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.9893_9895del (p.Gly3298del)26278SACSUncertain significancers1293576848RCV000672020; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390812023908122TCTCT13:g.23908120_23908122del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.9887C>T (p.Pro3296Leu)26278SACSUncertain significancers779195622RCV000388007; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390812823908128GANC_000013.10:g.23908128G>AClinGen:CA6910546C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.9879del (p.Val3294fs)26278SACSLikely pathogenic-1RCV001808018; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390813623908136CAC23908135-
NM_014363.6(SACS):c.9866C>G (p.Ser3289Ter)26278SACSPathogenic-1RCV001421040; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390814923908149GC23908149-
NM_014363.6(SACS):c.9852A>G (p.Thr3284=)26278SACSConflicting interpretations of pathogenicityrs147506904RCV000281392|RCV001113530|RCV001089187|RCV001288380; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MedGen:CN169374132390816323908163TC13:g.23908163T>CClinGen:CA6910551CN169374 not specified;
NM_014363.6(SACS):c.9846A>G (p.Pro3282=)26278SACSBenign/Likely benignrs61753111RCV000516893|RCV001083576|RCV001274922|RCV001848839; NMedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MONDO:MONDO:00190132390816923908169TCNC_000013.10:g.23908169T>CClinGen:CA6910554CN169374 not specified;
NM_014363.6(SACS):c.9818_9831del (p.Asp3273fs)26278SACSLikely pathogenicrs1057516464RCV000410298; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390818423908197AGTCTTTTAGAGTATA13:g.23908184_23908197delClinGen:CA16041610C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.9788A>G (p.Glu3263Gly)26278SACSLikely benign-1RCV001450119|RCV001826273; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390822723908227TC23908227-
NM_014363.6(SACS):c.9774AGA[1] (p.Glu3259del)26278SACSUncertain significancers768958169RCV000665334; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390823623908238ATCTA13:g.23908236_23908238del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.9779A>G (p.Asp3260Gly)26278SACSUncertain significancers1883670937RCV001113531; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390823623908236TC13:g.23908236T>C-
NM_014363.6(SACS):c.9763_9764del (p.Val3255fs)26278SACSLikely pathogenicrs1555250508RCV000673219; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390825123908252TACT13:g.23908251_23908252del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.9742T>C (p.Trp3248Arg)26278SACSPathogenicrs137853018RCV000005854; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390827323908273AG13:g.23908273A>GClinGen:CA253516,UniProtKB:Q9NZJ4#VAR_064816,OMIM:604490.0008C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.9723G>C (p.Glu3241Asp)26278SACSUncertain significancers772595501RCV000625697; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390829223908292CGNC_000013.10:g.23908292C>GClinGen:CA6910575C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.9680A>C (p.Lys3227Thr)26278SACSUncertain significancers765635417RCV000712995|RCV001825427; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390833523908335TGNC_000013.10:g.23908335T>G-
NM_014363.6(SACS):c.9677A>G (p.Tyr3226Cys)26278SACSUncertain significancers776143384RCV000992802|RCV001273197; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390833823908338TC13:g.23908338T>C-
NM_014363.6(SACS):c.9670C>T (p.Arg3224Ter)26278SACSLikely pathogenicrs751568153RCV000781830; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390834523908345GANC_000013.10:g.23908345G>A-
NM_014363.6(SACS):c.9661G>A (p.Val3221Met)26278SACSConflicting interpretations of pathogenicity-1RCV001458158|RCV001579252; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390835423908354CT23908354-
NM_014363.6(SACS):c.9653T>G (p.Leu3218Ter)26278SACSLikely pathogenic-1RCV001779520; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390836223908362AC23908362-
NM_014363.6(SACS):c.9625_9628del (p.Phe3209fs)26278SACSLikely pathogenicrs1555250557RCV000670846; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390838723908390TCAAAT13:g.23908387_23908390del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.9572C>T (p.Thr3191Ile)26278SACSUncertain significancers1883687760RCV001113532; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390844323908443GA13:g.23908443G>A-
NM_014363.6(SACS):c.9561_9564del (p.Leu3187_Phe3188insTer)26278SACSPathogenicrs1060503431RCV000470443|RCV001283763; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390845123908454TAAACTNC_000013.10:g.23908453_23908456delClinGen:CA16613883C0037772 Spastic paraplegia;
NM_014363.6(SACS):c.9562T>C (p.Phe3188Leu)26278SACSConflicting interpretations of pathogenicityrs137905181RCV000712994|RCV000765118|RCV001034278; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132390845323908453AGNC_000013.10:g.23908453A>G-
NM_014363.6(SACS):c.9551G>A (p.Arg3184His)26278SACSUncertain significancers200453385RCV000689777|RCV001829908|RCV001849054; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MONDO:MONDO:0019064,MedGen:C00377132390846423908464CTNC_000013.10:g.23908464C>T-C0037772 Spastic paraplegia;
NM_014363.6(SACS):c.9550C>T (p.Arg3184Cys)26278SACSUncertain significancers143557803RCV000518073|RCV000560872|RCV001113533; NMedGen:CN169374|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390846523908465GANC_000013.10:g.23908465G>AClinGen:CA6910606CN169374 not specified;
NM_014363.6(SACS):c.9523ACA[1] (p.Thr3176del)26278SACSUncertain significancers1161557781RCV000667115; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390848723908489ATGTA13:g.23908487_23908489del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.9508C>T (p.Arg3170Ter)26278SACSPathogenic/Likely pathogenicrs202199411RCV000297710|RCV000411666|RCV001223182; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132390850723908507GANC_000013.10:g.23908507G>AClinGen:CA6910613
NM_014363.6(SACS):c.9498del (p.Phe3166fs)26278SACSLikely pathogenicrs1555250642RCV000673287; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390851723908517CAC13:g.23908517_23908517del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.9492A>C (p.Gln3164His)26278SACSUncertain significancers1025915131RCV001346818|RCV001825934; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390852323908523TG23908523-
NM_014363.6(SACS):c.9447del (p.Val3150fs)26278SACSLikely pathogenicrs1555250653RCV000670775; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390856823908568CTC13:g.23908568_23908568del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.9404T>C (p.Leu3135Ser)26278SACSConflicting interpretations of pathogenicityrs371019314RCV000463355|RCV000712993|RCV001782958|RCV001848816; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MONDO:MONDO:00190132390861123908611AGNC_000013.10:g.23908611A>GClinGen:CA6910624C0037772 Spastic paraplegia;
NM_014363.6(SACS):c.9399A>G (p.Lys3133=)26278SACSConflicting interpretations of pathogenicityrs762665640RCV000546063|RCV001274923|RCV001848925; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MONDO:MONDO:0019064,MedGen:C00377132390861623908616TC13:g.23908616T>CClinGen:CA6910625C0037772 Spastic paraplegia;
NM_014363.6(SACS):c.9390_9391del (p.His3130fs)26278SACSLikely pathogenicrs1057517349RCV000410981; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390862423908625CTAC13:g.23908624_23908625delClinGen:CA16041611C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.9375_9379del (p.Asn3125fs)26278SACSLikely pathogenicrs1555250684RCV000667429; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390863623908640TTTAGAT13:g.23908636_23908640del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.9377dup (p.Leu3128fs)26278SACSLikely pathogenicrs1057516875RCV000410587; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390863723908638TTA13:g.23908637_23908638insAClinGen:CA16041612C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.9356GTC[1] (p.Arg3120del)26278SACSUncertain significancers1388341388RCV000665003; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390865423908656AGACA13:g.23908654_23908656del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.9359G>T (p.Arg3120Leu)26278SACSUncertain significancers569955570RCV000992801|RCV001274924; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390865623908656CA13:g.23908656C>A-
NM_014363.6(SACS):c.9346_9354dup (p.Lys3116_Pro3118dup)26278SACSLikely pathogenic-1RCV002052090; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390866023908661AAAGGCAGCTT23908660-
NM_014363.6(SACS):c.9333T>C (p.Asn3111=)26278SACSBenign/Likely benignrs150532740RCV000865279|RCV001087562|RCV001825723; NMedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390868223908682AG13:g.23908682A>G-
NM_014363.6(SACS):c.9305T>A (p.Leu3102Ter)26278SACSPathogenic/Likely pathogenicrs886041949RCV000377502|RCV000762910|RCV001544509|RCV001379554; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MONDO:MONDO:0010040,MedGen:C3151619,OMIM:270500|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontol132390871023908710ATNC_000013.10:g.23908710A>TClinGen:CA10603290
NM_014363.6(SACS):c.9299C>A (p.Ser3100Tyr)26278SACSBenign/Likely benignrs150615169RCV000863931|RCV001830871|RCV001847046; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MONDO:MONDO:0019064,MedGen:C00377132390871623908716GT13:g.23908716G>T-
NM_014363.6(SACS):c.9286G>A (p.Ala3096Thr)26278SACSUncertain significancers1085307569RCV000489327|RCV001829396; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390872923908729CTNC_000013.10:g.23908729C>TClinGen:CA387514775
NM_014363.6(SACS):c.9283C>G (p.Pro3095Ala)26278SACSUncertain significancers201899988RCV001113534; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390873223908732GC13:g.23908732G>C-
NM_014363.6(SACS):c.9275A>T (p.Tyr3092Phe)26278SACSUncertain significancers139579036RCV001212079|RCV001780126|RCV001507816; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202132390874023908740TA13:g.23908740T>A-
NM_014363.6(SACS):c.9251T>C (p.Ile3084Thr)26278SACSUncertain significancers149290718RCV001240147|RCV001507817|RCV001780177; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390876423908764AG13:g.23908764A>G-
NM_014363.6(SACS):c.9232A>G (p.Asn3078Asp)26278SACSUncertain significancers755698899RCV001039809|RCV001274925; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390878323908783TC13:g.23908783T>C-
NM_014363.6(SACS):c.9173T>G (p.Leu3058Arg)26278SACSUncertain significancers758654165RCV000516989|RCV001829476; NMedGen:CN169374|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390884223908842ACNC_000013.10:g.23908842A>CClinGen:CA6910654CN169374 not specified;
NM_014363.6(SACS):c.9128A>G (p.Tyr3043Cys)26278SACSUncertain significancers761690372RCV001071021|RCV001833671; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390888723908887TC13:g.23908887T>C-
NM_014363.6(SACS):c.9088_9089dup (p.Leu3030fs)26278SACSLikely pathogenicrs1057517060RCV000410750; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390892523908926TTAA13:g.23908925_23908926insAAClinGen:CA16041613C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.9090A>G (p.Leu3030=)26278SACSLikely benign-1RCV001411635|RCV001578943; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390892523908925TC23908925-
NM_014363.6(SACS):c.9055A>G (p.Thr3019Ala)26278SACSUncertain significance-1RCV001579253; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390896023908960TC23908960-
NM_014363.6(SACS):c.9031A>G (p.Ile3011Val)26278SACSUncertain significancers377657177RCV000232996|RCV000295984; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390898423908984TC13:g.23908984T>CClinGen:CA6910674C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.8990G>A (p.Arg2997Gln)26278SACSConflicting interpretations of pathogenicityrs139670073RCV000315960|RCV001411302; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132390902523909025CTNC_000013.10:g.23909025C>TClinGen:CA6910682C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.8972G>A (p.Arg2991His)26278SACSConflicting interpretations of pathogenicityrs192610957RCV000518535|RCV000765119|RCV001085517|RCV001644612|RCV001848898; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MedGen:CN169374|M132390904323909043CT13:g.23909043C>TClinGen:CA6910684CN169374 not specified;
NM_014363.6(SACS):c.8971C>T (p.Arg2991Cys)26278SACSUncertain significancers759112797RCV000517800|RCV001834673; NMedGen:CN169374|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390904423909044GA13:g.23909044G>AClinGen:CA6910685CN169374 not specified;
NM_014363.6(SACS):c.8958C>T (p.His2986=)26278SACSConflicting interpretations of pathogenicityrs758029668RCV000973863|RCV001114945; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390905723909057GA13:g.23909057G>A-
NM_014363.6(SACS):c.8956C>G (p.His2986Asp)26278SACSUncertain significancers751888795RCV000674258; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390905923909059GC13:g.23909059G>C-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.8948A>G (p.Asn2983Ser)26278SACSUncertain significancers200106708RCV000795635|RCV001274926; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390906723909067TC13:g.23909067T>C-
NM_014363.6(SACS):c.8931A>G (p.Leu2977=)26278SACSLikely benignrs376228714RCV000871159|RCV001278820; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390908423909084TC13:g.23909084T>C-
NM_014363.6(SACS):c.8922A>G (p.Leu2974=)26278SACSBenignrs563864403RCV000867085|RCV001273198; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390909323909093TC13:g.23909093T>C-
NM_014363.6(SACS):c.8900G>A (p.Arg2967His)26278SACSUncertain significancers777753707RCV001244187|RCV001835199; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390911523909115CT13:g.23909115C>T-
NM_014363.6(SACS):c.8889C>A (p.Phe2963Leu)26278SACSUncertain significancers776647599RCV000992800|RCV001784524; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390912623909126GT13:g.23909126G>T-
NM_014363.6(SACS):c.8888del (p.Phe2963fs)26278SACSLikely pathogenicrs1555250872RCV000669495; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390912723909127GAG13:g.23909127_23909127del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.8873A>G (p.Lys2958Arg)26278SACSBenignrs11839380RCV000173862|RCV000224353|RCV001084232|RCV001274927|RCV001847804; NMedGen:CN169374|MedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|M132390914223909142TC13:g.23909142T>CClinGen:CA200741,UniProtKB:Q9NZJ4#VAR_059719CN517202 not provided;
NM_014363.6(SACS):c.8873del (p.Lys2958fs)26278SACSLikely pathogenicrs765992922RCV000409008; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390914223909142CTCNC_000013.10:g.23909143delClinGen:CA6910702C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.8867T>A (p.Leu2956Ter)26278SACSLikely pathogenicrs1057516853RCV000411855; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390914823909148AT13:g.23909148A>TClinGen:CA16041614C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.8858A>C (p.Lys2953Thr)26278SACSUncertain significancers1868444121RCV001114946; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390915723909157TG13:g.23909157T>G-
NM_014363.6(SACS):c.8853T>C (p.Val2951=)26278SACSBenign/Likely benignrs9552929RCV000118234|RCV000372801|RCV000676356|RCV001517095|RCV001847722; NMedGen:CN169374|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|M132390916223909162AG13:g.23909162A>GClinGen:CA155048CN517202 not provided;
NM_014363.6(SACS):c.8853T>G (p.Val2951=)26278SACSConflicting interpretations of pathogenicityrs9552929RCV001114947|RCV001489757; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132390916223909162AC13:g.23909162A>C-
NM_014363.6(SACS):c.8848_8849dup (p.Val2951fs)26278SACSLikely pathogenicrs797044608RCV000194102; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390916523909166AATG13:g.23909165_23909166insTGClinGen:CA277260C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.8844del (p.Ile2949fs)26278SACSPathogenicrs281865117RCV000005847|RCV000338359|RCV000460039|RCV001847583; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:00190132390917123909171TAT13:g.23909171_23909171delClinGen:CA340432,OMIM:604490.0001CN517202 not provided;
NM_014363.6(SACS):c.8836A>G (p.Asn2946Asp)26278SACSUncertain significancers184407783RCV000516711|RCV001834672; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390917923909179TCNC_000013.10:g.23909179T>CClinGen:CA246653925CN169374 not specified;
NM_014363.6(SACS):c.8802C>T (p.Phe2934=)26278SACSUncertain significancers1868452276RCV001278821; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390921323909213GA13:g.23909213G>A-
NM_014363.6(SACS):c.8799T>C (p.Tyr2933=)26278SACSLikely benignrs779302353RCV000866861|RCV001273199|RCV001474532; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132390921623909216AG13:g.23909216A>G-
NM_014363.6(SACS):c.8793dup (p.Arg2932fs)26278SACSPathogenic/Likely pathogenicrs767871841RCV001233437|RCV001785796|RCV001288377|RCV001847200; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202|MONDO:MONDO:00190132390922123909222GGT13:g.23909221_23909222insT-
NM_014363.6(SACS):c.8793del (p.Lys2931fs)26278SACSPathogenic/Likely pathogenicrs767871841RCV000519077|RCV000674417|RCV000706287; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132390922223909222GTG13:g.23909222_23909222delClinGen:CA483160036CN517202 not provided;
NM_014363.6(SACS):c.8768T>C (p.Val2923Ala)26278SACSUncertain significancers1566062448RCV001278822; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390924723909247AG13:g.23909247A>G-
NM_014363.6(SACS):c.8755G>T (p.Ala2919Ser)26278SACSUncertain significancers886050079RCV000280553; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390926023909260CANC_000013.10:g.23909260C>AClinGen:CA10644032C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.8733_8734del (p.Asn2911fs)26278SACSLikely pathogenicrs1057517020RCV000409838; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390928123909282CTGC13:g.23909281_23909282delClinGen:CA16041615C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.8727G>A (p.Trp2909Ter)26278SACSPathogenic/Likely pathogenicrs1555250949RCV000667371|RCV001855479; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132390928823909288CT13:g.23909288C>T-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.8716C>T (p.Arg2906Ter)26278SACSPathogenicrs750732115RCV001328754|RCV001820019|RCV001386448; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132390929923909299GA23909299-
NM_014363.6(SACS):c.8693G>A (p.Arg2898His)26278SACSUncertain significancers201977288RCV000530318|RCV001274928; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390932223909322CT13:g.23909322C>TClinGen:CA6910731C0037772 Spastic paraplegia;
NM_014363.6(SACS):c.8621_8624del (p.Ser2874fs)26278SACSPathogenic/Likely pathogenicrs753012964RCV000409386|RCV001861390; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132390939123909394CAAAGCNC_000013.10:g.23909392AAGA[1]ClinGen:CA6910739C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.8612dup (p.Leu2871fs)26278SACSLikely pathogenicrs1057517212RCV000411570; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390940223909403CCA13:g.23909402_23909403insAClinGen:CA16041616C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.8596A>G (p.Arg2866Gly)26278SACSUncertain significancers1868466055RCV001198520; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390941923909419TC13:g.23909419T>C-
NM_014363.6(SACS):c.8589dup (p.Pro2864fs)26278SACSLikely pathogenicrs1555250987RCV000669195; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390942523909426GGT13:g.23909425_23909426insT-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.8579A>G (p.Asn2860Ser)26278SACSConflicting interpretations of pathogenicityrs201294520RCV000625698|RCV001848999|RCV001439415; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MONDO:MONDO:0019064,MedGen:C0037773,OMIM:PS303350, Orphanet:685|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontolo132390943623909436TC13:g.23909436T>CClinGen:CA6910745C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.8577C>T (p.His2859=)26278SACSConflicting interpretations of pathogenicityrs140016265RCV000338040|RCV000676357|RCV001088324; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132390943823909438GANC_000013.10:g.23909438G>AClinGen:CA6910746CN517202 not provided;
NM_014363.6(SACS):c.8574_8577del (p.His2859fs)26278SACSLikely pathogenicrs1555250991RCV000667339; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390943823909441TGTGAT13:g.23909438_23909441del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.8542_8543del (p.Phe2848fs)26278SACSPathogenic/Likely pathogenicrs876657721RCV000218042|RCV000824756; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MONDO:MONDO:0017847,MedGen:CN279276, Orphanet:316240132390947223909473GAAGNC_000013.10:g.23909474_23909475delClinGen:CA10576938C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.8539C>G (p.Leu2847Val)26278SACSUncertain significancers760976439RCV000712992|RCV000800081|RCV001276935; NMedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390947623909476GCNC_000013.10:g.23909476G>C-
NM_014363.6(SACS):c.8512_8514del (p.Ser2838del)26278SACSUncertain significancers1555251001RCV000669788; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390950123909503CTGAC13:g.23909501_23909503del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.8504G>A (p.Ser2835Asn)26278SACSUncertain significancers1382975968RCV000803737|RCV001830738; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390951123909511CT13:g.23909511C>T-
NM_014363.6(SACS):c.8497_8500del (p.Ser2833fs)26278SACSLikely pathogenicrs1555251007RCV000673644; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390951523909518TTAGAT13:g.23909515_23909518del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.8487G>A (p.Met2829Ile)26278SACSnot providedrs1566062847RCV000709971; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390952823909528CTNC_000013.10:g.23909528C>T-
NM_014363.6(SACS):c.8482A>G (p.Ser2828Gly)26278SACSLikely benignrs9552930RCV000865117|RCV001273200; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390953323909533TC13:g.23909533T>C-
NM_014363.6(SACS):c.8480C>A (p.Ser2827Ter)26278SACSLikely pathogenicrs1555251015RCV000667851; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390953523909535GT13:g.23909535G>T-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.8414C>T (p.Thr2805Ile)26278SACSUncertain significancers772742353RCV000173861|RCV000658671|RCV001276936|RCV001852116; NMedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132390960123909601GA13:g.23909601G>AClinGen:CA239316CN517202 not provided;
NM_014363.6(SACS):c.8393C>A (p.Pro2798Gln)26278SACSConflicting interpretations of pathogenicityrs140551762RCV000194652|RCV000230214|RCV000513770|RCV001815246|RCV001847873; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MedGen:CN517202|MedGen:CN169374|M132390962223909622GT13:g.23909622G>TClinGen:CA277355,UniProtKB:Q9NZJ4#VAR_064814CN517202 not provided;
NM_014363.6(SACS):c.8379G>A (p.Gln2793=)26278SACSConflicting interpretations of pathogenicityrs776028181RCV000390354|RCV002056364; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132390963623909636CTNC_000013.10:g.23909636C>TClinGen:CA6910769C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.8377C>T (p.Gln2793Ter)26278SACSLikely pathogenicrs1240368715RCV000674504; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390963823909638GA13:g.23909638G>A-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.8356G>C (p.Asp2786His)26278SACSUncertain significancers753607639RCV000516762|RCV001834671; NMedGen:CN169374|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390965923909659CGNC_000013.10:g.23909659C>GClinGen:CA6910775CN169374 not specified;
NM_014363.6(SACS):c.8345C>T (p.Ala2782Val)26278SACSBenign/Likely benignrs61742500RCV000249301|RCV000957157|RCV001109309|RCV001547216|RCV001848030; NMedGen:CN169374|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202|M132390967023909670GANC_000013.10:g.23909670G>AClinGen:CA6910777CN169374 not specified;
NM_014363.6(SACS):c.8344G>A (p.Ala2782Thr)26278SACSBenign/Likely benignrs61742502RCV000224587|RCV001082218|RCV001109310|RCV001847947; NMedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MONDO:MONDO:00190132390967123909671CT13:g.23909671C>TClinGen:CA6910778CN517202 not provided;
NM_014363.6(SACS):c.8341C>G (p.His2781Asp)26278SACSUncertain significancers886050080RCV000283923; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390967423909674GCNC_000013.10:g.23909674G>CClinGen:CA10643112C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.8339T>G (p.Phe2780Cys)26278SACSConflicting interpretations of pathogenicityrs111540787RCV000341299|RCV001083821|RCV000676358|RCV001847977; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MedGen:CN517202|MONDO:MONDO:00190132390967623909676AC13:g.23909676A>CClinGen:CA6910780CN517202 not provided;
NM_014363.6(SACS):c.8336A>T (p.Gln2779Leu)26278SACSConflicting interpretations of pathogenicity-1RCV001448702|RCV001507818|RCV001780384; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390967923909679TA23909679-
NM_014363.6(SACS):c.8315G>C (p.Gly2772Ala)26278SACSUncertain significancers763504656RCV000516833|RCV000765120; NMedGen:CN169374|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390970023909700CGNC_000013.10:g.23909700C>GClinGen:CA6910788CN169374 not specified;
NM_014363.6(SACS):c.8305dup (p.Ile2769fs)26278SACSLikely pathogenicrs1279988199RCV000665991; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390970923909710AAT13:g.23909709_23909710insT-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.8281G>A (p.Val2761Met)26278SACSUncertain significancers372119773RCV001244439|RCV001829930; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390973423909734CT13:g.23909734C>T-
NM_014363.6(SACS):c.8245A>G (p.Ile2749Val)26278SACSConflicting interpretations of pathogenicityrs186436335RCV000473308|RCV000594324|RCV000765121|RCV001848817; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MONDO:MONDO:00190132390977023909770TCNC_000013.10:g.23909770T>CClinGen:CA6910801CN169374 not specified;
NM_014363.6(SACS):c.8233G>A (p.Glu2745Lys)26278SACSUncertain significancers745462710RCV001287919|RCV001830094; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390978223909782CT23909782-
NM_014363.6(SACS):c.8227del (p.His2743fs)26278SACSPathogenic-1RCV001391625; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390978823909788TGT23909787-
NM_014363.6(SACS):c.8221del (p.Asn2742fs)26278SACSLikely pathogenicrs1555251151RCV000666128; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390979423909794AGA13:g.23909794_23909794del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.8192G>A (p.Arg2731His)26278SACSUncertain significancers201127191RCV001287918|RCV001328753; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390982323909823CT23909823-
NM_014363.6(SACS):c.8191C>T (p.Arg2731Cys)26278SACSUncertain significancers772072343RCV001111635; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390982423909824GA13:g.23909824G>A-
NM_014363.6(SACS):c.8142G>A (p.Ser2714=)26278SACSConflicting interpretations of pathogenicityrs530250252RCV000598079|RCV001468357|RCV001783101; NMedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390987323909873CT13:g.23909873C>TClinGen:CA6910815CN169374 not specified;
NM_014363.6(SACS):c.8141C>T (p.Ser2714Leu)26278SACSUncertain significancers762610527RCV000633037|RCV001835887|RCV001849004; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MONDO:MONDO:0019064,MedGen:C00377132390987423909874GA13:g.23909874G>AClinGen:CA6910816C0037772 Spastic paraplegia;
NM_014363.6(SACS):c.8133G>A (p.Ser2711=)26278SACSConflicting interpretations of pathogenicityrs143386746RCV000173859|RCV001087614|RCV001273201; NMedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390988223909882CT13:g.23909882C>TClinGen:CA239312CN169374 not specified;
NM_014363.6(SACS):c.8132C>A (p.Ser2711Ter)26278SACSPathogenic-1RCV001421041; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390988323909883GT23909883-
NM_014363.6(SACS):c.8108G>A (p.Arg2703His)26278SACSConflicting interpretations of pathogenicityrs750181262RCV000668456|RCV001576889|RCV001868222; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132390990723909907CT13:g.23909907C>T-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.8056C>T (p.Leu2686=)26278SACSUncertain significancers748595405RCV000401979; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390995923909959GANC_000013.10:g.23909959G>AClinGen:CA10643113C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.8029C>T (p.Gln2677Ter)26278SACSLikely pathogenicrs1555251241RCV000667379; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390998623909986GA13:g.23909986G>A-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.8022T>C (p.Phe2674=)26278SACSConflicting interpretations of pathogenicityrs34928783RCV000512830|RCV001085541|RCV001111636|RCV001848058; NMedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MONDO:MONDO:00190132390999323909993AG13:g.23909993A>GClinGen:CA6910829CN517202 not provided;
NM_014363.6(SACS):c.8022T>G (p.Phe2674Leu)26278SACSConflicting interpretations of pathogenicityrs34928783RCV000306392|RCV000516257|RCV001477679; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN169374|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132390999323909993ACNC_000013.10:g.23909993A>CClinGen:CA6910830CN169374 not specified;
NM_014363.6(SACS):c.8009del (p.Leu2670fs)26278SACSLikely pathogenicrs1555251254RCV000669250; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391000623910006CAC13:g.23910006_23910006del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.7991G>T (p.Gly2664Val)26278SACSLikely pathogenicrs1060499656RCV000449537; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391002423910024CANC_000013.10:g.23910024C>AClinGen:CA16609396C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.7988C>T (p.Pro2663Leu)26278SACSUncertain significancers377626385RCV001111637|RCV001847158; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MONDO:MONDO:0019064,MedGen:C0037773,OMIM:PS303350, Orphanet:685132391002723910027GA13:g.23910027G>A-
NM_014363.6(SACS):c.7981A>G (p.Ile2661Val)26278SACSUncertain significancers1269342975RCV000556409|RCV001829568; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391003423910034TC13:g.23910034T>CClinGen:CA387517648C0037772 Spastic paraplegia;
NM_014363.6(SACS):c.7915_7920del (p.Ile2639_Ser2640del)26278SACSUncertain significancers1555251289RCV000668818; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391009523910100CAGAAATC13:g.23910095_23910100del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.7916T>C (p.Ile2639Thr)26278SACSUncertain significance-1RCV001663562|RCV001832846; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391009923910099AG23910099-
NM_014363.6(SACS):c.7903del (p.Cys2635fs)26278SACSLikely pathogenicrs1028098148RCV000668512; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391011223910112CAC13:g.23910112_23910112del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.7868del (p.Gly2623fs)26278SACSLikely pathogenicrs1555251301RCV000671528; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391014723910147TCT13:g.23910147_23910147del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.7861C>T (p.Gln2621Ter)26278SACSLikely pathogenicrs1057517014RCV000408978; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391015423910154GA13:g.23910154G>AClinGen:CA16041617C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.7857T>C (p.Thr2619=)26278SACSUncertain significancers886050081RCV000364237; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391015823910158AGNC_000013.10:g.23910158A>GClinGen:CA10644034C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.7844del (p.Asn2615fs)26278SACSPathogenic/Likely pathogenicrs758572409RCV000409571|RCV001218622; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391017123910171ATA13:g.23910171_23910171delClinGen:CA6910857C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.7833G>A (p.Thr2611=)26278SACSLikely benignrs1237743096RCV000873051|RCV001273202|RCV001664513; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN169374132391018223910182CT13:g.23910182C>T-
NM_014363.6(SACS):c.7817A>G (p.Asn2606Ser)26278SACSUncertain significancers1191066514RCV001111638; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391019823910198TC13:g.23910198T>C-
NM_014363.6(SACS):c.7812T>C (p.Ile2604=)26278SACSLikely benignrs1593127031RCV000867494|RCV001273203; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391020323910203AG13:g.23910203A>G-
NM_014363.6(SACS):c.7796ATG[1] (p.Asp2600del)26278SACSUncertain significancers1555251315RCV000671465; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391021423910216ACATA13:g.23910214_23910216del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.7795G>C (p.Asp2599His)26278SACSUncertain significance-1RCV001578941; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391022023910220CG23910220-
NM_014363.6(SACS):c.7788del (p.Phe2596fs)26278SACSPathogenic/Likely pathogenicrs1057516959RCV000409944|RCV001388052; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391022723910227TAT13:g.23910227_23910227delClinGen:CA16041618C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.7742C>T (p.Ala2581Val)26278SACSUncertain significancers866333277RCV000995034|RCV001111639; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391027323910273GA13:g.23910273G>A-
NM_014363.6(SACS):c.7725A>T (p.Ile2575=)26278SACSConflicting interpretations of pathogenicityrs200735789RCV000862794|RCV001080113|RCV001112099; NMedGen:CN169374|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391029023910290TA13:g.23910290T>A-
NM_014363.6(SACS):c.7713A>T (p.Pro2571=)26278SACSConflicting interpretations of pathogenicityrs557113294RCV000406766|RCV002056365; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391030223910302TANC_000013.10:g.23910302T>AClinGen:CA6910868C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.7697A>G (p.Asp2566Gly)26278SACSUncertain significancers1868573738RCV001262393; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391031823910318TC13:g.23910318T>C-
NM_014363.6(SACS):c.7647T>G (p.Leu2549=)26278SACSConflicting interpretations of pathogenicityrs186301471RCV000310623|RCV000865836|RCV001848098; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0019064,MedGen:C00377132391036823910368ACNC_000013.10:g.23910368A>CClinGen:CA6910879C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.7614A>C (p.Ala2538=)26278SACSConflicting interpretations of pathogenicityrs142697365RCV001112100|RCV001454999; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391040123910401TG13:g.23910401T>G-
NM_014363.6(SACS):c.7601G>A (p.Ser2534Asn)26278SACSUncertain significancers750491874RCV001112101; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391041423910414CT13:g.23910414C>T-
NM_014363.6(SACS):c.7583T>G (p.Leu2528Trp)26278SACSUncertain significance-1RCV001823469; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391043223910432AC23910432-
NM_014363.6(SACS):c.7535A>G (p.Asn2512Ser)26278SACSUncertain significancers777424692RCV000367674; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391048023910480TCNC_000013.10:g.23910480T>CClinGen:CA6910890C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.7528G>A (p.Ala2510Thr)26278SACSConflicting interpretations of pathogenicityrs111920492RCV000243536|RCV000710207|RCV001082626|RCV001112102|RCV001848029; NMedGen:CN169374|MedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|M132391048723910487CT13:g.23910487C>TClinGen:CA6910891CN169374 not specified;
NM_014363.6(SACS):c.7527T>C (p.Tyr2509=)26278SACSConflicting interpretations of pathogenicityrs140034972RCV000275588|RCV000712990|RCV001083438|RCV001725163; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN169374|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MedGen:CN517202132391048823910488AGNC_000013.10:g.23910488A>GClinGen:CA6910892C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.7527T>G (p.Tyr2509Ter)26278SACSLikely pathogenicrs140034972RCV000665439; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391048823910488AC13:g.23910488A>C-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.7521_7524del (p.Glu2507fs)26278SACSLikely pathogenicrs1057516438RCV000410665; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391049123910494ATCTTANC_000013.10:g.23910494_23910497delClinGen:CA16041619C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.7504C>T (p.Arg2502Ter)26278SACSPathogenicrs281865118RCV000005848|RCV001268308|RCV001851681|RCV001847584; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:00190132391051123910511GA13:g.23910511G>AClinGen:CA340433,OMIM:604490.0002,ClinVar:691950C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.7494_7504del (p.Val2499fs)26278SACSLikely pathogenicrs1057517451RCV000410317; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391051123910521CGCTTTGGGACTCNC_000013.10:g.23910514_23910524delClinGen:CA16041620C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.7497C>T (p.Val2499=)26278SACSConflicting interpretations of pathogenicityrs774558627RCV000873350|RCV001115052; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391051823910518GA13:g.23910518G>A-
NM_014363.6(SACS):c.7448_7456del (p.Tyr2483_Ala2486delinsSer)26278SACSUncertain significancers1555251416RCV000666850; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391055923910567GCATGACAATG13:g.23910559_23910567del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.7454A>T (p.His2485Leu)26278SACSUncertain significancers1420170258RCV001115053; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391056123910561TA13:g.23910561T>A-
NM_014363.6(SACS):c.7448A>G (p.Tyr2483Cys)26278SACSUncertain significance-1RCV001579249; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391056723910567TC23910567-
NM_014363.6(SACS):c.7436_7443dup (p.Lys2482delinsProLeuTer)26278SACSLikely pathogenicrs1555251421RCV000666291; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391057123910572TTTACAGTGG13:g.23910571_23910572insTACAGTGG-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.7418_7419delinsTTT (p.Trp2473fs)26278SACSLikely pathogenicrs1555251428RCV000668806; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391059623910597CCAAA13:g.23910596_23910597insAA-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.7406A>G (p.Asn2469Ser)26278SACSUncertain significancers1288769278RCV001287915|RCV001830093; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391060923910609TC23910609-
NM_014363.6(SACS):c.7394C>A (p.Ser2465Ter)26278SACSLikely pathogenicrs747676277RCV000411674; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391062123910621GT13:g.23910621G>TClinGen:CA16041621C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.7394C>T (p.Ser2465Leu)26278SACSConflicting interpretations of pathogenicityrs747676277RCV001115054|RCV001269831|RCV001247856|RCV001847161; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:00190132391062123910621GA13:g.23910621G>A-
NM_014363.6(SACS):c.7384C>T (p.Pro2462Ser)26278SACSBenign/Likely benignrs78239814RCV000676359|RCV001085314|RCV001275188; NMedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391063123910631GANC_000013.10:g.23910631G>AClinGen:CA6910916CN517202 not provided;
NM_014363.6(SACS):c.7376T>C (p.Met2459Thr)26278SACSUncertain significancers767864000RCV001115055; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391063923910639AG13:g.23910639A>G-
NM_014363.6(SACS):c.7354T>C (p.Leu2452=)26278SACSLikely benignrs761258047RCV000868843|RCV001278823; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391066123910661AG13:g.23910661A>G-
NM_014363.6(SACS):c.7282A>G (p.Ile2428Val)26278SACSUncertain significancers1007936574RCV000712989|RCV001784353; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391073323910733TCNC_000013.10:g.23910733T>C-
NM_014363.6(SACS):c.7276C>T (p.Arg2426Ter)26278SACSPathogenic/Likely pathogenicrs786204750RCV000169603|RCV000734960|RCV001850407; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391073923910739GANC_000013.10:g.23910739G>AClinGen:CA274458,ClinVar:424796C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.7274G>C (p.Arg2425Pro)26278SACSPathogenic-1RCV001391624; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391074123910741CG23910741-
NM_014363.6(SACS):c.7273C>T (p.Arg2425Ter)26278SACSPathogenicrs145766983RCV000412060|RCV000599123|RCV000704868; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391074223910742GA13:g.23910742G>AClinGen:CA6910940CN517202 not provided;
NM_014363.6(SACS):c.7262T>A (p.Phe2421Tyr)26278SACSUncertain significancers1213144547RCV000992798|RCV001276937; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391075323910753AT13:g.23910753A>T-
NM_014363.6(SACS):c.7221_7224dup (p.Gln2409Ter)26278SACSLikely pathogenicrs1555251514RCV000664967; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391079023910791GGATCA13:g.23910790_23910791insATCA-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.7207G>C (p.Val2403Leu)26278SACSUncertain significancers779973547RCV001341618|RCV001836330; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391080823910808CG23910808-
NM_014363.6(SACS):c.7205_7206del (p.Leu2402fs)26278SACSPathogenicrs773182375RCV000531534|RCV001835847; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391080923910810CAAC13:g.23910809_23910810delClinGen:CA6910949C0037772 Spastic paraplegia;
NM_014363.6(SACS):c.7200T>C (p.Phe2400=)26278SACSConflicting interpretations of pathogenicityrs148544893RCV000863351|RCV001115056|RCV001849169; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MONDO:MONDO:0019064,MedGen:C00377132391081523910815AG13:g.23910815A>G-
NM_014363.6(SACS):c.7171G>A (p.Val2391Met)26278SACSUncertain significancers760087813RCV000712988|RCV001825426; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391084423910844CTNC_000013.10:g.23910844C>T-
NM_014363.6(SACS):c.7169G>A (p.Gly2390Asp)26278SACSUncertain significance-1RCV001579251; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391084623910846CT23910846-
NM_014363.6(SACS):c.7165G>A (p.Val2389Met)26278SACSConflicting interpretations of pathogenicityrs142869943RCV000332938|RCV000863318|RCV001287913; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MedGen:CN169374132391085023910850CTNC_000013.10:g.23910850C>TClinGen:CA6910961C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.7162_7163del (p.Thr2388fs)26278SACSPathogenic/Likely pathogenicrs1555251539RCV000516377|RCV001785652|RCV001857925; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391085223910853GGTGNC_000013.10:g.23910852_23910853delClinGen:CA658658232CN517202 not provided;
NM_014363.6(SACS):c.7150G>A (p.Glu2384Lys)26278SACSUncertain significancers762896797RCV000995035|RCV001115057|RCV001242408|RCV001847126; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:00190132391086523910865CT13:g.23910865C>T-
NM_014363.6(SACS):c.7147C>T (p.Arg2383Cys)26278SACSUncertain significancers772611372RCV001109416; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391086823910868GA13:g.23910868G>A-
NM_014363.6(SACS):c.7140T>A (p.Asn2380Lys)26278SACSConflicting interpretations of pathogenicityrs61754478RCV000338875|RCV000725615|RCV001079763|RCV001109417; NMedGen:CN169374|MedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391087523910875AT13:g.23910875A>TClinGen:CA6910967CN169374 not specified;
NM_014363.6(SACS):c.7139del (p.Asn2380fs)26278SACSPathogenic/Likely pathogenicrs1057516689RCV000408983|RCV000622821|RCV001051132; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MeSH:D030342,MedGen:C0950123|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391087623910876ATANC_000013.10:g.23910880delClinGen:CA16041622C0950123 Inborn genetic diseases;
NM_014363.6(SACS):c.7114dup (p.Tyr2372fs)26278SACSLikely pathogenicrs1057517222RCV000412481; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391090023910901TTANC_000013.10:g.23910903dupClinGen:CA16041623C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.7110C>A (p.Tyr2370Ter)26278SACSLikely pathogenicrs1555251553RCV000674868; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391090523910905GT13:g.23910905G>T-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.7110C>G (p.Tyr2370Ter)26278SACSPathogenic-1RCV001784933; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391090523910905GC23910905-
NM_014363.6(SACS):c.7101G>A (p.Ala2367=)26278SACSConflicting interpretations of pathogenicityrs764702321RCV000868084|RCV001109418; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391091423910914CT13:g.23910914C>T-
NM_014363.6(SACS):c.7100C>T (p.Ala2367Val)26278SACSUncertain significancers752273313RCV000690739|RCV001275189; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391091523910915GA13:g.23910915G>A-C0037772 Spastic paraplegia;
NM_014363.6(SACS):c.7079_7081del (p.Ser2360del)26278SACSUncertain significancers1555251573RCV000666881; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391093423910936AAAGA13:g.23910934_23910936del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.6993A>T (p.Glu2331Asp)26278SACSUncertain significancers759201960RCV000712987|RCV001825425; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391102223911022TANC_000013.10:g.23911022T>A-
NM_014363.6(SACS):c.6952G>A (p.Ala2318Thr)26278SACSConflicting interpretations of pathogenicityrs147949881RCV000371368|RCV001247269|RCV000712986|RCV001642968|RCV001848099; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MedGen:CN517202|Human Phenotype O132391106323911063CTNC_000013.10:g.23911063C>TClinGen:CA6910993C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.6941A>C (p.Asn2314Thr)26278SACSUncertain significancers1868664491RCV001328752; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391107423911074TG23911074-
NM_014363.6(SACS):c.6919G>T (p.Gly2307Ter)26278SACSLikely pathogenicrs1555251615RCV000668288; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391109623911096CA13:g.23911096C>A-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.6856AAG[1] (p.Lys2287del)26278SACSUncertain significancers1555251633RCV000670787; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391115423911156GCTTG13:g.23911154_23911156del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.6859A>C (p.Lys2287Gln)26278SACSUncertain significancers1397588851RCV000712984|RCV001830586; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391115623911156TGNC_000013.10:g.23911156T>G-
NM_014363.6(SACS):c.6857A>G (p.Lys2286Arg)26278SACSUncertain significancers754381972RCV000791527|RCV001275190; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391115823911158TC13:g.23911158T>C-
NM_014363.6(SACS):c.6844T>C (p.Leu2282=)26278SACSUncertain significancers1868678889RCV001278824; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391117123911171AG13:g.23911171A>G-
NM_014363.6(SACS):c.6837dup (p.Glu2280fs)26278SACSPathogenic-1RCV001806843; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391117723911178CCT23911177-
NM_014363.6(SACS):c.6804del (p.Phe2268fs)26278SACSLikely pathogenicrs1057517301RCV000411394; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391121123911211TAT13:g.23911211_23911211delClinGen:CA16041624C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.6800_6802del (p.Ser2267del)26278SACSUncertain significancers1555251650RCV000673088; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391121323911215AAAGA13:g.23911213_23911215del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.6767_6794del (p.Leu2256fs)26278SACSLikely pathogenic-1RCV001783708; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391122123911248GGAATTTTCATTTAGAATTGGTTGCAAAAG23911220-
NM_014363.6(SACS):c.6781C>A (p.Leu2261Ile)26278SACSConflicting interpretations of pathogenicityrs146722795RCV000260358|RCV000516875|RCV001081244|RCV001847976; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:00190132391123423911234GT13:g.23911234G>TClinGen:CA6911032CN169374 not specified;
NM_014363.6(SACS):c.6778A>G (p.Ile2260Val)26278SACSUncertain significancers202110208RCV001287910|RCV001830092; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391123723911237TC23911237-
NM_014363.6(SACS):c.6776C>T (p.Pro2259Leu)26278SACSUncertain significancers150098233RCV000992796|RCV001275191; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391123923911239GA13:g.23911239G>A-
NM_014363.6(SACS):c.6757dup (p.Ile2253fs)26278SACSLikely pathogenicrs1057516932RCV000409610; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391125723911258AATNC_000013.10:g.23911258dupClinGen:CA16041625C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.6754G>T (p.Asp2252Tyr)26278SACSUncertain significancers886050082RCV000317355; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391126123911261CANC_000013.10:g.23911261C>AClinGen:CA10639231C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.6740C>G (p.Thr2247Arg)26278SACSUncertain significance-1RCV001578935; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391127523911275GC23911275-
NM_014363.6(SACS):c.6702T>A (p.Phe2234Leu)26278SACSUncertain significancers774487714RCV001287908|RCV001835367; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391131323911313AT23911313-
NM_014363.6(SACS):c.6665CAG[1] (p.Ala2223del)26278SACSUncertain significancers1555251695RCV000674439; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391134523911347CCTGC13:g.23911345_23911347del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.6663del (p.Lys2221fs)26278SACSPathogenic/Likely pathogenicrs1555251699RCV000666605|RCV001849038; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MONDO:MONDO:0019064,MedGen:C0037773,OMIM:PS303350, Orphanet:685132391135223911352GTG13:g.23911352_23911352del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.6650C>A (p.Pro2217Gln)26278SACSPathogenic/Likely pathogenic-1RCV001391623|RCV001880217; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391136523911365GT23911365-
NM_014363.6(SACS):c.6643T>C (p.Phe2215Leu)26278SACSUncertain significancers886050083RCV000374343; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391137223911372AGNC_000013.10:g.23911372A>GClinGen:CA10634039C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.6640C>T (p.Arg2214Cys)26278SACSUncertain significancers138379074RCV000538701|RCV000765122; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391137523911375GA13:g.23911375G>AClinGen:CA6911049C0037772 Spastic paraplegia;
NM_014363.6(SACS):c.6634A>G (p.Thr2212Ala)26278SACSConflicting interpretations of pathogenicityrs556248979RCV000282675|RCV000691162; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391138123911381TCNC_000013.10:g.23911381T>CClinGen:CA6911051C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.6632A>G (p.Gln2211Arg)26278SACSUncertain significancers1044714793RCV001287907|RCV001830091; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391138323911383TC23911383-
NM_014363.6(SACS):c.6593T>C (p.Ile2198Thr)26278SACSUncertain significancers754906806RCV000532956|RCV001834758; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391142223911422AG13:g.23911422A>GClinGen:CA6911056C0037772 Spastic paraplegia;
NM_014363.6(SACS):c.6592_6593insAAAAAAAAA (p.Ile2198_Arg2199insLysLysLys)26278SACSUncertain significancers1555251719RCV000672445; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391142223911423AATTTTTTTTT13:g.23911422_23911423insTTTTTTTTT-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.6577G>A (p.Asp2193Asn)26278SACSUncertain significancers149278134RCV000321278; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391143823911438CTNC_000013.10:g.23911438C>TClinGen:CA6911059C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.6561C>T (p.Ile2187=)26278SACSConflicting interpretations of pathogenicityrs143477126RCV000378234|RCV000863703; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391145423911454GANC_000013.10:g.23911454G>AClinGen:CA6911064C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.6518T>C (p.Ile2173Thr)26278SACSUncertain significancers368624188RCV000992795|RCV001111735|RCV001245042; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391149723911497AG13:g.23911497A>G-
NM_014363.6(SACS):c.6496C>T (p.Arg2166Cys)26278SACSUncertain significancers764516788RCV001300358|RCV001835432; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391151923911519GA23911519-
NM_014363.6(SACS):c.6485A>G (p.Asp2162Gly)26278SACSUncertain significancers369388933RCV000519608|RCV001829518; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391153023911530TCNC_000013.10:g.23911530T>CClinGen:CA6911075
NM_014363.6(SACS):c.6466GAT[1] (p.Asp2157del)26278SACSUncertain significancers1204242892RCV000674356; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391154423911546TATCT13:g.23911544_23911546del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.6448_6452del (p.Gln2150fs)26278SACSPathogenic/Likely pathogenicrs1057516635RCV000411320|RCV001245824; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391156323911567TAACTGTNC_000013.10:g.23911567_23911571delClinGen:CA16041626C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.6451T>G (p.Leu2151Val)26278SACSUncertain significancers886050084RCV000286135; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391156423911564AC13:g.23911564A>CClinGen:CA10639233C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.6436A>G (p.Ile2146Val)26278SACSUncertain significancers1415663565RCV000538763|RCV001829567; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391157923911579TC13:g.23911579T>CClinGen:CA387521847C0037772 Spastic paraplegia;
NM_014363.6(SACS):c.6434T>A (p.Leu2145Ter)26278SACSPathogenicrs770490672RCV000850593|RCV001386982; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391158123911581AT13:g.23911581A>T-
NM_014363.6(SACS):c.6409C>T (p.Gln2137Ter)26278SACSLikely pathogenicrs201690040RCV000666608; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391160623911606GA13:g.23911606G>A-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.6409C>G (p.Gln2137Glu)26278SACSUncertain significancers201690040RCV000804057|RCV001830740; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391160623911606GC13:g.23911606G>C-
NM_014363.6(SACS):c.6406A>T (p.Thr2136Ser)26278SACSUncertain significancers1566066009RCV000712981|RCV001830585; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391160923911609TANC_000013.10:g.23911609T>A-
NM_014363.6(SACS):c.6364A>G (p.Lys2122Glu)26278SACSUncertain significancers755723511RCV000992793|RCV001362985|RCV001784523; NMedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391165123911651TC13:g.23911651T>C-
NM_014363.6(SACS):c.6353_6356del (p.Gly2118fs)26278SACSLikely pathogenicrs1555251818RCV000670135; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391165923911662TCGTCT13:g.23911659_23911662del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.6355C>T (p.Arg2119Ter)26278SACSPathogenicrs766711286RCV000672257|RCV001387162; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391166023911660GA13:g.23911660G>A-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.6349G>A (p.Glu2117Lys)26278SACSUncertain significancers754033201RCV000805719|RCV001275192|RCV001287906; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202132391166623911666CT13:g.23911666C>T-
NM_014363.6(SACS):c.6343C>T (p.His2115Tyr)26278SACSUncertain significancers757161092RCV000528752|RCV001508701|RCV001783034; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391167223911672GA13:g.23911672G>AClinGen:CA6911100C0037772 Spastic paraplegia;
NM_014363.6(SACS):c.6338_6341del (p.Leu2113fs)26278SACSPathogenicrs1555251822RCV000677657; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391167423911677GATCAGNC_000013.10:g.23911677_23911680del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.6336A>C (p.Arg2112Ser)26278SACSConflicting interpretations of pathogenicityrs80132141RCV000517696|RCV001080771|RCV001111736|RCV001848895; NMedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MONDO:MONDO:00190132391167923911679TGNC_000013.10:g.23911679T>GClinGen:CA6911101CN169374 not specified;
NM_014363.6(SACS):c.6320del (p.Leu2107fs)26278SACSLikely pathogenicrs1057516295RCV000410468; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391169523911695CACNC_000013.10:g.23911697delClinGen:CA16041627C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.6300_6301delinsC (p.Ser2101fs)26278SACSLikely pathogenicrs1555251840RCV000669989; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391171423911715AAG13:g.23911715_23911715del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.6282del (p.Thr2095fs)26278SACSLikely pathogenicrs1555251853RCV000669770; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391173323911733TAT13:g.23911733_23911733del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.6267G>A (p.Ser2089=)26278SACSBenign/Likely benignrs9550956RCV000321971|RCV000343325|RCV000474698|RCV000676362; NMedGen:CN169374|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MedGen:CN517202132391174823911748CT13:g.23911748C>TClinGen:CA6911107CN517202 not provided;
NM_014363.6(SACS):c.6266C>T (p.Ser2089Leu)26278SACSUncertain significancers370095300RCV000516945|RCV001276938; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391174923911749GANC_000013.10:g.23911749G>AClinGen:CA6911108CN169374 not specified;
NM_014363.6(SACS):c.6240T>C (p.Val2080=)26278SACSConflicting interpretations of pathogenicityrs550680855RCV000676363|RCV001086386|RCV001111737|RCV001706417; NMedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN169374132391177523911775AG13:g.23911775A>GClinGen:CA6911113CN517202 not provided;
NM_014363.6(SACS):c.6231_6233del (p.Met2077del)26278SACSUncertain significancers1555251880RCV000668142; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391178223911784GATCG13:g.23911782_23911784del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.6221del (p.Asp2074fs)26278SACSLikely pathogenicrs1057517366RCV000411355; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391179423911794ATA13:g.23911794_23911794delClinGen:CA16041628C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.6195T>C (p.Ile2065=)26278SACSBenign/Likely benignrs4143768RCV000118232|RCV000381598|RCV000676364|RCV001517096|RCV001847720; NMedGen:CN169374|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|M132391182023911820AG13:g.23911820A>GClinGen:CA155044CN517202 not provided;
NM_014363.6(SACS):c.6178G>C (p.Val2060Leu)26278SACSUncertain significancers373226693RCV000712980|RCV001830584; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391183723911837CGNC_000013.10:g.23911837C>G-
NM_014363.6(SACS):c.6172del (p.Ser2058fs)26278SACSPathogenic/Likely pathogenicrs1214399996RCV000667372; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391184323911843GAG13:g.23911843_23911843del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.6163del (p.Gln2055fs)26278SACSLikely pathogenicrs1555251905RCV000673654; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391185223911852TGT13:g.23911852_23911852del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.6130C>T (p.Gln2044Ter)26278SACSLikely pathogenicrs1408290451RCV000673160; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391188523911885GA13:g.23911885G>A-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.6126C>A (p.Cys2042Ter)26278SACSPathogenic-1RCV001391622; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391188923911889GT23911889-
NM_014363.6(SACS):c.6125G>A (p.Cys2042Tyr)26278SACSUncertain significance-1RCV001535820; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391189023911890CT23911890-
NM_014363.6(SACS):c.6119C>G (p.Ala2040Gly)26278SACSUncertain significancers1234193312RCV001278825; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391189623911896GC13:g.23911896G>C-
NM_014363.6(SACS):c.6096G>A (p.Ser2032=)26278SACSUncertain significancers756027210RCV001112181; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391191923911919CT13:g.23911919C>T-
NM_014363.6(SACS):c.6084A>T (p.Glu2028Asp)26278SACSConflicting interpretations of pathogenicityrs149018756RCV000518824|RCV001276939|RCV002060257; NMedGen:CN169374|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391193123911931TA13:g.23911931T>AClinGen:CA6911139CN169374 not specified;
NM_014363.6(SACS):c.6070C>G (p.Leu2024Val)26278SACSUncertain significancers758895050RCV001112182; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391194523911945GC13:g.23911945G>C-
NM_014363.6(SACS):c.6069C>T (p.Asn2023=)26278SACSConflicting interpretations of pathogenicityrs35369023RCV000289978|RCV000861552|RCV001660626|RCV001848100; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MedGen:CN169374|MONDO:MONDO:00190132391194623911946GA13:g.23911946G>AClinGen:CA6911143C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.6068del (p.Asn2023fs)26278SACSLikely pathogenicrs1555251935RCV000670921; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391194723911947GTG13:g.23911947_23911947del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.6062C>A (p.Ser2021Tyr)26278SACSUncertain significance-1RCV001578944; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391195323911953GT23911953-
NM_014363.6(SACS):c.6059G>A (p.Gly2020Glu)26278SACSUncertain significancers747566710RCV000347234|RCV000699474|RCV000517759; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MedGen:CN169374132391195623911956CT13:g.23911956C>TClinGen:CA6911144CN169374 not specified;
NM_014363.6(SACS):c.6052A>T (p.Lys2018Ter)26278SACSLikely pathogenicrs1555251944RCV000673402; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391196323911963TA13:g.23911963T>A-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.6051G>C (p.Lys2017Asn)26278SACSConflicting interpretations of pathogenicityrs35865691RCV000516670|RCV001112183|RCV001082654|RCV001848894; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:00190132391196423911964CGNC_000013.10:g.23911964C>GClinGen:CA6911147CN169374 not specified;
NM_014363.6(SACS):c.6030G>T (p.Lys2010Asn)26278SACSUncertain significancers769751841RCV000518243|RCV000803901|RCV001783017; NMedGen:CN169374|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391198523911985CANC_000013.10:g.23911985C>AClinGen:CA6911148CN169374 not specified;
NM_014363.6(SACS):c.6008A>T (p.Asp2003Val)26278SACSConflicting interpretations of pathogenicityrs537408260RCV000390861|RCV000401468|RCV001087895|RCV001848064; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:00190132391200723912007TA13:g.23912007T>AClinGen:CA6911152CN169374 not specified;
NM_014363.6(SACS):c.6000_6004del (p.Arg2002fs)26278SACSPathogenicrs773754134RCV001192590|RCV001232497; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391201123912015CTTCTTC13:g.23912011_23912015del-
NM_014363.6(SACS):c.6001dup (p.Arg2001fs)26278SACSLikely pathogenicrs1555251960RCV000670859; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391201323912014CCT13:g.23912013_23912014insT-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.5999_6001del (p.Lys2000del)26278SACSUncertain significancers1555251960RCV000673637; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391201423912016CTTTC13:g.23912014_23912016del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.5990_5991del (p.Ser1997fs)26278SACSLikely pathogenicrs1555251963RCV000671797; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391202423912025TAGT13:g.23912024_23912025del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.5975G>A (p.Arg1992Lys)26278SACSUncertain significancers758101602RCV000805575|RCV001830748; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391204023912040CT13:g.23912040C>T-
NM_014363.6(SACS):c.5972dup (p.Arg1992fs)26278SACSLikely pathogenic-1RCV001535819; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391204223912043TTA23912042-
NM_014363.6(SACS):c.5971G>A (p.Val1991Ile)26278SACSConflicting interpretations of pathogenicity-1RCV001481775|RCV001508702|RCV001780391; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391204423912044CT23912044-
NM_014363.6(SACS):c.5937_5939del (p.Ser1980del)26278SACSUncertain significancers1555251980RCV000671647; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391207623912078AGAGA13:g.23912076_23912078del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.5932G>A (p.Val1978Ile)26278SACSUncertain significancers373812430RCV000312333|RCV000995036; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202132391208323912083CT13:g.23912083C>TClinGen:CA6911169C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.5930A>G (p.Lys1977Arg)26278SACSUncertain significancers774492331RCV000350600|RCV000550324; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391208523912085TC13:g.23912085T>CClinGen:CA6911170C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.5919del (p.Glu1974fs)26278SACSLikely pathogenicrs1555251990RCV000665272; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391209623912096CTC13:g.23912096_23912096del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.5906A>G (p.His1969Arg)26278SACSUncertain significancers776693219RCV000693766|RCV001825352; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391210923912109TC13:g.23912109T>C-C0037772 Spastic paraplegia;
NM_014363.6(SACS):c.5903C>T (p.Ala1968Val)26278SACSConflicting interpretations of pathogenicityrs201866523RCV001780180|RCV001242782|RCV001732089; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MedGen:CN517202132391211223912112GA13:g.23912112G>A-
NM_014363.6(SACS):c.5858A>T (p.His1953Leu)26278SACSUncertain significancers1428265468RCV000633048|RCV001276940; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391215723912157TANC_000013.10:g.23912157T>AClinGen:CA387524514C0037772 Spastic paraplegia;
NM_014363.6(SACS):c.5855T>A (p.Val1952Asp)26278SACSUncertain significance-1RCV001579250; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391216023912160AT23912160-
NM_014363.6(SACS):c.5848G>A (p.Asp1950Asn)26278SACSUncertain significancers370902090RCV000225857|RCV000676365|RCV001578942; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391216723912167CT13:g.23912167C>TClinGen:CA6911186CN517202 not provided;
NM_014363.6(SACS):c.5842G>A (p.Asp1948Asn)26278SACSUncertain significancers772515267RCV000434730|RCV001828396|RCV001851025; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391217323912173CT13:g.23912173C>TClinGen:CA6911188CN517202 not provided;
NM_014363.6(SACS):c.5841C>T (p.Pro1947=)26278SACSConflicting interpretations of pathogenicityrs145371235RCV000392069|RCV000868830|RCV001081266; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391217423912174GA13:g.23912174G>AClinGen:CA6911189C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.5836T>C (p.Trp1946Arg)26278SACSPathogenicrs137853017RCV000005852|RCV001851682; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391217923912179AG13:g.23912179A>GUniProtKB:Q9NZJ4#VAR_064811,OMIM:604490.0006,ClinGen:CA253513C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.5832A>G (p.Ala1944=)26278SACSConflicting interpretations of pathogenicityrs374169472RCV000805989|RCV001289181|RCV001784428; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391218323912183TC13:g.23912183T>C-
NM_014363.6(SACS):c.5784dup (p.Arg1929fs)26278SACSLikely pathogenicrs1057517099RCV000409433; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391223023912231GGTNC_000013.10:g.23912231dupClinGen:CA16041629C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.5785C>T (p.Arg1929Trp)26278SACSUncertain significancers141019064RCV001064907|RCV001115152; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391223023912230GA13:g.23912230G>A-
NM_014363.6(SACS):c.5770G>T (p.Val1924Leu)26278SACSUncertain significancers1329947939RCV001115153; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391224523912245CA13:g.23912245C>A-
NM_014363.6(SACS):c.5764_5767del (p.Leu1922fs)26278SACSLikely pathogenicrs759166250RCV000410379; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391224823912251TGTAAT13:g.23912248_23912251delClinGen:CA6911197C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.5761T>G (p.Tyr1921Asp)26278SACSPathogenic-1RCV001391621; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391225423912254AC23912254-
NM_014363.6(SACS):c.5744_5745del (p.His1915fs)26278SACSPathogenic/Likely pathogenicrs1057517138RCV000411869|RCV001387964; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391227023912271CATC13:g.23912270_23912271delClinGen:CA16041630C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.5744A>G (p.His1915Arg)26278SACSUncertain significancers144822691RCV000712979|RCV001245813|RCV000765123; NMedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391227123912271TCNC_000013.10:g.23912271T>C-
NM_014363.6(SACS):c.5732C>T (p.Thr1911Met)26278SACSUncertain significancers368494148RCV000513129|RCV000518319|RCV001275193; NMedGen:CN517202|MedGen:CN169374|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391228323912283GA13:g.23912283G>AClinGen:CA6911204CN517202 not provided;
NM_014363.6(SACS):c.5719C>T (p.Arg1907Ter)26278SACSPathogenicrs1485209013RCV000672553; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391229623912296GA13:g.23912296G>A-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.5719del (p.Arg1907fs)26278SACSLikely pathogenicrs1555252055RCV000671785; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391229623912296CGC13:g.23912296_23912296del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.5711C>T (p.Thr1904Ile)26278SACSUncertain significancers758570844RCV000995037|RCV001245729|RCV001784527; NMedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391230423912304GA13:g.23912304G>A-
NM_014363.6(SACS):c.5711C>G (p.Thr1904Arg)26278SACSConflicting interpretations of pathogenicityrs758570844RCV000995038|RCV001578936|RCV001419225; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391230423912304GC13:g.23912304G>C-
NM_014363.6(SACS):c.5692G>T (p.Glu1898Ter)26278SACSLikely pathogenic-1RCV001783709; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391232323912323CA23912323-
NM_014363.6(SACS):c.5639C>T (p.Thr1880Ile)26278SACSUncertain significancers1555252070RCV000667624; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391237623912376GA13:g.23912376G>A-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.5630G>A (p.Arg1877Gln)26278SACSUncertain significance-1RCV001663558|RCV001832845|RCV001847316; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MONDO:MONDO:0019064,MedGen:C0037773,OMIM:PS303350, Orphanet:685132391238523912385CT23912385-
NM_014363.6(SACS):c.5629C>T (p.Arg1877Ter)26278SACSConflicting interpretations of pathogenicityrs761089024RCV000409299|RCV000515938|RCV001865273; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MONDO:MONDO:0019064,MedGen:C0037773,OMIM:PS303350, Orphanet:685|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontolo132391238623912386GA13:g.23912386G>AClinGen:CA6911218C0037773 Hereditary spastic paraplegia;
NM_014363.6(SACS):c.5621T>C (p.Leu1874Ser)26278SACSUncertain significancers1868847058RCV001262659; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391239423912394AG13:g.23912394A>G-
NM_014363.6(SACS):c.5618_5619del (p.Tyr1873fs)26278SACSLikely pathogenicrs1188844823RCV000672744; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391239623912397AATA13:g.23912396_23912397del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.5598_5599del (p.Ile1867fs)26278SACSPathogenic/Likely pathogenicrs1555252086RCV000674844|RCV001204188; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391241623912417ATGA13:g.23912416_23912417del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.5591A>G (p.Lys1864Arg)26278SACSUncertain significance-1RCV001578933; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391242423912424TC23912424-
NM_014363.6(SACS):c.5583G>C (p.Trp1861Cys)26278SACSUncertain significancers140678034RCV000517247|RCV001276941; NMedGen:CN169374|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391243223912432CGNC_000013.10:g.23912432C>GClinGen:CA6911227CN169374 not specified;
NM_014363.6(SACS):c.5529G>C (p.Leu1843=)26278SACSLikely benignrs148091738RCV000862540|RCV001276942; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391248623912486CG13:g.23912486C>G-
NM_014363.6(SACS):c.5502G>C (p.Leu1834=)26278SACSConflicting interpretations of pathogenicityrs34389000RCV000861553|RCV001115154|RCV001664489|RCV001849145; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN169374|MONDO:MONDO:00190132391251323912513CG13:g.23912513C>G-
NM_014363.6(SACS):c.5492del (p.Lys1831fs)26278SACSLikely pathogenicrs1868862742RCV001255857; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391252323912523CTC13:g.23912523_23912523del-
NM_014363.6(SACS):c.5469C>A (p.Cys1823Ter)26278SACSLikely pathogenicrs1057517172RCV000409004; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391254623912546GT13:g.23912546G>TClinGen:CA16041631C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.5466T>C (p.Thr1822=)26278SACSUncertain significancers757576348RCV001115155; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391254923912549AG13:g.23912549A>G-
NM_014363.6(SACS):c.5461T>C (p.Cys1821Arg)26278SACSConflicting interpretations of pathogenicityrs376680832RCV000863078|RCV001080973|RCV001115156|RCV001849165; NMedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MONDO:MONDO:00190132391255423912554AG13:g.23912554A>G-
NM_014363.6(SACS):c.5458C>T (p.Leu1820=)26278SACSLikely benign-1RCV001403344|RCV001831432; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391255723912557GA23912557-
NM_014363.6(SACS):c.5428C>T (p.Gln1810Ter)26278SACSPathogenic/Likely pathogenicrs1868872666RCV001039830|RCV001289179|RCV001785771; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391258723912587GA13:g.23912587G>A-
NM_014363.6(SACS):c.5419G>A (p.Glu1807Lys)26278SACSConflicting interpretations of pathogenicityrs375805688RCV000516475|RCV000863881|RCV001109527; NMedGen:CN169374|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391259623912596CTNC_000013.10:g.23912596C>TClinGen:CA6911250CN169374 not specified;
NM_014363.6(SACS):c.5414C>G (p.Ser1805Ter)26278SACSLikely pathogenicrs1555252113RCV000664891; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391260123912601GC13:g.23912601G>C-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.5391G>C (p.Lys1797Asn)26278SACSConflicting interpretations of pathogenicityrs144715822RCV000518362|RCV001109528|RCV001433538; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391262423912624CGNC_000013.10:g.23912624C>GClinGen:CA6911253CN169374 not specified;
NM_014363.6(SACS):c.5379del (p.Phe1793fs)26278SACSLikely pathogenicrs1057517297RCV000412471; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391263623912636CAC13:g.23912636_23912636delClinGen:CA16041632C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.5368G>A (p.Ala1790Thr)26278SACSUncertain significancers147517201RCV000821085|RCV001276943|RCV001849125; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MONDO:MONDO:0019064,MedGen:C00377132391264723912647CT13:g.23912647C>T-
NM_014363.6(SACS):c.5358TGA[1] (p.Asp1788del)26278SACSUncertain significancers775922113RCV000668952; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391265223912654GTCAG13:g.23912652_23912654del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.5356G>A (p.Asp1786Asn)26278SACSUncertain significancers763496360RCV000822535|RCV001276944; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391265923912659CT13:g.23912659C>T-
NM_014363.6(SACS):c.5304_5306del (p.His1769del)26278SACSUncertain significancers1555252136RCV000669699; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391270923912711ATGGA13:g.23912709_23912711del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.5302C>T (p.His1768Tyr)26278SACSUncertain significancers758381112RCV000297039; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391271323912713GA13:g.23912713G>AClinGen:CA6911269C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.5281C>T (p.Gln1761Ter)26278SACSLikely pathogenicrs1555252142RCV000671001; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391273423912734GA13:g.23912734G>A-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.5274C>T (p.Cys1758=)26278SACSBenignrs201982449RCV000867989|RCV001278826; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391274123912741GA13:g.23912741G>A-
NM_014363.6(SACS):c.5238dup (p.Lys1747Ter)26278SACSLikely pathogenicrs1555252148RCV000673869; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391277623912777TTA13:g.23912776_23912777insA-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.5222C>T (p.Thr1741Ile)26278SACSConflicting interpretations of pathogenicityrs201724656RCV000354216|RCV000876841|RCV001848101; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0019064,MedGen:C00377132391279323912793GA13:g.23912793G>AClinGen:CA6911277C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.5169A>G (p.Ala1723=)26278SACSConflicting interpretations of pathogenicityrs200699984RCV000874244|RCV001109529; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391284623912846TC13:g.23912846T>C-
NM_014363.6(SACS):c.5151dup (p.Ser1718fs)26278SACSPathogenicrs754439135RCV000517322|RCV001035595|RCV001276945|RCV001848893; NMedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MONDO:MONDO:00190132391286323912864AATNC_000013.10:g.23912872dupClinGen:CA6911291CN517202 not provided;
NM_014363.6(SACS):c.5149_5151del (p.Lys1717del)26278SACSUncertain significancers754439135RCV000672014|RCV001849040; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MONDO:MONDO:0019064,MedGen:C0037773,OMIM:PS303350, Orphanet:685132391286423912866ATTTA13:g.23912864_23912866del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.5147A>G (p.Lys1716Arg)26278SACSUncertain significancers199998045RCV001224971|RCV001836173; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391286823912868TC13:g.23912868T>C-
NM_014363.6(SACS):c.5143A>T (p.Lys1715Ter)26278SACSPathogenicrs755824618RCV001174760|RCV001387163; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391287223912872TA13:g.23912872T>A-
NM_014363.6(SACS):c.5125C>T (p.Gln1709Ter)26278SACSPathogenicrs1057517311RCV000412006|RCV001224413; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391289023912890GA13:g.23912890G>AClinGen:CA16041633C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.5122del (p.Ala1708fs)26278SACSLikely pathogenicrs1485885260RCV000668294; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391289323912893GCG13:g.23912893_23912893del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.5111_5113dup (p.Pro1705_Ser1706insHis)26278SACSUncertain significancers1555252172RCV000667641; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391290123912902GGGGT13:g.23912901_23912902insGGT-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.5079G>A (p.Met1693Ile)26278SACSUncertain significancers775069857RCV000995039|RCV001231870|RCV001784528; NMedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391293623912936CT13:g.23912936C>T-
NM_014363.6(SACS):c.5073_5074dup (p.Ser1692fs)26278SACSLikely pathogenicrs1057517305RCV000409240; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391294023912941GGAC13:g.23912940_23912941insACClinGen:CA16041634C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.5075C>A (p.Ser1692Ter)26278SACSLikely pathogenicrs1555252184RCV000667425; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391294023912940GT13:g.23912940G>T-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.5065_5066del (p.Ser1689fs)26278SACSPathogenic/Likely pathogenicrs1372213267RCV000591507|RCV000724727|RCV001853995; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391294923912950ACTA13:g.23912949_23912950delClinGen:CA608985270C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.5064G>A (p.Gln1688=)26278SACSLikely benignrs760628805RCV000868684|RCV001275194; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391295123912951CT13:g.23912951C>T-
NM_014363.6(SACS):c.5060C>T (p.Thr1687Ile)26278SACSUncertain significancers776656956RCV001045544|RCV001276946; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391295523912955GA13:g.23912955G>A-
NM_014363.6(SACS):c.5045G>A (p.Arg1682Lys)26278SACSUncertain significancers1269546947RCV001043294|RCV001832412; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391297023912970CT13:g.23912970C>T-
NM_014363.6(SACS):c.5043C>T (p.His1681=)26278SACSUncertain significancers1868915593RCV001109530; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391297223912972GA13:g.23912972G>A-
NM_014363.6(SACS):c.5010T>G (p.Tyr1670Ter)26278SACSLikely pathogenicrs1459899547RCV000672847; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391300523913005AC13:g.23913005A>C-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.4998A>G (p.Thr1666=)26278SACSLikely benignrs184994682RCV000862021|RCV001275195; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391301723913017TC13:g.23913017T>C-
NM_014363.6(SACS):c.4986G>A (p.Thr1662=)26278SACSConflicting interpretations of pathogenicityrs755523201RCV001109531|RCV001425988; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391302923913029CT13:g.23913029C>T-
NM_014363.6(SACS):c.4976T>G (p.Val1659Gly)26278SACSUncertain significancers886050085RCV000261943; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391303923913039AC13:g.23913039A>CClinGen:CA10643115C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.4963A>G (p.Lys1655Glu)26278SACSUncertain significancers1035497308RCV001278827; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391305223913052TC13:g.23913052T>C-
NM_014363.6(SACS):c.4936C>A (p.Leu1646Met)26278SACSUncertain significancers200810800RCV000300780|RCV000516210|RCV001242340; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391307923913079GT13:g.23913079G>TClinGen:CA6911320CN169374 not specified;
NM_014363.6(SACS):c.4933C>T (p.Arg1645Ter)26278SACSPathogenicrs770901638RCV001255708|RCV001383726; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391308223913082GA13:g.23913082G>A-
NM_014363.6(SACS):c.4913G>A (p.Ser1638Asn)26278SACSUncertain significancers774163551RCV001289176|RCV001830108; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391310223913102CT23913102-
NM_014363.6(SACS):c.4900G>C (p.Glu1634Gln)26278SACSUncertain significancers143961484RCV000503684|RCV000551798|RCV000765124|RCV001848875; NMedGen:CN169374|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MONDO:MONDO:00190132391311523913115CGNC_000013.10:g.23913115C>GClinGen:CA6911327CN169374 not specified;
NM_014363.6(SACS):c.4894_4897del (p.Leu1631_Thr1632insTer)26278SACSLikely pathogenicrs1057516580RCV000411344; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391311823913121ACAGTA13:g.23913118_23913121delClinGen:CA16041635C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.4877_4880del (p.Gly1626fs)26278SACSPathogenicrs757872635RCV000282747|RCV000670743; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391313523913138ACAGCANC_000013.10:g.23913137_23913140delClinGen:CA6911333
NM_014363.6(SACS):c.4878C>T (p.Gly1626=)26278SACSLikely benignrs778664565RCV000868844|RCV001278828; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391313723913137GA13:g.23913137G>A-
NM_014363.6(SACS):c.4846A>C (p.Asn1616His)26278SACSUncertain significance-1RCV001663557|RCV001827569; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391316923913169TG23913169-
NM_014363.6(SACS):c.4840T>C (p.Phe1614Leu)26278SACSUncertain significancers771080306RCV001289174|RCV001830107; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391317523913175AG23913175-
NM_014363.6(SACS):c.4835dup (p.Phe1614fs)26278SACSPathogenic-1RCV001391620; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391317923913180TTC23913179-
NM_014363.6(SACS):c.4814G>C (p.Ser1605Thr)26278SACSUncertain significancers770007806RCV001225970|RCV001828802|RCV001847199; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MONDO:MONDO:0019064,MedGen:C00377132391320123913201CG13:g.23913201C>G-
NM_014363.6(SACS):c.4782C>G (p.Asp1594Glu)26278SACSUncertain significancers1330036755RCV001111811|RCV001223402; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391323323913233GC13:g.23913233G>C-
NM_014363.6(SACS):c.4760del (p.His1587fs)26278SACSLikely pathogenicrs1057516285RCV000409566; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391325523913255ATANC_000013.10:g.23913255delClinGen:CA16041636C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.4756_4760del (p.Asn1586fs)26278SACSPathogenic-1RCV001568302|RCV001832778|RCV001847304|RCV001866008; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MONDO:MONDO:0019064,MedGen:C0037773,OMIM:PS303350, Orphanet:685|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human 132391325523913259ATGATTA23913254-
NM_014363.6(SACS):c.4757A>G (p.Asn1586Ser)26278SACSConflicting interpretations of pathogenicityrs201558584RCV000633040|RCV001111812|RCV001508703|RCV001849005; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202|MONDO:MONDO:00190132391325823913258TC13:g.23913258T>CClinGen:CA6911347C0037772 Spastic paraplegia;
NM_014363.6(SACS):c.4744G>A (p.Asp1582Asn)26278SACSPathogenic/Likely pathogenicrs1160357920RCV000536906|RCV000578242|RCV001848923; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MONDO:MONDO:0019064,MedGen:C00377132391327123913271CT13:g.23913271C>TClinGen:CA387527870C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.4743C>T (p.Phe1581=)26278SACSLikely benignrs143310473RCV000868486|RCV001825737; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391327223913272GA13:g.23913272G>A-
NM_014363.6(SACS):c.4724G>A (p.Arg1575Gln)26278SACSUncertain significancers764992284RCV001195790; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391329123913291CT13:g.23913291C>T-
NM_014363.6(SACS):c.4724G>C (p.Arg1575Pro)26278SACSPathogenic-1RCV001391619; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391329123913291CG23913291-
NM_014363.6(SACS):c.4718T>G (p.Met1573Arg)26278SACSPathogenic-1RCV001391618; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391329723913297AC23913297-
NM_014363.6(SACS):c.4639A>T (p.Arg1547Trp)26278SACSUncertain significancers772907934RCV000992792|RCV001051001|RCV001784522; NMedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391337623913376TA13:g.23913376T>A-
NM_014363.6(SACS):c.4628A>G (p.Glu1543Gly)26278SACSUncertain significancers370324250RCV000557599|RCV000992791|RCV001783033; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391338723913387TC13:g.23913387T>CClinGen:CA6911367C0037772 Spastic paraplegia;
NM_014363.6(SACS):c.4612A>G (p.Ile1538Val)26278SACSUncertain significancers544249449RCV000518100|RCV000547323|RCV001275196; NMedGen:CN169374|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391340323913403TCNC_000013.10:g.23913403T>CClinGen:CA6911368CN169374 not specified;
NM_014363.6(SACS):c.4606G>T (p.Val1536Leu)26278SACSUncertain significancers764832688RCV000489239|RCV001834590; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391340923913409CANC_000013.10:g.23913409C>AClinGen:CA387528267
NM_014363.6(SACS):c.4593dup (p.Asp1532fs)26278SACSLikely pathogenicrs780197970RCV000410059; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391342123913422CCT13:g.23913421_23913422insTClinGen:CA6911373C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.4585C>T (p.Gln1529Ter)26278SACSPathogenicrs1555252345RCV000625765; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391343023913430GA13:g.23913430G>AClinGen:CA387528407C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.4565_4568del (p.Leu1522fs)26278SACSPathogenic/Likely pathogenicrs1555252349RCV000670492|RCV001389177; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391344723913450CCACAC13:g.23913447_23913450del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.4522A>C (p.Asn1508His)26278SACSUncertain significancers144653411RCV000992790|RCV001276947; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391349323913493TG13:g.23913493T>G-
NM_014363.6(SACS):c.4495dup (p.Met1499fs)26278SACSLikely pathogenicrs1555252359RCV000671834; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391351923913520AAT13:g.23913519_23913520insT-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.4465_4471del (p.Asn1489fs)26278SACSLikely pathogenicrs1057516294RCV000409192; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391354423913550GTTGCATTG13:g.23913544_23913550delClinGen:CA16041637C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.4430T>C (p.Ile1477Thr)26278SACSUncertain significance-1RCV001647238; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391358523913585AG23913585-
NM_014363.6(SACS):c.4385dup (p.Arg1463fs)26278SACSLikely pathogenicrs1555252388RCV000671599; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391362923913630TTA13:g.23913629_23913630insA-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.4318A>G (p.Ser1440Gly)26278SACSUncertain significancers1172044277RCV000992788|RCV001858756|RCV001832308; NMedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391369723913697TC13:g.23913697T>C-
NM_014363.6(SACS):c.4302A>G (p.Leu1434=)26278SACSConflicting interpretations of pathogenicityrs34559250RCV000357802|RCV000864699|RCV000517025|RCV001171670|RCV001848102; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MedGen:CN169374|MedGen:CN517202|M132391371323913713TC13:g.23913713T>CClinGen:CA6911407CN169374 not specified;
NM_014363.6(SACS):c.4299G>A (p.Trp1433Ter)26278SACSLikely pathogenicrs768209419RCV001289171|RCV001830105; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391371623913716CT23913716-
NM_014363.6(SACS):c.4298G>A (p.Trp1433Ter)26278SACSLikely pathogenicrs1057516930RCV000410424; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391371723913717CTNC_000013.10:g.23913717C>TClinGen:CA16041638C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.4279C>A (p.Pro1427Thr)26278SACSConflicting interpretations of pathogenicityrs527513599RCV000333351|RCV001089050|RCV001782779; NMedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391373623913736GT13:g.23913736G>TClinGen:CA6911409CN169374 not specified;
NM_014363.6(SACS):c.4268A>G (p.His1423Arg)26278SACSUncertain significance-1RCV001823470; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391374723913747TC23913747-
NM_014363.6(SACS):c.4255A>G (p.Ile1419Val)26278SACSConflicting interpretations of pathogenicityrs138245586RCV001111813|RCV001482679|RCV001289170; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MedGen:CN517202132391376023913760TC13:g.23913760T>C-
NM_014363.6(SACS):c.4233dup (p.Leu1412fs)26278SACSLikely pathogenicrs1555252448RCV000672857; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391378123913782GGT13:g.23913781_23913782insT-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.4234C>T (p.Leu1412Phe)26278SACSUncertain significancers961377840RCV001111814; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391378123913781GA13:g.23913781G>A-
NM_014363.6(SACS):c.4232T>G (p.Leu1411Ter)26278SACSPathogenicrs867249938RCV000521561|RCV000984213|RCV001064306; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391378323913783ACNC_000013.10:g.23913783A>CClinGen:CA387531824
NM_014363.6(SACS):c.4199_4200insAACATTAATGTTTAATG (p.Tyr1400Ter)26278SACSLikely pathogenicrs1555252458RCV000665635; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391381523913816AACATTAAACATTAATGTT13:g.23913815_23913816insCATTAAACATTAATGTT-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.4188C>T (p.His1396=)26278SACSBenign/Likely benignrs61754477RCV000265524|RCV000324275|RCV000461336|RCV000676366; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN169374|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MedGen:CN517202132391382723913827GA13:g.23913827G>AClinGen:CA6911421CN517202 not provided;
NM_014363.6(SACS):c.4173_4175del (p.Ile1391del)26278SACSUncertain significancers1555252463RCV000670377; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391384023913842CATGC13:g.23913840_23913842del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.4168del (p.Ile1391fs)26278SACSLikely pathogenicrs1555252465RCV000673214; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391384723913847AGA13:g.23913847_23913847del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.4162_4164del (p.Ser1388del)26278SACSUncertain significancers755941308RCV000674669; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391385123913853TAGAT13:g.23913851_23913853del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.4149T>C (p.His1383=)26278SACSUncertain significancers749219225RCV000633019|RCV001275197; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391386623913866AG13:g.23913866A>GClinGen:CA6911426C0037772 Spastic paraplegia;
NM_014363.6(SACS):c.4145A>G (p.His1382Arg)26278SACSLikely benignrs550057119RCV000876720|RCV001830926; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391387023913870TC13:g.23913870T>C-
NM_014363.6(SACS):c.4118C>T (p.Ala1373Val)26278SACSConflicting interpretations of pathogenicityrs61548169RCV000224523|RCV000290021|RCV001112284|RCV001847949|RCV001084237; NMedGen:CN517202|MedGen:CN169374|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MONDO:MONDO:0019064,MedGen:C0037773,OMIM:PS303350, Orphanet:685|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:H132391389723913897GA13:g.23913897G>AClinGen:CA6911430CN517202 not provided;
NM_014363.6(SACS):c.4117G>C (p.Ala1373Pro)26278SACSConflicting interpretations of pathogenicityrs61326562RCV000323040|RCV000884011|RCV001848103; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0019064,MedGen:C00377132391389823913898CG13:g.23913898C>GClinGen:CA6911431C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.4103G>T (p.Ser1368Ile)26278SACSPathogenicrs1566069517RCV000761546; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391391223913912CANC_000013.10:g.23913912C>A-
NM_014363.6(SACS):c.4098G>C (p.Leu1366=)26278SACSLikely benignrs200381539RCV000865968|RCV001835990; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391391723913917CG13:g.23913917C>G-
NM_014363.6(SACS):c.4095G>A (p.Trp1365Ter)26278SACSLikely pathogenicrs1057516779RCV000412449; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391392023913920CT13:g.23913920C>TClinGen:CA16041639C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.4076T>C (p.Met1359Thr)26278SACSConflicting interpretations of pathogenicityrs146451611RCV000194599|RCV000515329|RCV000710206|RCV001082339|RCV001847803; NMedGen:CN169374|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|M132391393923913939AG13:g.23913939A>GClinGen:CA208864CN169374 not specified;
NM_014363.6(SACS):c.4039del (p.Leu1347fs)26278SACSLikely pathogenicrs1057516222RCV000409583; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391397623913976AGANC_000013.10:g.23913976delClinGen:CA16041640C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.4033dup (p.Gln1345fs)26278SACSPathogenicrs606231163RCV000005853; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391398123913982TTGNC_000013.10:g.23913983dupClinGen:CA253515,OMIM:604490.0007C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.4015A>C (p.Ile1339Leu)26278SACSConflicting interpretations of pathogenicityrs143144795RCV001112285|RCV001847159|RCV001523475; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MONDO:MONDO:0019064,MedGen:C0037773,OMIM:PS303350, Orphanet:685|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontolo132391400023914000TG13:g.23914000T>G-
NM_014363.6(SACS):c.3992A>G (p.His1331Arg)26278SACSUncertain significancers1869039514RCV001278829; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391402323914023TC13:g.23914023T>C-
NM_014363.6(SACS):c.3978_3982del (p.Glu1326fs)26278SACSLikely pathogenicrs1555252518RCV000668565; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391403323914037GTCAACG13:g.23914033_23914037del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.3915T>C (p.His1305=)26278SACSConflicting interpretations of pathogenicityrs767598017RCV000865691|RCV001112286|RCV001446915; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391410023914100AG13:g.23914100A>G-
NM_014363.6(SACS):c.3901C>T (p.Gln1301Ter)26278SACSLikely pathogenicrs1555252531RCV000667332; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391411423914114GA13:g.23914114G>A-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.3868G>T (p.Ala1290Ser)26278SACSUncertain significancers757939935RCV000379945|RCV000501904; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN169374132391414723914147CANC_000013.10:g.23914147C>AClinGen:CA6911463CN169374 not specified;
NM_014363.6(SACS):c.3836G>A (p.Trp1279Ter)26278SACSLikely pathogenic-1RCV001843707; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391417923914179CT23914179-
NM_014363.6(SACS):c.3831_3832dup (p.Val1278fs)26278SACSLikely pathogenicrs1555252545RCV000671777; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391418223914183AACC13:g.23914182_23914183insCC-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.3768C>T (p.Tyr1256=)26278SACSLikely benignrs200350631RCV000862947|RCV001275198; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391424723914247GA13:g.23914247G>A-
NM_014363.6(SACS):c.3752T>C (p.Ile1251Thr)26278SACSConflicting interpretations of pathogenicityrs76872266RCV000269188|RCV000282202|RCV000861200|RCV001086494|RCV001848052; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN169374|MedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|M132391426323914263AG13:g.23914263A>GClinGen:CA6911480CN169374 not specified;
NM_014363.6(SACS):c.3729A>G (p.Glu1243=)26278SACSLikely benignrs756663705RCV000873926|RCV001277260; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391428623914286TC13:g.23914286T>C-
NM_014363.6(SACS):c.3706_3707insACT (p.Tyr1235dup)26278SACSUncertain significancers1555252563RCV000672372; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391430823914309GGAGT13:g.23914308_23914309insAGT-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.3700T>A (p.Trp1234Arg)26278SACSUncertain significancers1192682879RCV000658672|RCV001692255; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391431523914315AT13:g.23914315A>T-CN517202 not provided;
NM_014363.6(SACS):c.3674T>G (p.Leu1225Ter)26278SACSLikely pathogenicrs959856535RCV000668407; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391434123914341AC13:g.23914341A>C-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.3655C>T (p.Pro1219Ser)26278SACSLikely benign-1RCV001823047; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391436023914360GA23914360-
NM_014363.6(SACS):c.3637T>C (p.Leu1213=)26278SACSConflicting interpretations of pathogenicity-1RCV001517041|RCV001727865|RCV001724329|RCV001836434|RCV001847292; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MedGen:CN517202|MedGen:CN169374|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|M132391437823914378AG23914378-
NM_014363.6(SACS):c.3633del (p.Ala1212fs)26278SACSLikely pathogenicrs1555252587RCV000666037; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391438223914382CTC13:g.23914382_23914382del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.3615C>T (p.Ile1205=)26278SACSUncertain significancers886050086RCV000326629; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391440023914400GA13:g.23914400G>AClinGen:CA10644038C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.3589T>C (p.Ser1197Pro)26278SACSLikely pathogenicrs727503785RCV000157061; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391442623914426AG13:g.23914426A>GClinGen:CA273726C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.3557T>C (p.Met1186Thr)26278SACSUncertain significancers886050087RCV000383585; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391445823914458AG13:g.23914458A>GClinGen:CA10634058C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.3556dup (p.Met1186fs)26278SACSLikely pathogenicrs1555252611RCV000671609; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391445823914459AAT13:g.23914458_23914459insT-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.3551C>G (p.Pro1184Arg)26278SACSUncertain significancers374961109RCV001247995|RCV001835319; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391446423914464GC13:g.23914464G>C-
NM_014363.6(SACS):c.3550C>T (p.Pro1184Ser)26278SACSUncertain significancers200831217RCV001051899|RCV001827327; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391446523914465GA13:g.23914465G>A-
NM_014363.6(SACS):c.3545C>T (p.Ala1182Val)26278SACSUncertain significancers373859681RCV000283262; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391447023914470GA13:g.23914470G>AClinGen:CA6911512C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.3523_3527del (p.Gly1175fs)26278SACSLikely pathogenicrs1555252623RCV000674267; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391448823914492ATCTCCA13:g.23914488_23914492del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.3506G>C (p.Gly1169Ala)26278SACSUncertain significancers1443000762RCV000676367|RCV001830473; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391450923914509CG13:g.23914509C>G-CN517202 not provided;
NM_014363.6(SACS):c.3457A>T (p.Lys1153Ter)26278SACSLikely pathogenicrs1555252634RCV000670862; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391455823914558TA13:g.23914558T>A-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.3443A>C (p.Lys1148Thr)26278SACSUncertain significancers140028127RCV001243638|RCV001835177; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391457223914572TG13:g.23914572T>G-
NM_014363.6(SACS):c.3429A>G (p.Gln1143=)26278SACSUncertain significancers1869096503RCV001037458|RCV001827224; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391458623914586TC13:g.23914586T>C-
NM_014363.6(SACS):c.3427C>A (p.Gln1143Lys)26278SACSConflicting interpretations of pathogenicityrs144267558RCV000193535|RCV000338267|RCV000470007|RCV001083422|RCV001847871; NMedGen:CN169374|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|M132391458823914588GTNC_000013.10:g.23914588G>TClinGen:CA207090CN169374 not specified;
NM_014363.6(SACS):c.3427C>T (p.Gln1143Ter)26278SACSPathogenic/Likely pathogenicrs144267558RCV000670813; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391458823914588GA13:g.23914588G>A-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.3417C>T (p.His1139=)26278SACSConflicting interpretations of pathogenicityrs758862765RCV000869042|RCV001113627|RCV001396576; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391459823914598GA13:g.23914598G>A-
NM_014363.6(SACS):c.3413A>G (p.Asn1138Ser)26278SACSUncertain significancers1202128043RCV000517093|RCV001834669; NMedGen:CN169374|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391460223914602TC13:g.23914602T>CClinGen:CA387535393CN169374 not specified;
NM_014363.6(SACS):c.3408T>G (p.Asn1136Lys)26278SACSUncertain significancers756303420RCV000518654|RCV001829475; NMedGen:CN169374|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391460723914607AC13:g.23914607A>CClinGen:CA246662269CN169374 not specified;
NM_014363.6(SACS):c.3391C>T (p.Leu1131Phe)26278SACSConflicting interpretations of pathogenicityrs139805032RCV000232090|RCV000988965; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391462423914624GA13:g.23914624G>AClinGen:CA6911531C0037772 Spastic paraplegia;
NM_014363.6(SACS):c.3369TCT[1] (p.Leu1125del)26278SACSUncertain significancers1555252672RCV000665289; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391464123914643CAGAC13:g.23914641_23914643del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.3356del (p.Pro1119fs)26278SACSPathogenic/Likely pathogenicrs1057517039RCV000412109|RCV001383371; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391465923914659AGA13:g.23914659_23914659delClinGen:CA16041641C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.3346G>A (p.Gly1116Ser)26278SACSUncertain significancers774044532RCV001113628; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391466923914669CT13:g.23914669C>T-
NM_014363.6(SACS):c.3345C>T (p.Val1115=)26278SACSConflicting interpretations of pathogenicityrs143287019RCV000374188|RCV000860788|RCV001660627; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MedGen:CN169374132391467023914670GA13:g.23914670G>AClinGen:CA6911535C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.3343G>A (p.Val1115Ile)26278SACSUncertain significancers771915442RCV001207086|RCV001833820; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391467223914672CT13:g.23914672C>T-
NM_014363.6(SACS):c.3328dup (p.Ile1110fs)26278SACSPathogenic/Likely pathogenicrs770866403RCV000169583|RCV001850406; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391468623914687AAT13:g.23914686_23914687insTClinGen:CA274434C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.3281dup (p.Asn1094fs)26278SACSPathogenic/Likely pathogenic-1RCV001421039|RCV001814320; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0011442,MedGen:C4023354132391473323914734GGT23914733-
NM_014363.6(SACS):c.3242C>T (p.Pro1081Leu)26278SACSUncertain significancers377493083RCV000517189|RCV001829474; NMedGen:CN169374|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391477323914773GANC_000013.10:g.23914773G>AClinGen:CA246662431CN169374 not specified;
NM_014363.6(SACS):c.3195_3196del (p.Phe1065fs)26278SACSLikely pathogenicrs1057516551RCV000411216; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391481923914820CAAC13:g.23914819_23914820delClinGen:CA16041642C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.3173T>C (p.Ile1058Thr)26278SACSUncertain significance-1RCV001578940; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391484223914842AG23914842-
NM_014363.6(SACS):c.3161T>C (p.Phe1054Ser)26278SACSPathogenicrs137853019RCV000005855; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391485423914854AG13:g.23914854A>GClinGen:CA253518,UniProtKB:Q9NZJ4#VAR_064807,OMIM:604490.0009C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.3159_3160del (p.Leu1053_Phe1054insTer)26278SACSLikely pathogenic-1RCV001775262; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391485523914856AAGA23914854-
NM_014363.6(SACS):c.3144A>G (p.Val1048=)26278SACSConflicting interpretations of pathogenicityrs3751369RCV000279611|RCV000712974|RCV001081930|RCV001848104; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:00190132391487123914871TC13:g.23914871T>CClinGen:CA6911561C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.3129A>G (p.Ser1043=)26278SACSConflicting interpretations of pathogenicityrs148878361RCV000334685|RCV000372721|RCV001082217|RCV000710205|RCV001847975; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN169374|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MedGen:CN517202|M132391488623914886TC13:g.23914886T>CClinGen:CA6911564CN169374 not specified;
NM_014363.6(SACS):c.3096G>A (p.Glu1032=)26278SACSLikely benignrs529746813RCV000869782|RCV001830910; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391491923914919CT13:g.23914919C>T-
NM_014363.6(SACS):c.3074A>T (p.Asn1025Ile)26278SACSConflicting interpretations of pathogenicityrs150981983RCV000173863|RCV001080295|RCV001277261; NMedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391494123914941TA13:g.23914941T>AClinGen:CA239318CN169374 not specified;
NM_014363.6(SACS):c.3070A>G (p.Lys1024Glu)26278SACSUncertain significancers1869134973RCV001278830; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391494523914945TC13:g.23914945T>C-
NM_014363.6(SACS):c.3066del (p.Asn1025fs)26278SACSLikely pathogenicrs1057516767RCV000412355; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391494923914949GAG13:g.23914949_23914949delClinGen:CA16041643C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.3055A>G (p.Asn1019Asp)26278SACSPathogenicrs1566071225RCV000761547; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391496023914960TCNC_000013.10:g.23914960T>C-
NM_014363.6(SACS):c.3042A>G (p.Leu1014=)26278SACSConflicting interpretations of pathogenicityrs141982796RCV000399926|RCV000992787|RCV001416952; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391497323914973TC13:g.23914973T>CClinGen:CA6911574C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.3021_3023del (p.Glu1008del)26278SACSUncertain significancers1555252742RCV000674580; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391499223914994CTCTC13:g.23914992_23914994del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.3017A>G (p.His1006Arg)26278SACSUncertain significancers368149368RCV000712973|RCV001271966; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391499823914998TCNC_000013.10:g.23914998T>C-
NM_014363.6(SACS):c.2996T>C (p.Ile999Thr)26278SACSUncertain significancers371869943RCV000373496|RCV000681647; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391501923915019AG13:g.23915019A>GClinGen:CA6911580CN169374 not specified;
NM_014363.6(SACS):c.2988A>G (p.Leu996=)26278SACSConflicting interpretations of pathogenicityrs111846884RCV000386665|RCV000761852|RCV001086002|RCV001109613|RCV001847974; NMedGen:CN169374|MedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|M132391502723915027TC13:g.23915027T>CClinGen:CA6911582CN169374 not specified;
NM_014363.6(SACS):c.2983G>T (p.Val995Phe)26278SACSBenign/Likely benignrs142967124RCV000203008|RCV000761853|RCV001109614|RCV001086025|RCV001847912; NMedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|M132391503223915032CANC_000013.10:g.23915032C>AClinGen:CA249209CN169374 not specified;
NM_014363.6(SACS):c.2957T>A (p.Leu986Ter)26278SACSLikely pathogenicrs766457071RCV000409140; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391505823915058ATNC_000013.10:g.23915058A>TClinGen:CA6911585C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.2938_2939del (p.Met980fs)26278SACSPathogenicrs1593133306RCV000850594; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391507623915077CATC13:g.23915076_23915077del-
NM_014363.6(SACS):c.2929C>T (p.Leu977=)26278SACSLikely benignrs146296924RCV000840234|RCV001277262|RCV001083492; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391508623915086GA13:g.23915086G>A-
NM_014363.6(SACS):c.2926C>A (p.Arg976Ser)26278SACSConflicting interpretations of pathogenicityrs139993038RCV000516574|RCV001081341|RCV001109615|RCV001644611|RCV001848892; NMedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN169374|M132391508923915089GTNC_000013.10:g.23915089G>TClinGen:CA6911590CN169374 not specified;
NM_014363.6(SACS):c.2926C>T (p.Arg976Cys)26278SACSUncertain significancers139993038RCV001239667|RCV001828927; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391508923915089GA13:g.23915089G>A-
NM_014363.6(SACS):c.2913_2914dup (p.Glu972fs)26278SACSLikely pathogenicrs1057517034RCV000409133; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391510023915101TTCA13:g.23915100_23915101insCAClinGen:CA16041644C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.2903_2906del (p.Asp968fs)26278SACSPathogenicrs1259615333RCV000664233|RCV000691411; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391510923915112ACTGTA13:g.23915109_23915112del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.2904C>T (p.Asp968=)26278SACSLikely benign-1RCV001504618|RCV001832666; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391511123915111GA23915111-
NM_014363.6(SACS):c.2881C>T (p.Arg961Ter)26278SACSPathogenicrs1593133395RCV000793079|RCV001830692; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391513423915134GA13:g.23915134G>A-
NM_014363.6(SACS):c.2870del (p.Pro957fs)26278SACSLikely pathogenicrs1057516624RCV000411525; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391514523915145TGT13:g.23915145_23915145delClinGen:CA16041645C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.2863A>T (p.Lys955Ter)26278SACSLikely pathogenicrs1555252786RCV000667512; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391515223915152TA13:g.23915152T>A-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.2853C>A (p.His951Gln)26278SACSUncertain significancers200644511RCV000558806|RCV001835846; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391516223915162GT13:g.23915162G>TClinGen:CA6911606C0037772 Spastic paraplegia;
NM_014363.6(SACS):c.2829dup (p.Leu944fs)26278SACSLikely pathogenicrs1869162207RCV001255707; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391518523915186AAT13:g.23915185_23915186insT-
NM_014363.6(SACS):c.2830T>C (p.Leu944=)26278SACSLikely benign-1RCV001457710|RCV001832593; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391518523915185AG23915185-
NM_014363.6(SACS):c.2806C>A (p.Gln936Lys)26278SACSConflicting interpretations of pathogenicityrs61978562RCV001288712|RCV001830102|RCV002069552; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391520923915209GT23915209-
NM_014363.6(SACS):c.2791A>T (p.Asn931Tyr)26278SACSConflicting interpretations of pathogenicityrs190383030RCV001111914|RCV001479507; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391522423915224TA13:g.23915224T>A-
NM_014363.6(SACS):c.2788A>G (p.Ile930Val)26278SACSUncertain significancers886050088RCV000313588|RCV000700339; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391522723915227TCNC_000013.10:g.23915227T>CClinGen:CA10639237C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.2776A>G (p.Ile926Val)26278SACSUncertain significancers144362131RCV000712972|RCV001111915|RCV001257223|RCV001849073; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:00190132391523923915239TCNC_000013.10:g.23915239T>C-
NM_014363.6(SACS):c.2733C>T (p.Thr911=)26278SACSLikely benignrs199702597RCV000869149|RCV001278831; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391528223915282GA13:g.23915282G>A-
NM_014363.6(SACS):c.2699_2700del (p.Lys900fs)26278SACSPathogenic/Likely pathogenicrs1167474602RCV000667508|RCV001385440; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391531523915316CTTC13:g.23915315_23915316del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.2686C>T (p.Leu896Phe)26278SACSUncertain significancers760556327RCV000992785|RCV001832307; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391532923915329GA13:g.23915329G>A-
NM_014363.6(SACS):c.2681C>T (p.Ser894Leu)26278SACSConflicting interpretations of pathogenicityrs201857647RCV000349604|RCV000712971|RCV001080014|RCV001706475; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MedGen:CN169374132391533423915334GANC_000013.10:g.23915334G>AClinGen:CA6911646CN169374 not specified;
NM_014363.6(SACS):c.2643G>C (p.Glu881Asp)26278SACSConflicting interpretations of pathogenicityrs200517685RCV000173860|RCV000400126|RCV001085181; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391537223915372CG13:g.23915372C>GClinGen:CA239314CN169374 not specified;
NM_014363.6(SACS):c.2629_2630dup (p.Leu877fs)26278SACSLikely pathogenicrs1057516829RCV000410288; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391538423915385CCAA13:g.23915384_23915385insAAClinGen:CA16041646C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.2627_2631del (p.Val876fs)26278SACSLikely pathogenicrs1555252844RCV000672777; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391538423915388GCAAAAG13:g.23915384_23915388del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.2614_2619del (p.Leu872_Pro873del)26278SACSUncertain significancers771746381RCV000672019; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391539623915401TTGGTAAT13:g.23915396_23915401del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.2602A>G (p.Ile868Val)26278SACSConflicting interpretations of pathogenicityrs142284018RCV000518481|RCV000820462|RCV001111916|RCV001848891; NMedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MONDO:MONDO:00190132391541323915413TCNC_000013.10:g.23915413T>CClinGen:CA6911659CN169374 not specified;
NM_014363.6(SACS):c.2599T>C (p.Tyr867His)26278SACSUncertain significancers774682589RCV000560347|RCV001508705|RCV001783032; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391541623915416AGNC_000013.10:g.23915416A>GClinGen:CA6911660C0037772 Spastic paraplegia;
NM_014363.6(SACS):c.2597A>G (p.Lys866Arg)26278SACSUncertain significancers761960824RCV001336181; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391541823915418TC23915418-
NM_014363.6(SACS):c.2585C>T (p.Pro862Leu)26278SACSUncertain significancers776290829RCV001288711|RCV001830101; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391543023915430GA23915430-
NM_014363.6(SACS):c.2581C>T (p.His861Tyr)26278SACSUncertain significancers759265754RCV000814972|RCV001830785; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391543423915434GA13:g.23915434G>A-
NM_014363.6(SACS):c.2580A>G (p.Gln860=)26278SACSConflicting interpretations of pathogenicityrs41283958RCV000712969|RCV000765125|RCV001087176|RCV001849072; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:00190132391543523915435TCNC_000013.10:g.23915435T>C-
NM_014363.6(SACS):c.2564T>G (p.Leu855Ter)26278SACSLikely pathogenicrs142037771RCV000669728; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391545123915451AC13:g.23915451A>C-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.2551G>T (p.Val851Phe)26278SACSUncertain significancers756890722RCV000545527|RCV001834757|RCV001848921; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MONDO:MONDO:0019064,MedGen:C00377132391546423915464CA13:g.23915464C>AClinGen:CA6911670C0037772 Spastic paraplegia;
NM_014363.6(SACS):c.2533C>T (p.Gln845Ter)26278SACSLikely pathogenicrs1555252876RCV000664830; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391548223915482GA13:g.23915482G>A-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.2497G>A (p.Glu833Lys)26278SACSConflicting interpretations of pathogenicityrs143433500RCV000309988|RCV000517722|RCV000529780; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391551823915518CTNC_000013.10:g.23915518C>TClinGen:CA6911678CN169374 not specified;
NM_014363.6(SACS):c.2494T>C (p.Ser832Pro)26278SACSLikely benignrs549957998RCV000863911|RCV001277263; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391552123915521AG13:g.23915521A>G-
NM_014363.6(SACS):c.2492A>G (p.Glu831Gly)26278SACSUncertain significancers375968367RCV000700961|RCV001271967; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391552323915523TC13:g.23915523T>C-C0037772 Spastic paraplegia;
NM_014363.6(SACS):c.2488G>A (p.Asp830Asn)26278SACSUncertain significancers571646732RCV001112373; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391552723915527CT13:g.23915527C>T-
NM_014363.6(SACS):c.2487C>T (p.Asp829=)26278SACSConflicting interpretations of pathogenicityrs151198216RCV000364679|RCV000867241; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391552823915528GANC_000013.10:g.23915528G>AClinGen:CA6911682C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.2472G>A (p.Ser824=)26278SACSLikely benignrs554395185RCV000870183|RCV001825751; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391554323915543CT13:g.23915543C>T-
NM_014363.6(SACS):c.2451_2452insT (p.Ile818fs)26278SACSLikely pathogenicrs1555252926RCV000668817; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391556323915564TTA13:g.23915563_23915564insA-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.2451C>T (p.Leu817=)26278SACSLikely benignrs756595744RCV000871764|RCV001277264|RCV001410793; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391556423915564GA13:g.23915564G>A-
NM_014363.6(SACS):c.2439_2440del (p.Val815fs)26278SACSPathogenic/Likely pathogenicrs775059063RCV000169208|RCV000992783|RCV001382654|RCV001814081; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|Human Phenotype O132391557523915576CATC13:g.23915575_23915576delClinGen:CA274046C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.2438_2439del (p.Thr813fs)26278SACSLikely pathogenicrs1555252928RCV000672354; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391557623915577ATGA13:g.23915576_23915577del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.2434C>T (p.Gln812Ter)26278SACSLikely pathogenicrs1555252929RCV000674140; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391558123915581GA13:g.23915581G>A-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.2403A>G (p.Pro801=)26278SACSLikely benignrs758503842RCV000898797|RCV001277265; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391561223915612TC13:g.23915612T>C-
NM_014363.6(SACS):c.2330C>A (p.Ser777Ter)26278SACSLikely pathogenicrs1057517437RCV000409346; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391568523915685GTNC_000013.10:g.23915685G>TClinGen:CA16041647C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.2329dup (p.Ser777fs)26278SACSLikely pathogenicrs1555252944RCV000673181; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391568523915686GGA13:g.23915685_23915686insA-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.2322A>G (p.Pro774=)26278SACSLikely benignrs1869225328RCV001278832|RCV001413369; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391569323915693TC13:g.23915693T>C-
NM_014363.6(SACS):c.2294A>G (p.Tyr765Cys)26278SACSConflicting interpretations of pathogenicityrs141553858RCV000688531|RCV001784312|RCV001756169; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202132391572123915721TCNC_000013.10:g.23915721T>C-C0037772 Spastic paraplegia;
NM_014363.6(SACS):c.2287C>T (p.Gln763Ter)26278SACSLikely pathogenicrs1555252953RCV000671096; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391572823915728GA13:g.23915728G>A-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.2278T>C (p.Leu760=)26278SACSLikely benign-1RCV001494678|RCV001826329; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391573723915737AG23915737-
NM_014363.6(SACS):c.2234G>A (p.Arg745His)26278SACSConflicting interpretations of pathogenicityrs143677534RCV000555876|RCV001271968|RCV001088901; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391578123915781CT13:g.23915781C>TClinGen:CA6911721C0037772 Spastic paraplegia;
NM_014363.6(SACS):c.2225G>C (p.Arg742Pro)26278SACSUncertain significance-1RCV001647239; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391579023915790CG23915790-
NM_014363.6(SACS):c.2224C>T (p.Arg742Ter)26278SACSLikely pathogenicrs1057517285RCV000412381; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391579123915791GANC_000013.10:g.23915791G>AClinGen:CA16041648C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.2186-2A>G26278SACSLikely pathogenicrs1057516554RCV000410645; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132391583123915831TC13:g.23915831T>CClinGen:CA16041649C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.2186-4A>G26278SACSConflicting interpretations of pathogenicityrs371866995RCV000664864|RCV001512029; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132391583323915833TC13:g.23915833T>C-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.2182C>T (p.Arg728Ter)26278SACSPathogenic/Likely pathogenicrs752059006RCV000393719|RCV000454220|RCV000984212|RCV001859535|RCV001848046; NMedGen:CN517202|Human Phenotype Ontology:HP:0012443,MedGen:C4021085|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype O132392792723927927GA13:g.23927927G>AClinGen:CA6911751C4021085 Abnormality of brain morphology;
NM_014363.6(SACS):c.2182C>G (p.Arg728Gly)26278SACSUncertain significancers752059006RCV000992782|RCV001277266; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392792723927927GC13:g.23927927G>C-
NM_014363.6(SACS):c.2110C>A (p.Leu704Ile)26278SACSUncertain significancers767844042RCV000270117; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392799923927999GTNC_000013.10:g.23927999G>TClinGen:CA10639241C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.2096C>T (p.Ser699Phe)26278SACSUncertain significancers374680967RCV000992781|RCV001271969; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392801323928013GA13:g.23928013G>A-
NM_014363.6(SACS):c.2080G>A (p.Ala694Thr)26278SACSBenignrs17325713RCV000250154|RCV000234475|RCV000624974|RCV000676368|RCV001847973; NMedGen:CN169374|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202|M132392867123928671CT13:g.23928671C>TClinGen:CA6911796,UniProtKB:Q9NZJ4#VAR_059717CN517202 not provided;
NM_014363.6(SACS):c.2076del (p.Ser693fs)26278SACSLikely pathogenicrs1057516224RCV000411780; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392867523928675AGANC_000013.10:g.23928676delClinGen:CA16041650C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.2037CTC[1] (p.Ser682del)26278SACSUncertain significancers764516069RCV001288710|RCV001835373; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392870923928711TGAGT23928708-
NM_014363.6(SACS):c.2024A>G (p.Asn675Ser)26278SACSUncertain significancers146395198RCV000712965|RCV001244618|RCV001784352; NMedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392872723928727TCNC_000013.10:g.23928727T>C-
NM_014363.6(SACS):c.2023A>T (p.Asn675Tyr)26278SACSUncertain significancers374667929RCV000633046|RCV001835013; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392872823928728TANC_000013.10:g.23928728T>AClinGen:CA6911809C0037772 Spastic paraplegia;
NM_014363.6(SACS):c.1919_1920del (p.His640fs)26278SACSPathogenicrs797045937RCV000192515; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392883123928832GGTGNC_000013.10:g.23928832TG[1]ClinGen:CA276979C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.1917A>G (p.Ala639=)26278SACSConflicting interpretations of pathogenicityrs138457742RCV000710204|RCV001078709|RCV001283505|RCV001782774; NMedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MedGen:CN169374|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392883423928834TC13:g.23928834T>CClinGen:CA6911818CN169374 not specified;
NM_014363.6(SACS):c.1913G>A (p.Cys638Tyr)26278SACSConflicting interpretations of pathogenicityrs778572943RCV000862304|RCV001277267|RCV001088293; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132392883823928838CT13:g.23928838C>T-
NM_014363.6(SACS):c.1912T>G (p.Cys638Gly)26278SACSConflicting interpretations of pathogenicityrs200333323RCV000306464|RCV001288709|RCV001400059|RCV001848105; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:00190132392883923928839ACNC_000013.10:g.23928839A>CClinGen:CA6911820C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.1907G>A (p.Arg636Gln)26278SACSUncertain significancers368944813RCV000819244|RCV001784447|RCV001508706; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202132392884423928844CT13:g.23928844C>T-
NM_014363.6(SACS):c.1906C>T (p.Arg636Trp)26278SACSConflicting interpretations of pathogenicityrs201752905RCV000676369|RCV001049324|RCV001113725; NMedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392884523928845GA13:g.23928845G>A-CN517202 not provided;
NM_014363.6(SACS):c.1886C>T (p.Ala629Val)26278SACSUncertain significancers760505057RCV000530995|RCV001829566; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392886523928865GA13:g.23928865G>AClinGen:CA6911832C0037772 Spastic paraplegia;
NM_014363.6(SACS):c.1885G>A (p.Ala629Thr)26278SACSConflicting interpretations of pathogenicityrs149638449RCV000518207|RCV001113726|RCV001083870|RCV001848890; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:00190132392886623928866CTNC_000013.10:g.23928866C>TClinGen:CA6911833CN169374 not specified;
NM_014363.6(SACS):c.1884C>T (p.Pro628=)26278SACSBenign/Likely benignrs144468379RCV000866995|RCV001288708|RCV001277268; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MedGen:CN169374|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392886723928867GA13:g.23928867G>A-
NM_014363.6(SACS):c.1846G>C (p.Ala616Pro)26278SACSUncertain significancers200437752RCV000712964|RCV000812548|RCV001784351; NMedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392890523928905CGNC_000013.10:g.23928905C>G-
NM_014363.6(SACS):c.1839G>A (p.Gln613=)26278SACSBenign/Likely benignrs35840595RCV000247615|RCV000361137|RCV000676370|RCV001084224|RCV001848027; NMedGen:CN169374|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|M132392891223928912CT13:g.23928912C>TClinGen:CA6911843CN517202 not provided;
NM_014363.6(SACS):c.1814C>T (p.Pro605Leu)26278SACSLikely pathogenic-1RCV001729997; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392893723928937GA23928937-
NM_014363.6(SACS):c.1799A>G (p.Gln600Arg)26278SACSUncertain significancers1348513054RCV000516359|RCV001829473; NMedGen:CN169374|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392895223928952TC13:g.23928952T>CClinGen:CA387546434CN169374 not specified;
NM_014363.6(SACS):c.1791A>T (p.Ser597=)26278SACSConflicting interpretations of pathogenicityrs371175405RCV000633109|RCV001113727; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392896023928960TA13:g.23928960T>AClinGen:CA6911850C0037772 Spastic paraplegia;
NM_014363.6(SACS):c.1769_1770del (p.Val590fs)26278SACSPathogenic-1RCV001389169|RCV001849514; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392898123928982GCAG23928980-
NM_014363.6(SACS):c.1762A>G (p.Lys588Glu)26278SACSUncertain significancers376186273RCV001113728; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392898923928989TC13:g.23928989T>C-
NM_014363.6(SACS):c.1752A>G (p.Leu584=)26278SACSConflicting interpretations of pathogenicityrs368626712RCV000871517|RCV001277269|RCV001847087; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MONDO:MONDO:0019064,MedGen:C00377132392899923928999TC13:g.23928999T>C-
NM_014363.6(SACS):c.1728C>T (p.Tyr576=)26278SACSConflicting interpretations of pathogenicityrs750748828RCV000266493|RCV000875331; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132392902323929023GANC_000013.10:g.23929023G>AClinGen:CA6911860C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.1683G>A (p.Val561=)26278SACSLikely benignrs1485932032RCV000929475|RCV001826940; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392906823929068CT13:g.23929068C>T-
NM_014363.6(SACS):c.1681del (p.Ala560_Val561insTer)26278SACSLikely pathogenicrs1057516543RCV000410889; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392907023929070ACA13:g.23929070_23929070delClinGen:CA16041651C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.1672C>T (p.Gln558Ter)26278SACSPathogenic/Likely pathogenicrs923921184RCV000627327|RCV001065954|RCV001785684|RCV001849000; NMedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MONDO:MONDO:00190132392907923929079GANC_000013.10:g.23929079G>AClinGen:CA387547285
NM_014363.6(SACS):c.1656A>G (p.Leu552=)26278SACSBenign/Likely benignrs1536365RCV000118231|RCV000321187|RCV000676371|RCV001517661|RCV001847719; NMedGen:CN169374|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|M132392909523929095TC13:g.23929095T>CClinGen:CA155042CN517202 not provided;
NM_014363.6(SACS):c.1640C>T (p.Pro547Leu)26278SACSUncertain significancers140507581RCV000375874; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392911123929111GANC_000013.10:g.23929111G>AClinVar:424657,ClinGen:CA6911879C0037773 Hereditary spastic paraplegia;
NM_014363.6(SACS):c.1627G>A (p.Val543Met)26278SACSUncertain significancers752705095RCV001336180; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392912423929124CT23929124-
NM_014363.6(SACS):c.1608G>A (p.Pro536=)26278SACSConflicting interpretations of pathogenicityrs745730439RCV000262582|RCV001504466; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132392914323929143CTNC_000013.10:g.23929143C>TClinGen:CA6911885C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.1607C>T (p.Pro536Leu)26278SACSConflicting interpretations of pathogenicityrs1440541889RCV000523535|RCV000674260|RCV001851489; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132392914423929144GANC_000013.10:g.23929144G>AClinGen:CA387547599
NM_014363.6(SACS):c.1596T>A (p.Tyr532Ter)26278SACSLikely pathogenic-1RCV001775261; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392915523929155AT23929155-
NM_014363.6(SACS):c.1593C>T (p.Ile531=)26278SACSConflicting interpretations of pathogenicityrs113756713RCV000861032|RCV001109712|RCV001552523|RCV001849134; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202|MONDO:MONDO:00190132392915823929158GA13:g.23929158G>A-
NM_014363.6(SACS):c.1593C>G (p.Ile531Met)26278SACSUncertain significance-1RCV001578938; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392915823929158GC23929158-
NM_014363.6(SACS):c.1562G>C (p.Ser521Thr)26278SACSConflicting interpretations of pathogenicityrs190617851RCV000697081|RCV001271970|RCV001756213; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202132392918923929189CG13:g.23929189C>G-C0037772 Spastic paraplegia;
NM_014363.6(SACS):c.1519A>G (p.Thr507Ala)26278SACSConflicting interpretations of pathogenicityrs372022664RCV000518256|RCV001271971|RCV001409443; NMedGen:CN169374|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132392923223929232TCNC_000013.10:g.23929232T>CClinGen:CA6911906CN169374 not specified;
NM_014363.6(SACS):c.1498G>A (p.Val500Ile)26278SACSUncertain significancers1244967438RCV000992780|RCV001827138; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392925323929253CT13:g.23929253C>T-
NM_014363.6(SACS):c.1483T>A (p.Phe495Ile)26278SACSUncertain significancers748972179RCV000552873|RCV001834756; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392926823929268AT13:g.23929268A>TClinGen:CA6911908C0037772 Spastic paraplegia;
NM_014363.6(SACS):c.1464G>A (p.Pro488=)26278SACSLikely benignrs375352514RCV000866167|RCV001278833; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392928723929287CT13:g.23929287C>T-
NM_014363.6(SACS):c.1463C>T (p.Pro488Leu)26278SACSUncertain significancers375875022RCV000317718|RCV000712962|RCV000464896|RCV001848106; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:00190132392928823929288GANC_000013.10:g.23929288G>AClinGen:CA6911912C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.1444C>G (p.Leu482Val)26278SACSConflicting interpretations of pathogenicityrs141487769RCV001109713|RCV002069778; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132392930723929307GC13:g.23929307G>C-
NM_014363.6(SACS):c.1435_1436insTTT (p.Trp479_Arg480insPhe)26278SACSUncertain significancers1555254306RCV000668148; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392931523929316CCAAA13:g.23929315_23929316insAAA-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.1420C>T (p.Arg474Cys)26278SACSUncertain significancers746704660RCV000664537; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392933123929331GA13:g.23929331G>A-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.1391T>G (p.Ile464Ser)26278SACSUncertain significancers1593144937RCV000992779|RCV001869375|RCV001832306; NMedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392936023929360AC13:g.23929360A>C-
NM_014363.6(SACS):c.1387C>A (p.His463Asn)26278SACSUncertain significancers149951538RCV001288707|RCV001830100; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392936423929364GT23929364-
NM_014363.6(SACS):c.1378C>T (p.Leu460Phe)26278SACSConflicting interpretations of pathogenicityrs145213666RCV000861435|RCV001277270|RCV001288706|RCV001849142; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202|MONDO:MONDO:00190132392937323929373GA13:g.23929373G>A-
NM_014363.6(SACS):c.1374A>G (p.Thr458=)26278SACSBenign/Likely benignrs149129638RCV000866381|RCV001277271|RCV001288705; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN169374132392937723929377TC13:g.23929377T>C-
NM_014363.6(SACS):c.1373C>T (p.Thr458Ile)26278SACSConflicting interpretations of pathogenicityrs61729954RCV000603816|RCV000516147|RCV000676372|RCV001082461|RCV001844110; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MONDO:MONDO:0019064,MedGen:C0037773,OMIM:PS303350, Orphanet:685|MedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human 132392937823929378GA13:g.23929378G>AClinGen:CA6911923C0037773 Hereditary spastic paraplegia;
NM_014363.6(SACS):c.1358del (p.Gly453fs)26278SACSPathogenic-1RCV001391617|RCV001880216; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132392939323929393ACA23929392-
NM_014363.6(SACS):c.1332A>G (p.Ala444=)26278SACSLikely benignrs1039811925RCV000938140|RCV001826979|RCV002066167; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132392941923929419TC13:g.23929419T>C-
NM_014363.6(SACS):c.1331C>G (p.Ala444Gly)26278SACSUncertain significancers951437363RCV001278834; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392942023929420GC13:g.23929420G>C-
NM_014363.6(SACS):c.1310C>T (p.Thr437Met)26278SACSUncertain significancers199657817RCV000992777|RCV001832304; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392944123929441GA13:g.23929441G>A-
NM_014363.6(SACS):c.1297G>C (p.Ala433Pro)26278SACSUncertain significancers770677319RCV001052446|RCV001277272; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392945423929454CG13:g.23929454C>G-
NM_014363.6(SACS):c.1278A>T (p.Leu426Phe)26278SACSUncertain significancers138413501RCV000372498|RCV001060561; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132392947323929473TANC_000013.10:g.23929473T>AClinGen:CA6911935C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.1276_1277dup (p.Leu426fs)26278SACSLikely pathogenicrs1057516406RCV000409220; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392947323929474TTAA13:g.23929473_23929474insAAClinGen:CA16041652C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.1259T>C (p.Ile420Thr)26278SACSUncertain significancers761791412RCV001112020; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392949223929492AG13:g.23929492A>G-
NM_014363.6(SACS):c.1228_1229del (p.Leu410fs)26278SACSPathogenic/Likely pathogenicrs1057516365RCV000411818|RCV001384946; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132392952223929523TAAT13:g.23929522_23929523delClinGen:CA16041653C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.1224C>T (p.Asp408=)26278SACSConflicting interpretations of pathogenicityrs2274386RCV000296723|RCV000862553|RCV001079181; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132392952723929527GANC_000013.10:g.23929527G>AClinGen:CA6911949C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.1219C>A (p.Leu407Ile)26278SACSUncertain significancers201569239RCV000333051|RCV001848107; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MONDO:MONDO:0019064,MedGen:C0037773,OMIM:PS303350, Orphanet:685132392953223929532GTNC_000013.10:g.23929532G>TClinGen:CA6911950C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.1201C>T (p.Arg401Ter)26278SACSPathogenic/Likely pathogenicrs769212398RCV001046270|RCV001261525; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392955023929550GA13:g.23929550G>A-
NM_014363.6(SACS):c.1189_1190del (p.Ser397fs)26278SACSPathogenic/Likely pathogenicrs1057516625RCV000409079|RCV001243148; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132392956123929562ACTA13:g.23929561_23929562delClinGen:CA16041654C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.1173T>C (p.Ser391=)26278SACSUncertain significancers150683286RCV000387597; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392957823929578AGNC_000013.10:g.23929578A>GClinGen:CA6911960C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.1173T>A (p.Ser391=)26278SACSLikely benignrs150683286RCV000666880; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392957823929578AT13:g.23929578A>T-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.1152T>G (p.Thr384=)26278SACSBenignrs185643322RCV000867239|RCV001278835; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392959923929599AC13:g.23929599A>C-
NM_014363.6(SACS):c.1137dup (p.Glu380fs)26278SACSPathogenic/Likely pathogenicrs1057516987RCV000411406|RCV001850954; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132392961323929614CCT13:g.23929613_23929614insTClinGen:CA16041655C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.1085del (p.Lys362fs)26278SACSLikely pathogenicrs1057517242RCV000410403; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392966623929666CTCNC_000013.10:g.23929670delClinGen:CA16041656C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.1081A>G (p.Lys361Glu)26278SACSConflicting interpretations of pathogenicityrs377027736RCV000293298|RCV000992772|RCV001500911; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132392967023929670TC13:g.23929670T>CClinGen:CA6911975C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.1066A>C (p.Ile356Leu)26278SACSConflicting interpretations of pathogenicityrs148286091RCV000392351|RCV000676373|RCV001083937|RCV001782775; NMedGen:CN169374|MedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392968523929685TG13:g.23929685T>GClinGen:CA6911977CN517202 not provided;
NM_014363.6(SACS):c.1066A>G (p.Ile356Val)26278SACSUncertain significancers148286091RCV000348179|RCV001848108|RCV001660628; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MONDO:MONDO:0019064,MedGen:C0037773,OMIM:PS303350, Orphanet:685|MedGen:CN517202132392968523929685TCNC_000013.10:g.23929685T>CClinGen:CA6911978C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.1061C>G (p.Thr354Ser)26278SACSUncertain significancers1425519295RCV000821539|RCV000992770|RCV001784452; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392969023929690GC13:g.23929690G>C-
NM_014363.6(SACS):c.1033C>T (p.Arg345Trp)26278SACSUncertain significancers776156836RCV000466492|RCV000519338|RCV001271972; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392971823929718GANC_000013.10:g.23929718G>AClinGen:CA6911986CN169374 not specified;
NM_014363.6(SACS):c.1004C>T (p.Ser335Leu)26278SACSConflicting interpretations of pathogenicityrs767435985RCV000673666|RCV001849042|RCV002060828; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MONDO:MONDO:0019064,MedGen:C0037773,OMIM:PS303350, Orphanet:685|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontolo132392974723929747GA13:g.23929747G>A-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.973G>A (p.Gly325Arg)26278SACSConflicting interpretations of pathogenicityrs144303334RCV000518798|RCV001083131|RCV001112021; NMedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392977823929778CTNC_000013.10:g.23929778C>TClinGen:CA6911994CN169374 not specified;
NM_014363.6(SACS):c.972C>A (p.Asp324Glu)26278SACSConflicting interpretations of pathogenicityrs546652936RCV000676374|RCV001112022|RCV001083526; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132392977923929779GTNC_000013.10:g.23929779G>TClinGen:CA6911995CN517202 not provided;
NM_014363.6(SACS):c.972C>T (p.Asp324=)26278SACSLikely benign-1RCV001496153|RCV001832649; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392977923929779GA23929779-
NM_014363.6(SACS):c.964G>T (p.Glu322Ter)26278SACSLikely pathogenicrs1593145590RCV000991449; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392978723929787CA13:g.23929787C>A-
NM_014363.6(SACS):c.961C>T (p.Arg321Ter)26278SACSPathogenicrs1175545518RCV000671337|RCV001090243|RCV001868253; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132392979023929790GA13:g.23929790G>A-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.954A>G (p.Leu318=)26278SACSUncertain significancers147412202RCV000390104; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392979723929797TCNC_000013.10:g.23929797T>CClinGen:CA6911998C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.944A>G (p.Asp315Gly)26278SACSUncertain significancers771115225RCV000289676; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392980723929807TCNC_000013.10:g.23929807T>CClinGen:CA6912001C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.914_915del (p.Thr305fs)26278SACSPathogenic-1RCV001391616; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392983623929837CTGC23929835-
NM_014363.6(SACS):c.909A>G (p.Ala303=)26278SACSBenign/Likely benignrs41315020RCV000249605|RCV000344542|RCV000465285|RCV000676375; NMedGen:CN169374|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MedGen:CN517202132392984223929842TC13:g.23929842T>CClinGen:CA6912006CN517202 not provided;
NM_014363.6(SACS):c.861C>T (p.Tyr287=)26278SACSConflicting interpretations of pathogenicityrs200877272RCV000869346|RCV001081486|RCV001112464; NMedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392989023929890GA13:g.23929890G>A-
NM_014363.6(SACS):c.848GTA[1] (p.Ser284del)26278SACSUncertain significancers1555254436RCV000668760; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392989823929900TTACT13:g.23929898_23929900del-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.832C>T (p.Gln278Ter)26278SACSLikely pathogenicrs1555254439RCV000666383; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392991923929919GA13:g.23929919G>A-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.818T>A (p.Phe273Tyr)26278SACSUncertain significancers182864646RCV000633042|RCV001829781; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132392993323929933ATNC_000013.10:g.23929933A>TClinGen:CA6912019C0037772 Spastic paraplegia;
NM_014363.6(SACS):c.815G>A (p.Arg272His)26278SACSPathogenic/Likely pathogenicrs745907077RCV000670029|RCV001855535; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132392993623929936CT13:g.23929936C>T-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.814C>T (p.Arg272Cys)26278SACSPathogenic/Likely pathogenicrs374128662RCV000612398|RCV000824757|RCV001380372|RCV001591363; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MONDO:MONDO:0100309,MedGen:C0004138, Orphanet:183518|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:00072132392993723929937GANC_000013.10:g.23929937G>AClinGen:CA246678438C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.810T>G (p.Phe270Leu)26278SACSConflicting interpretations of pathogenicityrs116907814RCV000517365|RCV000728923|RCV001085212|RCV001112465|RCV001848897; NMedGen:CN517202|MedGen:CN169374|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|M132392994123929941AC13:g.23929941A>CClinGen:CA6912021CN169374 not specified;
NM_014363.6(SACS):c.736C>G (p.Gln246Glu)26278SACSUncertain significancers886050089RCV000398546; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132393001523930015GCNC_000013.10:g.23930015G>CClinGen:CA10639246C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.699del (p.Asp235fs)26278SACSPathogenicrs1415870785RCV001287911|RCV001391615; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132393005223930052TGT23930051-
NM_014363.6(SACS):c.696T>A (p.Asn232Lys)26278SACSBenign/Likely benignrs2031640RCV000118233|RCV000304888|RCV000676376|RCV001517662|RCV001847721; NMedGen:CN169374|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|M132393005523930055AT13:g.23930055A>TClinGen:CA155046,UniProtKB:Q9NZJ4#VAR_059716CN517202 not provided;
NM_014363.6(SACS):c.623G>T (p.Ser208Ile)26278SACSConflicting interpretations of pathogenicityrs911764681RCV000522663|RCV000674847|RCV001224412; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132393012823930128CANC_000013.10:g.23930128C>AClinGen:CA246678645
NM_014363.6(SACS):c.605-1G>A26278SACSLikely pathogenicrs1555254489RCV000668193; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132393014723930147CT13:g.23930147C>T-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.604+1G>A26278SACSLikely pathogenicrs1555254734RCV000666450; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132393247323932473CT13:g.23932473C>T-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.598A>G (p.Ile200Val)26278SACSUncertain significancers762268076RCV001067073|RCV001277273; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132393248023932480TC13:g.23932480T>C-
NM_014363.6(SACS):c.593A>G (p.Tyr198Cys)26278SACSUncertain significancers1461096954RCV000516715|RCV001834670; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132393248523932485TC13:g.23932485T>CClinGen:CA387551889CN169374 not specified;
NM_014363.6(SACS):c.562G>A (p.Gly188Arg)26278SACSLikely pathogenicrs780184251RCV000988966; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132393251623932516CT13:g.23932516C>T-
NM_014363.6(SACS):c.559G>T (p.Val187Phe)26278SACSUncertain significancers1344578174RCV000814678|RCV001825636; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132393251923932519CA13:g.23932519C>A-
NM_014363.6(SACS):c.494C>T (p.Thr165Ile)26278SACSUncertain significancers1419027987RCV000712977|RCV001835937; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132393258423932584GANC_000013.10:g.23932584G>A-
NM_014363.6(SACS):c.482A>G (p.Asn161Ser)26278SACSUncertain significancers746069731RCV001289173|RCV001830106; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132393259623932596TC23932596-
NM_014363.6(SACS):c.475T>C (p.Tyr159His)26278SACSUncertain significancers1305721973RCV001221388|RCV001836169; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132393260323932603AG13:g.23932603A>G-
NM_014363.6(SACS):c.475T>G (p.Tyr159Asp)26278SACSLikely pathogenic-1RCV001843706; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132393260323932603AC23932603-
NM_014363.6(SACS):c.468_469insG (p.Tyr157fs)26278SACSLikely pathogenicrs1057516820RCV000409711; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132393260923932610AACNC_000013.10:g.23932609_23932610insCClinGen:CA16041657C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.447G>A (p.Ala149=)26278SACSConflicting interpretations of pathogenicityrs145681117RCV001113813|RCV001489166; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132393931523939315CT13:g.23939315C>T-
NM_014363.6(SACS):c.434C>G (p.Ser145Ter)26278SACSPathogenic/Likely pathogenicrs994374354RCV000819151|RCV000992789|RCV001785730; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132393932823939328GC13:g.23939328G>C-
NM_014363.6(SACS):c.432G>T (p.Trp144Cys)26278SACSUncertain significancers368570790RCV000804533|RCV000995043|RCV001277274; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132393933023939330CA13:g.23939330C>A-
NM_014363.6(SACS):c.396A>G (p.Leu132=)26278SACSLikely benignrs1256540997RCV000866363|RCV001272280; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132393936623939366TC13:g.23939366T>C-
NM_014363.6(SACS):c.382_383del (p.Glu128fs)26278SACSPathogenic/Likely pathogenicrs757179309RCV001062044|RCV001289169|RCV001785775; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132393937923939380TTCT13:g.23939379_23939380del-
NM_014363.6(SACS):c.346-3T>A26278SACSUncertain significancers186506382RCV000457852|RCV001828484; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132393941923939419ATNC_000013.10:g.23939419A>TClinGen:CA6912110C0037772 Spastic paraplegia;
NM_014363.6(SACS):c.345+14C>T26278SACSUncertain significancers538944334RCV000359589; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132394252723942527GANC_000013.10:g.23942527G>AClinGen:CA6912122C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.262C>T (p.Arg88Ter)26278SACSPathogenicrs1555255676RCV000677658|RCV001816685; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202132394262423942624GA13:g.23942624G>A-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.247T>C (p.Leu83=)26278SACSUncertain significancers1470292816RCV000712968|RCV001825424; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132394522923945229AGNC_000013.10:g.23945229A>G-
NM_014363.6(SACS):c.175T>A (p.Ser59Thr)26278SACSUncertain significancers539836931RCV001043293|RCV001759750|RCV001784587; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132394530123945301AT13:g.23945301A>T-
NM_014363.6(SACS):c.171+13C>T26278SACSConflicting interpretations of pathogenicityrs374672041RCV000250510|RCV000393585|RCV001566241|RCV002058247; NMedGen:CN169374|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132394924523949245GA13:g.23949245G>AClinGen:CA6912178CN169374 not specified;
NM_014363.6(SACS):c.171+6C>T26278SACSBenign/Likely benignrs3751368RCV000242640|RCV000300554|RCV000676377|RCV001521433; NMedGen:CN169374|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132394925223949252GA13:g.23949252G>AClinGen:CA6912180CN517202 not provided;
NM_014363.6(SACS):c.169G>C (p.Glu57Gln)26278SACSUncertain significancers1021024627RCV001113814; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132394926023949260CG13:g.23949260C>G-
NM_014363.6(SACS):c.159C>G (p.Arg53=)26278SACSLikely benignrs968138431RCV000869629|RCV001272281|RCV001470967; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132394927023949270GC13:g.23949270G>C-
NM_014363.6(SACS):c.151C>T (p.Leu51=)26278SACSConflicting interpretations of pathogenicityrs979224977RCV000865792|RCV001113815; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132394927823949278GA13:g.23949278G>A-
NM_014363.6(SACS):c.141G>A (p.Ser47=)26278SACSUncertain significancers1593160882RCV000802602|RCV001830733; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132394928823949288CT13:g.23949288C>T-
NM_014363.6(SACS):c.134C>T (p.Pro45Leu)26278SACSUncertain significancers1033188876RCV000518000|RCV001835834; NMedGen:CN169374|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132394929523949295GA13:g.23949295G>AClinGen:CA13805936CN169374 not specified;
NM_014363.6(SACS):c.110G>A (p.Arg37His)26278SACSUncertain significancers866539724RCV000522808|RCV001834696; NMedGen:CN517202|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132394931923949319CTNC_000013.10:g.23949319C>TClinGen:CA387554542
NM_014363.6(SACS):c.99T>C (p.Asp33=)26278SACSConflicting interpretations of pathogenicityrs775206528RCV000355437|RCV001083423|RCV000863241|RCV001288381; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MedGen:CN517202|MedGen:CN169374132394933023949330AGNC_000013.10:g.23949330A>GClinGen:CA6912185C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.83C>T (p.Ser28Phe)26278SACSUncertain significancers1365453773RCV000633012|RCV001835012; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132394934623949346GANC_000013.10:g.23949346G>AClinGen:CA387554637C0037772 Spastic paraplegia;
NM_014363.6(SACS):c.60C>T (p.Cys20=)26278SACSConflicting interpretations of pathogenicityrs932552006RCV001109790|RCV001462819; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|Human Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772132394936923949369GA13:g.23949369G>A-
NM_014363.6(SACS):c.51C>T (p.Cys17=)26278SACSLikely benignrs763979020RCV000863921|RCV001272282; NHuman Phenotype Ontology:HP:0001258,Human Phenotype Ontology:HP:0007062,Human Phenotype Ontology:HP:0007124,Human Phenotype Ontology:HP:0007216,MedGen:C0037772|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132394937823949378GA13:g.23949378G>A-
NM_014363.6(SACS):c.47G>T (p.Gly16Val)26278SACSUncertain significancers886050090RCV000260394|RCV000712975; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202132394938223949382CANC_000013.10:g.23949382C>AClinGen:CA10643120C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.29del (p.Pro10fs)26278SACSLikely pathogenicrs1057516837RCV000409439; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132394940023949400CGC13:g.23949400_23949400delClinGen:CA16041658C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.25G>A (p.Val9Ile)26278SACSUncertain significancers939705811RCV001333046; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132394940423949404CT23949404-
NM_014363.6(SACS):c.2T>C (p.Met1Thr)26278SACSLikely pathogenicrs1417057515RCV000666635; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132398537723985377AG13:g.23985377A>G-C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.1A>G (p.Met1Val)26278SACSLikely pathogenicrs771943685RCV000409645; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132398537823985378TCNC_000013.10:g.23985378T>CClinGen:CA6912209C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.-13A>G26278SACSBenign/Likely benignrs17078720RCV000248762|RCV000315880|RCV001618448; NMedGen:CN169374|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202132398539123985391TCNC_000013.10:g.23985391T>CClinGen:CA6912215CN169374 not specified;
NM_014363.6(SACS):c.-59C>A26278SACSUncertain significancers150561537RCV000370452; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132398543723985437GTNC_000013.10:g.23985437G>TClinGen:CA10634082C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.-70G>A26278SACSUncertain significancers575970347RCV000275839; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132398544823985448CTNC_000013.10:g.23985448C>TClinGen:CA10644044C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.-173C>A26278SACSUncertain significancers139517739RCV000330947; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132398555123985551GTNC_000013.10:g.23985551G>TClinGen:CA10639249C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.-219A>G26278SACSConflicting interpretations of pathogenicityrs74495070RCV000385634|RCV001559393; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN517202132398559723985597TC13:g.23985597T>CClinGen:CA10643121C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.-331A>C26278SACSUncertain significancers560626127RCV000291246; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132398570923985709TG13:g.23985709T>GClinGen:CA10634085C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.-367C>A26278SACSUncertain significancers145469796RCV000327697; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132398574523985745GT13:g.23985745G>TClinGen:CA10643125C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.-470C>T26278SACSUncertain significancers748973703RCV000382222; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132398584823985848GA13:g.23985848G>AClinGen:CA10643128C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.-489G>A26278SACSUncertain significancers886050091RCV000287898; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132398586723985867CT13:g.23985867C>TClinGen:CA10634087C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_014363.6(SACS):c.-502+2T>G26278SACSUncertain significancers1874525003RCV001110577; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132400775224007752AC13:g.24007752A>C-
NM_014363.6(SACS):c.-531G>A26278SACSUncertain significancers73154650RCV000342904; NMONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132400778324007783CT13:g.24007783C>TClinGen:CA10643132C1849140 270550 Spastic ataxia Charlevoix-Saguenay type;
NM_000231.3(SGCG):c.860A>G (p.Asn287Ser)-1SACS;SGCGBenignrs1800354RCV000153942|RCV000348757|RCV000988963; NMedGen:CN169374|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MONDO:MONDO:0009677,MedGen:C0410173,OMIM:253700, Orphanet:353132389866423898664AG13:g.23898664A>GClinGen:CA180430CN169374 not specified;
NM_000231.3(SGCG):c.*13C>T-1SACS;SGCGBenign/Likely benignrs9510701RCV000078402|RCV000304530|RCV000398630|RCV000393997|RCV001114521; NMedGen:CN169374|MedGen:CN239352|MONDO:MONDO:0009677,MedGen:C0410173,OMIM:253700, Orphanet:353|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MONDO:MONDO:0016140,MedGen:C2936331, Orphanet:207052132389869323898693CT13:g.23898693C>TClinGen:CA145896CN239352 Limb-Girdle Muscular Dystrophy, Recessive;
NM_000231.3(SGCG):c.*254G>A-1SACS;SGCGBenign/Likely benignrs3751371RCV000315861|RCV000372732|RCV000354144|RCV000394244|RCV001111245|RCV001642891; NMONDO:MONDO:0009677,MedGen:C0410173,OMIM:253700, Orphanet:353|MedGen:CN239352|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN169374|MONDO:MONDO:0016140,MedGen:C2936331, Orphanet:207052|MedGen:CN517202132389893423898934GA13:g.23898934G>AClinGen:CA10606084CN239352 Limb-Girdle Muscular Dystrophy, Recessive;
NM_000231.3(SGCG):c.*295T>C-1SACS;SGCGBenign/Likely benignrs3829352RCV000261794|RCV000319133|RCV000391543|RCV001111247|RCV001653527; NMONDO:MONDO:0009677,MedGen:C0410173,OMIM:253700, Orphanet:353|MedGen:CN239352|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MONDO:MONDO:0016140,MedGen:C2936331, Orphanet:207052|MedGen:CN517202132389897523898975TCNC_000013.10:g.23898975T>CClinGen:CA10639182CN239352 Limb-Girdle Muscular Dystrophy, Recessive;
NM_014363.6(SACS):c.*1046CTTTA[1]-1SACS;SGCGLikely benignrs66920661RCV000305184|RCV000359875|RCV000400201; NMONDO:MONDO:0009677,MedGen:C0410173,OMIM:253700, Orphanet:353|MedGen:CN239352|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390322023903224TTAAAGT13:g.23903220_23903224delClinGen:CA10634034CN239352 Limb-Girdle Muscular Dystrophy, Recessive;
NM_014363.6(SACS):c.*677C>T-1SACS;SGCGLikely benignrs200375761RCV000265271|RCV000320434|RCV000391991; NMedGen:CN239352|MONDO:MONDO:0009677,MedGen:C0410173,OMIM:253700, Orphanet:353|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98132390359823903598GA13:g.23903598G>AClinGen:CA6909895CN239352 Limb-Girdle Muscular Dystrophy, Recessive;
NM_014363.6(SACS):c.*484T>C-1SACS;SGCGLikely benignrs4770433RCV000271293|RCV000315525|RCV000365800; NMedGen:CN239352|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MONDO:MONDO:0009677,MedGen:C0410173,OMIM:253700, Orphanet:353132390379123903791AG13:g.23903791A>GClinGen:CA10639216CN239352 Limb-Girdle Muscular Dystrophy, Recessive;
NM_000231.3(SGCG):c.705T>C (p.Leu235=)-1SGCG;SACSBenign/Likely benignrs1800353RCV000078407|RCV000293880|RCV000278365|RCV000373060|RCV000710216|RCV001113157; NMedGen:CN169374|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN239352|MONDO:MONDO:0009677,MedGen:C0410173,OMIM:253700, Orphanet:353|MedGen:CN517202|MONDO:MONDO:0016140,MedGen:C2936331, Orphanet:207052132389850923898509TC13:g.23898509T>CClinGen:CA145907CN239352 Limb-Girdle Muscular Dystrophy, Recessive;
NM_000231.3(SGCG):c.*136T>C-1SGCG;SACSBenign/Likely benignrs3751372RCV000273729|RCV000299676|RCV000312413|RCV001110485|RCV001683256; NMONDO:MONDO:0009677,MedGen:C0410173,OMIM:253700, Orphanet:353|MONDO:MONDO:0010041,MedGen:C1849140,OMIM:270550, Orphanet:98|MedGen:CN239352|MONDO:MONDO:0016140,MedGen:C2936331, Orphanet:207052|MedGen:CN517202132389881623898816TCNC_000013.10:g.23898816T>CClinGen:CA10634033CN239352 Limb-Girdle Muscular Dystrophy, Recessive;
MSeqDR Portal