MSeqDR Mitochondrial Disease Portal


 
*:HP: HPO terms, UMDF: 1= Disease, ND: NAMDC terms.
  Most Studied  CPEO, Complex I Deficiency, COXPD1, Leigh, LHON, MELAS, MERRF, Myopathy, SANDO
Disease Browser
Parent Node:
expand
Ophthalmoplegia (D009886)
..Starting node
..expand
Progressive External Ophthalmoplegia with Mitochondrial DNA Deletions, Autosomal Recessive (C564926)

       Child Nodes:



 Sister Nodes: 
..expandAdenine Nucleotide Translocator Deficiency (C566309)
..expandARTHROGRYPOSIS, PERTHES DISEASE, AND UPWARD GAZE PALSY (OMIM:614262)
..expandCANOMAD syndrome (C537980)
..expandCongenital Fibrosis of the Extraocular Muscles (C580012)
..expandExternal Ophthalmoplegia, Synergistic Divergence, Jaw Winking, and Oculocutaneous Hypopigmentation (C566509)
..expandFibrosis Of Extraocular Muscles, Congenital, 2 (C566587)
..expandHamano Tsukamoto syndrome (C535625)
..expandInclusion Body Myopathy 3, Autosomal Dominant (C565311)
..expandInclusion body myopathy, autosomal dominant (C538330)
..expandMinicore Myopathy with External Ophthalmoplegia (C564969)
..expandMotor Neuron Disease with Dementia and Ophthalmoplegia (C563954)
..expandOcular Myopathy with Curare Sensitivity (C564937)
..expandOculomelic amyoplasia (C537737)
..expandOculootoradial syndrome (C535544)
..expandOphthalmoplegia Totalis with Ptosis and Miosis (C564927)
..expandOphthalmoplegia, Chronic Progressive External (D017246) Child7  LSDB C:5
..expandOphthalmoplegia, External, and Myopia (C564087)
..expandOphthalmoplegia, Familial Static (C563500)
..expandOphthalmoplegia, Familial Total, with Iris Transillumination (C563499)
..expandOphthalmoplegia, Progressive, with Scrotal Tongue and Mental Deficiency (C563498)
..expandOphthalmoplegic Migraine (D060486)
..expandOphthalmoplegic Neuromuscular Disorder with Abnormal Mitochondria (C564925)
..expandOptic Atrophy, Deafness, Ophthalmoplegia, and Myopathy (C565117)
..expandProgressive External Ophthalmoplegia With Hypogonadism (C563576)
..expandPROGRESSIVE EXTERNAL OPHTHALMOPLEGIA WITH MITOCHONDRIAL DNA DELETIONS, AUTOSOMAL DOMINANT 6 (OMIM:615156)  LSDB  L: 00050;
..expandProgressive External Ophthalmoplegia with Mitochondrial DNA Deletions, Autosomal Dominant, 1 (C563575)  LSDB  L: 00117;
..expandProgressive External Ophthalmoplegia with Mitochondrial DNA Deletions, Autosomal Recessive (C564926)  LSDB  L: 00118;
..expandPROGRESSIVE EXTERNAL OPHTHALMOPLEGIA WITH MITOCHONDRIAL DNA DELETIONS, AUTOSOMAL RECESSIVE 2 (OMIM:616479)  LSDB  L: 00534;
..expandPROGRESSIVE EXTERNAL OPHTHALMOPLEGIA WITH MITOCHONDRIAL DNA DELETIONS, AUTOSOMAL RECESSIVE 3 (OMIM:617069)  LSDB  L: 00510;
..expandPROGRESSIVE EXTERNAL OPHTHALMOPLEGIA WITH MITOCHONDRIAL DNA DELETIONS, AUTOSOMAL RECESSIVE 4 (OMIM:617070)  LSDB  L: 00535;
..expandSchimke X-linked mental retardation syndrome (C536630)
..expandSensory ataxic neuropathy, dysarthria, and ophthalmoparesis (C537583)  LSDB  L: 00042;
..expandSupranuclear Palsy, Progressive (D013494) Child5
..expandTreft Sanborn Carey syndrome (C536544)
..expandWieacker syndrome (C536703)
   

Human Disease MESH is developed by UMLS.
Further data from MedGen, OMIM,ClinVar, CTD
Term ID:10262
Name:Progressive External Ophthalmoplegia with Mitochondrial DNA Deletions, Autosomal Recessive
Definition:
Alternative IDs:OMIM:258450
ParentIDs:MESH:D009886
TreeNumbers:C10.292.562.750/C564926 |C10.597.622.447/C564926 |C11.590.472/C564926 |C23.888.592.636.447/C564926
Synonyms:PEOB1 |Progressive External Ophthalmoplegia, Autosomal Recessive |PROGRESSIVE EXTERNAL OPHTHALMOPLEGIA, AUTOSOMAL RECESSIVE 1 |PROGRESSIVE EXTERNAL OPHTHALMOPLEGIA WITH MITOCHONDRIAL DNA DELETIONS, AUTOSOMAL RECESSIVE 1
Slim Mappings:Eye disease|Nervous system disease|Signs and symptoms
Reference: MedGen: C564926
MeSH: C564926
OMIM: 258450;
MSeqDR LSDB: 00118;  
Genes: POLG;
Phenotypes
1 HP:0000007Autosomal recessive inheritance
2 HP:0003581Adult onsetHP:0040282
3 HP:0001284Areflexia
4 HP:0002067Bradykinesia
5 HP:0001638CardiomyopathyHP:0040283
6 HP:0003688Cytochrome C oxidase-negative muscle fibers
7 HP:0000716Depressivity
NAMDC:  Depression
8 HP:0002460Distal muscle weakness
NAMDC:  Muscle weakness: distal
9 HP:0001260Dysarthria
NAMDC:  Dysarthria
10 HP:0007641DyschromatopsiaHP:0040283
11 HP:0002015Dysphagia
NAMDC:  Dysphagia
12 HP:0001618Dysphonia
13 HP:0003458EMG: myopathic abnormalities
14 HP:0000712Emotional lability
15 HP:0003546Exercise intolerance
NAMDC:  Exercise intolerance
16 HP:0010628Facial palsy
17 HP:0002066Gait ataxia
18 HP:0003700Generalized amyotrophy
19 HP:0001265Hyporeflexia
20 HP:0006858Impaired distal proprioception
21 HP:0006886Impaired distal vibration sensation
22 HP:0002922Increased CSF protein
23 HP:0003557Increased variability in muscle fiber diameter
24 HP:0002070Limb ataxia
25 HP:0008180Mildly elevated creatine phosphokinase
26 HP:0003737Mitochondrial myopathy
27 HP:0001653Mitral regurgitation
28 HP:0001634Mitral valve prolapse
29 HP:0003689Multiple mitochondrial DNA deletions
30 HP:0003713Muscle fiber necrosis
31 HP:0000648Optic atrophyHP:0040283
32 HP:0001300Parkinsonism
NAMDC:  Parkinsonism
33 HP:0001761Pes cavus
34 HP:0003812Phenotypic variability
35 HP:0002403Positive Romberg sign
36 HP:0000590Progressive external ophthalmoplegia
37 HP:0003701Proximal muscle weakness
NAMDC:  Muscle weakness: proximal
38 HP:0000508Ptosis
NAMDC:  Ptosis
39 HP:0003200Ragged-red muscle fibers
40 HP:0002747Respiratory insufficiency due to muscle weakness
41 HP:0002063Rigidity
42 HP:0003434Sensory ataxic neuropathy
43 HP:0003390Sensory axonal neuropathy
44 HP:0003376Steppage gait
45 HP:0003548Subsarcolemmal accumulations of abnormally shaped mitochondria
46 HP:0000505Visual impairmentHP:0040283
Disease Causing ClinVar Variants
Variation_NameGeneIDGeneSymbolClinicalSignificancedbSNPRCVaccessionTestedInGTRPhenotypeIDsChromosomeStartStopHGVS_cHGVS_pHGVS_gOtherIDsDisease_ClinVar
NM_002693.3(POLG):c.3483-19T>G5428POLGBenignrs2307438RCV000127543|RCV000758550|RCV001711294|RCV001789187|RCV001789188|RCV001789189|RCV001789190; NMedGen:CN169374|MONDO:MONDO:0008758,MedGen:C0205710,OMIM:203700, Orphanet:726|MedGen:CN517202|MONDO:MONDO:0011835,MedGen:C1843851,OMIM:607459, Orphanet:70595|MONDO:MONDO:0024528,MedGen:C1834846,OMIM:157640|MONDO:MONDO:0009783,MedGen:C4225153,OMIM:258450,O158986078689860786ACNC_000015.9:g.89860786A>CClinGen:CA292852CN169374 not specified;
NM_002693.3(POLG):c.3482+6C>T5428POLGConflicting interpretations of pathogenicityrs55779802RCV000127539|RCV000316461|RCV000559092|RCV000726414|RCV000768049|RCV001847754; NMedGen:CN169374|MedGen:C4763519|MONDO:MONDO:0008758,MedGen:C0205710,OMIM:203700, Orphanet:726|MedGen:CN517202|MONDO:MONDO:0024528,MedGen:C1834846,OMIM:157640; MONDO:MONDO:0009783,MedGen:C4225153,OMIM:258450, Orphanet:254886; MONDO:MONDO:0008758,MedGen:C0205158986176689861766GANC_000015.9:g.89861766G>AClinGen:CA292847CN169374 not specified;
NM_002693.3(POLG):c.3105-36A>G5428POLGBenignrs2246900RCV000758547|RCV001789365|RCV001672951|RCV001789366|RCV001789367|RCV001789368; NMONDO:MONDO:0008758,MedGen:C0205710,OMIM:203700, Orphanet:726|MONDO:MONDO:0011835,MedGen:C1843851,OMIM:607459, Orphanet:70595|MedGen:CN517202|MONDO:MONDO:0024528,MedGen:C1834846,OMIM:157640|MONDO:MONDO:0009783,MedGen:C4225153,OMIM:258450, Orphanet:254886|M158986236689862366TCNC_000015.9:g.89862366T>C-
NM_002693.3(POLG):c.3037G>T (p.Asp1013Tyr)5428POLGUncertain significancers1307399071RCV000497709|RCV000633536|RCV001332168; NMedGen:CN517202|MONDO:MONDO:0008758,MedGen:C0205710,OMIM:203700, Orphanet:726|MONDO:MONDO:0009783,MedGen:C4225153,OMIM:258450, Orphanet:254886158986252689862526CA15:g.89862526C>AClinGen:CA393751388CN169374 not specified;
NM_002693.3(POLG):c.2857C>T (p.Arg953Cys)5428POLGConflicting interpretations of pathogenicityrs11546842RCV000175301|RCV000758266|RCV001808449; NMedGen:CN517202|MONDO:MONDO:0008758,MedGen:C0205710,OMIM:203700, Orphanet:726|MONDO:MONDO:0009783,MedGen:C4225153,OMIM:258450, Orphanet:254886158986412189864121GA15:g.89864121G>AClinGen:CA241026,UniProtKB:P54098#VAR_023681CN169374 not specified;
NM_002693.3(POLG):c.2601T>C (p.Pro867=)5428POLGConflicting interpretations of pathogenicityrs201749977RCV000127526|RCV000403402|RCV000709782|RCV000734626|RCV001457683; NMedGen:CN169374|MedGen:C4763519|MONDO:MONDO:0024528,MedGen:C1834846,OMIM:157640; MONDO:MONDO:0009783,MedGen:C4225153,OMIM:258450, Orphanet:254886; MONDO:MONDO:0008758,MedGen:C0205710,OMIM:203700, Orphanet:726; MONDO:MONDO:0011835,MedGen:C1843851,OMIM:607459,158986448989864489AGNC_000015.9:g.89864489A>GClinGen:CA292834CN169374 not specified;
NM_002693.3(POLG):c.2557C>T (p.Arg853Trp)5428POLGUncertain significancers121918053RCV000014466|RCV000560575|RCV001449754; NMONDO:MONDO:0009783,MedGen:C4225153,OMIM:258450, Orphanet:254886|MONDO:MONDO:0008758,MedGen:C0205710,OMIM:203700, Orphanet:726|MedGen:CN169374158986500889865008GA15:g.89865008G>AClinGen:CA256899,UniProtKB:P54098#VAR_058889,OMIM:174763.0018C1850303 258450 Cerebellar ataxia infantile with progressive external ophthalmoplegia;
NM_002693.3(POLG):c.2542G>A (p.Gly848Ser)5428POLGPathogenicrs113994098RCV000014449|RCV000014450|RCV000014451|RCV000014452|RCV000188580|RCV000509449|RCV000363602|RCV000515163|RCV000678386|RCV001027839|RCV000717974|RCV002054437|RCV001847601; NMONDO:MONDO:0009783,MedGen:C4225153,OMIM:258450, Orphanet:254886|MedGen:C1868097|MONDO:MONDO:0008758,MedGen:C0205710,OMIM:203700, Orphanet:726|MONDO:MONDO:0013350,MedGen:C3150914,OMIM:613662, Orphanet:298|MedGen:CN517202||MedGen:C4763519|6 conditions|MONDO158986502389865023CT15:g.89865023C>TClinGen:CA123144,UniProtKB:P54098#VAR_023675,OMIM:174763.0006C1834846 157640 Autosomal dominant progressive external ophthalmoplegia with mitochondrial DNA deletions 1;
NM_002693.3(POLG):c.2419C>T (p.Arg807Cys)5428POLGConflicting interpretations of pathogenicityrs769827124RCV000261805|RCV000547242|RCV000626194|RCV000678828|RCV001263147; NMedGen:CN517202|MONDO:MONDO:0008758,MedGen:C0205710,OMIM:203700, Orphanet:726|MONDO:MONDO:0009783,MedGen:C4225153,OMIM:258450, Orphanet:254886||MONDO:MONDO:0011835,MedGen:C1843851,OMIM:607459, Orphanet:70595158986598089865980GA15:g.89865980G>AClinGen:CA7724495,UniProtKB:P54098#VAR_058887C1850303 258450 Cerebellar ataxia infantile with progressive external ophthalmoplegia;
NM_002693.3(POLG):c.2209G>C (p.Gly737Arg)5428POLGPathogenic/Likely pathogenicrs121918054RCV000014467|RCV000188568|RCV000370280|RCV000233045|RCV000508744|RCV000720676|RCV001004601|RCV000768053|RCV001813987|RCV001847605; NMONDO:MONDO:0009783,MedGen:C4225153,OMIM:258450, Orphanet:254886|MedGen:CN517202|MedGen:C4763519|MONDO:MONDO:0008758,MedGen:C0205710,OMIM:203700, Orphanet:726|MONDO:MONDO:0044970,MedGen:C0751651, Orphanet:68380|Human Phenotype Ontology:HP:0001250,Human Phe158986669189866691CG15:g.89866691C>GClinGen:CA201029,UniProtKB:P54098#VAR_058885,OMIM:174763.0019C1850303 258450 Cerebellar ataxia infantile with progressive external ophthalmoplegia;
NM_002693.3(POLG):c.2071-22T>C5428POLGBenignrs2072267RCV000758397|RCV001595039|RCV001789363|RCV001789361|RCV001789362|RCV001789364; NMONDO:MONDO:0008758,MedGen:C0205710,OMIM:203700, Orphanet:726|MedGen:CN517202|MONDO:MONDO:0009783,MedGen:C4225153,OMIM:258450, Orphanet:254886|MONDO:MONDO:0011835,MedGen:C1843851,OMIM:607459, Orphanet:70595|MONDO:MONDO:0024528,MedGen:C1834846,OMIM:157640|M158986715489867154AGNC_000015.9:g.89867154A>G-
NM_002693.3(POLG):c.1808T>C (p.Met603Thr)5428POLGConflicting interpretations of pathogenicityrs367610201RCV000188667|RCV001348402|RCV001814096|RCV001847837; NMedGen:CN517202|MONDO:MONDO:0008758,MedGen:C0205710,OMIM:203700, Orphanet:726|MONDO:MONDO:0008758,MedGen:C0205710,OMIM:203700, Orphanet:726; MONDO:MONDO:0011835,MedGen:C1843851,OMIM:607459, Orphanet:70595; MONDO:MONDO:0009783,MedGen:C4225153,OMIM:258450,Orph158986882289868822AGNC_000015.9:g.89868822A>GClinGen:CA316846CN517202 not provided;
NM_002693.3(POLG):c.1760C>T (p.Pro587Leu)5428POLGConflicting interpretations of pathogenicityrs113994096RCV000014456|RCV000020473|RCV000186576|RCV000193529|RCV000415307|RCV000508752|RCV000408293|RCV000427845|RCV000716826|RCV001004602|RCV001610290|RCV001642226|RCV001813986|RCV001813743|RCV001847603|RCV001770037; NMONDO:MONDO:0013350,MedGen:C3150914,OMIM:613662, Orphanet:298|MONDO:MONDO:0011283,MedGen:C4551995,OMIM:603041, Orphanet:298|MONDO:MONDO:0009783,MedGen:C4225153,OMIM:258450, Orphanet:254886|MedGen:CN169374|Human Phenotype Ontology:HP:0000754,Human Phenotype158986887089868870GA15:g.89868870G>AClinGen:CA123146,UniProtKB:P54098#VAR_023671,OMIM:174763.0011C1850303 258450 Cerebellar ataxia infantile with progressive external ophthalmoplegia;
NM_002693.3(POLG):c.1399G>A (p.Ala467Thr)5428POLGPathogenicrs113994095RCV000014440|RCV000014441|RCV000014442|RCV000014443|RCV000188658|RCV000184011|RCV000347876|RCV000515354|RCV000735201|RCV000720159|RCV000508942|RCV001198082|RCV001376079|RCV001004604|RCV001095683|RCV001813983|RCV001731286|RCV001847600; NMONDO:MONDO:0009783,MedGen:C4225153,OMIM:258450, Orphanet:254886|MONDO:MONDO:0011835,MedGen:C1843851,OMIM:607459, Orphanet:70595|MONDO:MONDO:0016809,MedGen:C1843852, Orphanet:254881|MONDO:MONDO:0008758,MedGen:C0205710,OMIM:203700, Orphanet:726|MedGen:CN5172158987043289870432CT15:g.89870432C>TClinGen:CA123140,UniProtKB:P54098#VAR_012155,OMIM:174763.0002C1834846 157640 Autosomal dominant progressive external ophthalmoplegia with mitochondrial DNA deletions 1;
NM_002693.3(POLG):c.915C>G (p.Ser305Arg)5428POLGPathogenic/Likely pathogenicrs769410130RCV000188649|RCV000758271|RCV000995844|RCV001332170; NMedGen:CN517202|MONDO:MONDO:0008758,MedGen:C0205710,OMIM:203700, Orphanet:726|MONDO:MONDO:0009783,MedGen:C4225153,OMIM:258450, Orphanet:254886|MONDO:MONDO:0024528,MedGen:C1834846,OMIM:157640158987228289872282GC15:g.89872282G>CClinGen:CA316819CN517202 not provided;
NM_002693.3(POLG):c.911T>G (p.Leu304Arg)5428POLGPathogenic/Likely pathogenicrs121918044RCV000014444|RCV000188648|RCV000762954|RCV000626287|RCV001266602|RCV001813984; NMONDO:MONDO:0009783,MedGen:C4225153,OMIM:258450, Orphanet:254886|MedGen:CN517202|6 conditions|MONDO:MONDO:0008758,MedGen:C0205710,OMIM:203700, Orphanet:726|MeSH:D030342,MedGen:C0950123|Human Phenotype Ontology:HP:0012103,MedGen:C4023042158987228689872286AC15:g.89872286A>CClinGen:CA256883,UniProtKB:P54098#VAR_012154,OMIM:174763.0003C1850303 258450 Cerebellar ataxia infantile with progressive external ophthalmoplegia;
NM_002693.3(POLG):c.862C>T (p.Arg288Cys)5428POLGUncertain significancers564582352RCV000188646|RCV000768290|RCV000806434; NMedGen:CN517202|MONDO:MONDO:0008758,MedGen:C0205710,OMIM:203700, Orphanet:726; MONDO:MONDO:0011835,MedGen:C1843851,OMIM:607459, Orphanet:70595; MONDO:MONDO:0024528,MedGen:C1834846,OMIM:157640; MONDO:MONDO:0009783,MedGen:C4225153,OMIM:258450, Orphanet:254886; M158987233589872335GANC_000015.9:g.89872335G>AClinGen:CA316815CN169374 not specified;
NM_002693.3(POLG):c.752C>T (p.Thr251Ile)5428POLGConflicting interpretations of pathogenicityrs113994094RCV000014448|RCV000014447|RCV000020484|RCV000184009|RCV000188641|RCV000194055|RCV000262479|RCV000415105|RCV000716828|RCV001004407|RCV001678594|RCV001642225|RCV001813742|RCV001813985|RCV001847602|RCV001770036; NMONDO:MONDO:0013350,MedGen:C3150914,OMIM:613662, Orphanet:298|MONDO:MONDO:0009783,MedGen:C4225153,OMIM:258450, Orphanet:254886|MONDO:MONDO:0011283,MedGen:C4551995,OMIM:603041, Orphanet:298|MONDO:MONDO:0008758,MedGen:C0205710,OMIM:203700, Orphanet:726|MedGen158987341589873415GA15:g.89873415G>AClinGen:CA123142,UniProtKB:P54098#VAR_023664,OMIM:174763.0007C1850303 258450 Cerebellar ataxia infantile with progressive external ophthalmoplegia;
NM_002693.3(POLG):c.67_88del (p.Gly23fs)5428POLGPathogenic/Likely pathogenicrs2055630470RCV001264386|RCV001388404; NMONDO:MONDO:0009783,MedGen:C4225153,OMIM:258450, Orphanet:254886|MONDO:MONDO:0008758,MedGen:C0205710,OMIM:203700, Orphanet:726158987689889876919ACGGAGCTGGAGACCCAGCGCCCA15:g.89876898_89876919del-
NM_002693.3(POLG):c.8G>C (p.Arg3Pro)5428POLGPathogenicrs121918045RCV000014445; NMONDO:MONDO:0009783,MedGen:C4225153,OMIM:258450, Orphanet:254886158987697889876978CG15:g.89876978C>GClinGen:CA256885,UniProtKB:P54098#VAR_012153,OMIM:174763.0004C1850303 258450 Cerebellar ataxia infantile with progressive external ophthalmoplegia;
MSeqDR Portal
Ensembl Gene IDAssociated Gene NameLSDB GenesLSDB VariantsclinVar hitsDescriptionDisease id
ENSG00000140521 MSeqDR Search EnsemblPOLG1820polymerase (DNA directed), gamma [Source:HGNC Symbol;Acc:9179]00118

*Click on gene and variants to check details. Or view all variants in new page