MSeqDR Mitochondrial Disease Portal


 
*:HP: HPO terms, UMDF: 1= Disease, ND: NAMDC terms.
  Most Studied  CPEO, Complex I Deficiency, COXPD1, Leigh, LHON, MELAS, MERRF, Myopathy, SANDO
Disease Browser
Parent Node:
expand
Muscular Diseases (D009135)
..Starting node
..expand
Myopathies, Structural, Congenital (D020914)

       Child Nodes:
........expandActin-Accumulation Myopathy (C579880)
........expandCap Myopathy (C579969)
........expandMinicore Myopathy with External Ophthalmoplegia (C564969)
........expandMyofibrillar Myopathy (C580316) Child1
........expandMyopathies, Nemaline (D017696) Child9
........expandMyopathy, Central Core (D020512) Child3
........expandMyopathy, Centronuclear, Autosomal Recessive (C562934)
........expandMyopathy, Congenital, With Fiber-Type Disproportion, X-Linked (C567594)
........expandMyopathy, Myofibrillar, Bag3-Related (C567843)
........expandMyosclerosis, Autosomal Recessive (C564968)
........expandMyotilinopathy (C563775)
........expandMyotubular Myopathy with Abnormal Genital Development (C564561)
........expandPleoconial Myopathy with Salt Craving (C564883)
........expandSpheroid body myopathy (C000598645)



 Sister Nodes: 
..expandAlpha-B Crystallinopathy (C563848)
..expandAnal Sphincter Myopathy, Internal (C566287)
..expandAplasia of Extensor Muscles of Fingers, Unilateral, with Generalized Polyneuropathy (C565945)
..expandArthrogryposis (D001176) Child55
..expandCamptodactyly, fibrous tissue hyperplasia, and skeletal dysplasia (C537974)
..expandCarnitine Palmitoyltransferase II Deficiency, Late-Onset (C563461)  LSDB  L: 00486;
..expandChanarin-Dorfman Syndrome (C536560)
..expandCompartment Syndromes (D003161) Child3
..expandContracture (D003286) Child41
..expandCraniomandibular Disorders (D017271) Child4
..expandDimauro disease (C536176)
..expandEHLERS-DANLOS SYNDROME, KYPHOSCOLIOTIC TYPE, 2 (OMIM:614557)
..expandEncephalopathy, Axonal, with Necrotizing Myopathy, Cardiomyopathy, and Cataracts (C565596)
..expandEosinophilia-Myalgia Syndrome (D016603)
..expandEpiphyseal Dysplasia, Multiple, with Myopathy (C563420)
..expandErythrocyte Amp Deaminase Deficiency (C567878)
..expandErythrocyte Lactate Transporter Defect (C565449)
..expandFatigue Syndrome, Chronic (D015673)
..expandFibromyalgia (D005356)
..expandFingerprint Body Myopathy (C564425)
..expandHereditary Myopathy with Early Respiratory Failure (C566343)
..expandHypertrophia Musculorum Vera (C564152)
..expandIsaacs Syndrome (D020386)
..expandKocher-Debre-Semelaigne syndrome (C537211)
..expandMarinesco-Sjogren-like syndrome (MSLS) (C535913)
..expandMedial Tibial Stress Syndrome (D058923)
..expandMitochondrial DNA Depletion Syndrome, Myopathic Form (C563698)
..expandMitochondrial Myopathies (D017240) Child33  LSDB C:22 L: 00400;
..expandMuscle Cramp (D009120) Child3
..expandMUSCLE HYPERTROPHY (OMIM:614160)
..expandMuscle Neoplasms (D019042)
..expandMuscle Rigidity (D009127) Child3
..expandMuscle Spasticity (D009128) Child17
..expandMuscle Weakness (D018908) Child5  LSDB C:2
..expandMuscular Disorders, Atrophic (D020966) Child120  LSDB C:1
..expandMuscular Hypoplasia, Congenital Universal, of Krabbe (C563553)
..expandMusculoskeletal Pain (D059352) Child2
..expandMyalgia (D063806)
..expandMyofascial Pain Syndromes (D009209) Child1
..expandMyopathic carnitine deficiency (C536100)
..expandMyopathies, Structural, Congenital (D020914) Child34
..expandMyopathy due to Malate-Aspartate Shuttle Defect (C564973)
..expandMYOPATHY DUE TO MYOADENYLATE DEAMINASE DEFICIENCY (OMIM:615511)
..expandMyopathy with Giant Abnormal Mitochondria (C564971)
..expandMyopathy with Lactic Acidosis, Hereditary (C564972)  LSDB  L: 00476;
..expandMyopathy, Cataract, Hypogonadism Syndrome (C563578)
..expandMyopathy, congenital nonprogressive with Moebius and Robin sequences (C536102)
..expandMyopathy, Congenital, With Excess Of Muscle Spindles (C566896)
..expandMyopathy, Early-Onset, with Fatal Cardiomyopathy (C567129)
..expandMyopathy, Granulovacuolar Lobular, with Electrical Myotonia (C564974)
..expandMyopathy, Hyaline Body, Autosomal Recessive (C564970)
..expandMyopathy, Myosin Storage (C564253)
..expandMyopathy, Reducing Body, X-Linked, Childhood-Onset (C567468)
..expandMyopathy, Reducing Body, X-Linked, Early-Onset, Severe (C567469)
..expandMyopathy, X-Linked, with Excessive Autophagy (C564093)
..expandMyositis (D009220) Child16
..expandMyostatin-related muscle hypertrophy (C536106)
..expandMyotonic Disorders (D020967) Child10
..expandNeutral Lipid Storage Disease with Myopathy (C565192)
..expandOphthalmoplegic Neuromuscular Disorder with Abnormal Mitochondria (C564925)
..expandOptic Atrophy, Deafness, Ophthalmoplegia, and Myopathy (C565117)
..expandParalyses, Familial Periodic (D010245) Child7
..expandPectoralis Muscle, Absence of (C566793)
..expandPERIPHERAL NEUROPATHY, MYOPATHY, HOARSENESS, AND HEARING LOSS (OMIM:614369)
..expandPolymyalgia Rheumatica (D011111)
..expandProximal Myopathy with Focal Depletion of Mitochondria (C563453)
..expandRhabdomyolysis (D012206) Child6  LSDB C:2
..expandRippling muscle disease, 1 (C535686)
..expandSecretory Diarrhea, Myopathy, and Deafness (C564382)
..expandSingleton Merten syndrome (C537343)
..expandSystemic carnitine deficiency (C536778)  LSDB  L: 00473;
..expandTel Hashomer camptodactyly syndrome (C536953)
..expandTendinopathy (D052256) Child5
..expandTreft Sanborn Carey syndrome (C536544)
..expandUruguay Faciocardiomusculoskeletal Syndrome (C564544)
..expandVacuolar myopathy (C536522)
..expandVLCAD deficiency (C536353)  LSDB  L: 00436;
   

Human Disease MESH is developed by UMLS.
Further data from MedGen, OMIM,ClinVar, CTD
Term ID:8464
Name:Myopathies, Structural, Congenital
Definition:A heterogeneous group of diseases characterized by the early onset of hypotonia, developmental delay of motor skills, non-progressive weakness. Each of these disorders is associated with a specific histologic muscle fiber abnormality.
Alternative IDs:DO:DOID:14717|DO:DOID:422|OMIM:160150|OMIM:160565|OMIM:255200|OMIM:255310|OMIM:310400|OMIM:614408|OM
ParentIDs:MESH:D009135
TreeNumbers:C05.651.575 |C10.668.491.550
Synonyms:Aggregate Myopathies, Tubular |Aggregate Myopathy, Tubular |Autosomal Dominant Myotubular Myopathy |Autosomal Recessive Centronuclear Myopathy |Centronuclear Myopathies |Centronuclear Myopathies, X-Linked |Centronuclear Myopathy |Centronuclear Myopathy, X-Linke
Slim Mappings:Musculoskeletal disease|Nervous system disease
Reference: MedGen: D020914
MeSH: D020914
OMIM: 255200;
MSeqDR LSDB:  
Genes: ACTA1; BIN1; DNM2; MTM1; MTMR14; MYF6; SEPN1; STIM1; TPM3;
Phenotypes
1 HP:0000007Autosomal recessive inheritance
2 HP:0003674Onset
3 HP:0001284Areflexia
4 HP:0003327Axial muscle weakness
5 HP:0003687Centrally nucleated skeletal muscle fibers
6 HP:0002460Distal muscle weakness
NAMDC:  Muscle weakness: distal
7 HP:0001260Dysarthria
NAMDC:  Dysarthria
8 HP:0001618Dysphonia
9 HP:0003458EMG: myopathic abnormalities
10 HP:0010628Facial palsy
11 HP:0008872Feeding difficulties in infancy
12 HP:0001371Flexion contracture
13 HP:0003700Generalized amyotrophy
14 HP:0003391Gowers sign
15 HP:0000218High palateHP:0040283
16 HP:0003307Hyperlordosis
17 HP:0001256Intellectual disability, mildHP:0040283
18 HP:0002808Kyphosis
19 HP:0000276Long faceHP:0040283
20 HP:0001270Motor delay
21 HP:0001319Neonatal hypotonia
NAMDC:  Floppy baby
22 HP:0000602Ophthalmoplegia
23 HP:0001761Pes cavusHP:0040283
24 HP:0003701Proximal muscle weakness
NAMDC:  Muscle weakness: proximal
25 HP:0000508Ptosis
NAMDC:  Ptosis
26 HP:0002747Respiratory insufficiency due to muscle weaknessHP:0040283
27 HP:0003691Scapular wingingHP:0040283
28 HP:0002650Scoliosis
29 HP:0001762Talipes equinovarusHP:0040283
30 HP:0002515Waddling gait
Disease Causing ClinVar Variants
Variation_NameGeneIDGeneSymbolClinicalSignificancedbSNPRCVaccessionTestedInGTRPhenotypeIDsChromosomeStartStopHGVS_cHGVS_pHGVS_gOtherIDsDisease_ClinVar
NM_001320634.1(BIN1):c.*501G>A274BIN1Uncertain significancers77059199RCV000272775; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127805601127805601CT2:g.127805601C>TClinGen:CA10612163
NM_139343.3(BIN1):c.*479del274BIN1Uncertain significancers367627116RCV000330205; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127805623127805623ATA2:g.127805623_127805623delClinGen:CA10611111
NM_139343.3(BIN1):c.*470A>C274BIN1Uncertain significance-1RCV001132728; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127805632127805632TG2:g.127805632T>G-
NM_139343.3(BIN1):c.*449G>A274BIN1Uncertain significancers369704619RCV000368573; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127805653127805653CT2:g.127805653C>TClinGen:CA10611112
NM_139343.3(BIN1):c.*418C>T274BIN1Uncertain significance-1RCV001136139; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127805684127805684GA2:g.127805684G>A-
NM_139343.3(BIN1):c.*413G>A274BIN1Uncertain significancers886054829RCV000276421; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127805689127805689CT2:g.127805689C>TClinGen:CA10612028
NM_139343.3(BIN1):c.*303A>G274BIN1Uncertain significance-1RCV001136140; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127805799127805799TC2:g.127805799T>C-
NM_139343.3(BIN1):c.*301C>T274BIN1Uncertain significancers886054830RCV000334087; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127805801127805801GA2:g.127805801G>AClinGen:CA10612036
NM_139343.3(BIN1):c.*247G>T274BIN1Uncertain significance-1RCV001136141; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127805855127805855CA2:g.127805855C>A-
NM_139343.3(BIN1):c.*243T>G274BIN1Uncertain significancers886054831RCV000372371; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127805859127805859AC2:g.127805859A>CClinGen:CA10612168
NM_139343.3(BIN1):c.*214G>A274BIN1Uncertain significancers886054832RCV000280095; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127805888127805888CT2:g.127805888C>TClinGen:CA10611114
NM_139343.3(BIN1):c.*194C>T274BIN1Uncertain significancers565856632RCV000318845; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127805908127805908GA2:g.127805908G>AClinGen:CA10610710
NM_139343.3(BIN1):c.*82C>T274BIN1Uncertain significancers111649895RCV000375956; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127806020127806020GA2:g.127806020G>AClinGen:CA10611117
NM_139343.3(BIN1):c.*82C>A274BIN1Benign-1RCV001129155; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127806020127806020GT2:g.127806020G>T-
NM_139343.3(BIN1):c.*55G>A274BIN1Uncertain significancers886054833RCV000283741; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127806047127806047CT2:g.127806047C>TClinGen:CA10612169
NM_139343.3(BIN1):c.*22C>T274BIN1Uncertain significance-1RCV001129156; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127806080127806080GA2:g.127806080G>A-
NC_000002.11:g.(?_127806092)_(127834292_?)dup274BIN1Uncertain significance-1RCV000812689; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127806092127834292nana-
NM_139343.3(BIN1):c.*1C>T274BIN1Conflicting interpretations of pathogenicityrs770804438RCV000440299|RCV001129157; NMedGen:CN169374|MONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127806101127806101GA2:g.127806101G>AClinGen:CA1856922CN169374 not specified;
NM_139343.3(BIN1):c.1756G>A (p.Glu586Lys)274BIN1Uncertain significance-1RCV001248193; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127806128127806128CT2:g.127806128C>T-
NM_139343.3(BIN1):c.1747G>A (p.Val583Ile)274BIN1Uncertain significancers759691190RCV000702936; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127806137127806137CT2:g.127806137C>T-
NM_139343.3(BIN1):c.1741C>T (p.Arg581Cys)274BIN1Uncertain significancers147655157RCV000701208; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127806143127806143GA2:g.127806143G>A-
NM_139343.3(BIN1):c.1729C>G (p.Leu577Val)274BIN1Uncertain significancers771368114RCV000824428; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127806155127806155GC2:g.127806155G>C-
NM_139343.3(BIN1):c.1727A>T (p.Glu576Val)274BIN1Uncertain significancers775119768RCV000341221; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127806157127806157TA2:g.127806157T>AClinGen:CA1856931C0410204 255200 Autosomal recessive centronuclear myopathy;
NM_139343.3(BIN1):c.1723A>T (p.Lys575Ter)274BIN1Likely pathogenicrs121909275RCV000008797; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127806161127806161TA2:g.127806161T>AClinGen:CA119460,OMIM:601248.0003C0410204 255200 Autosomal recessive centronuclear myopathy;
NM_139343.3(BIN1):c.1713G>A (p.Trp571Ter)274BIN1Pathogenicrs587783343RCV000145341; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127806171127806171CT2:g.127806171C>TClinGen:CA171397
NM_139343.3(BIN1):c.1710C>G (p.Asp570Glu)274BIN1Uncertain significance-1RCV001064999; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127806174127806174GC2:g.127806174G>C-
NM_139343.3(BIN1):c.1708G>A (p.Asp570Asn)274BIN1Uncertain significancers368983991RCV000527268; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127806176127806176CT2:g.127806176C>TClinGen:CA55335014
NM_139343.3(BIN1):c.1675-7C>T274BIN1Uncertain significance-1RCV001129158; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127806216127806216GA2:g.127806216G>A-
NM_139343.3(BIN1):c.1629T>G (p.Ala543=)274BIN1Conflicting interpretations of pathogenicityrs143258043RCV000636916; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127808042127808042AC2:g.127808042A>CClinGen:CA1856963
NM_139343.3(BIN1):c.1625A>G (p.Lys542Arg)274BIN1Conflicting interpretations of pathogenicityrs138047593RCV000145339|RCV000553563; NMedGen:CN169374|MONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127808046127808046TC2:g.127808046T>CClinGen:CA171393C0410204 255200 Autosomal recessive centronuclear myopathy;
NM_139343.3(BIN1):c.1611C>T (p.Asp537=)274BIN1Benign/Likely benignrs142523172RCV000538787|RCV000609834; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:169186|MedGen:CN1693742127808060127808060GA2:g.127808060G>AClinGen:CA1856967
NM_139343.3(BIN1):c.1608A>G (p.Thr536=)274BIN1Likely benignrs746208232RCV000932638; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127808063127808063TC2:g.127808063T>C-
NM_139343.3(BIN1):c.1595C>T (p.Thr532Met)274BIN1Benign/Likely benignrs112318500RCV000145338|RCV000404410; NMedGen:CN169374|MONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127808076127808076GA2:g.127808076G>AClinGen:CA171391C0410204 255200 Autosomal recessive centronuclear myopathy;
NM_139343.3(BIN1):c.1588G>A (p.Asp530Asn)274BIN1Uncertain significancers772786604RCV000636910; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127808083127808083CT2:g.127808083C>TClinGen:CA1856972
NM_139343.3(BIN1):c.1577A>G (p.Gln526Arg)274BIN1Uncertain significancers886043878RCV000352599|RCV000660519; NMedGen:CN517202|MONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127808094127808094TC2:g.127808094T>CClinGen:CA10606068C0410204 255200 Autosomal recessive centronuclear myopathy;
NM_139343.3(BIN1):c.1548C>T (p.Asp516=)274BIN1Likely benignrs750869889RCV000929229; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127808402127808402GA2:g.127808402G>A-
NM_139343.3(BIN1):c.1541G>A (p.Arg514His)274BIN1Uncertain significancers766615886RCV000803312; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127808409127808409CT2:g.127808409C>T-
NM_139343.3(BIN1):c.1525G>A (p.Gly509Ser)274BIN1Uncertain significance-1RCV001232956; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127808425127808425CT2:g.127808425C>T-
NM_139343.3(BIN1):c.1515C>G (p.Thr505=)274BIN1Uncertain significancers375583449RCV000286271; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127808435127808435GC2:g.127808435G>CClinGen:CA10612037C0410204 255200 Autosomal recessive centronuclear myopathy;
NM_139343.3(BIN1):c.1479C>T (p.Val493=)274BIN1Uncertain significancers773313892RCV000343605; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127808471127808471GA2:g.127808471G>AClinGen:CA1857022C0410204 255200 Autosomal recessive centronuclear myopathy;
NM_139343.3(BIN1):c.1478T>C (p.Val493Ala)274BIN1Uncertain significance-1RCV001070741; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127808472127808472AG2:g.127808472A>G-
NM_139343.3(BIN1):c.1473T>C (p.Pro491=)274BIN1Conflicting interpretations of pathogenicityrs779756862RCV000406360; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127808477127808477AG2:g.127808477A>GClinGen:CA1857023C0410204 255200 Autosomal recessive centronuclear myopathy;
NM_139343.3(BIN1):c.1462-3C>T274BIN1Uncertain significancers200384643RCV000700693; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127808491127808491GA2:g.127808491G>A-C0410204 255200 Autosomal recessive centronuclear myopathy;
NM_139343.3(BIN1):c.1461C>T (p.Ser487=)274BIN1Uncertain significancers34647988RCV000145337; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127808730127808730GA2:g.127808730G>AClinGen:CA171389
NM_139343.3(BIN1):c.1460C>G (p.Ser487Cys)274BIN1Uncertain significance-1RCV001052649; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127808731127808731GC2:g.127808731G>C-
NM_139343.3(BIN1):c.1442C>T (p.Ala481Val)274BIN1Uncertain significancers140410496RCV000550351; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127808749127808749GA2:g.127808749G>AClinGen:CA1857053
NM_139343.3(BIN1):c.1439C>T (p.Thr480Met)274BIN1Uncertain significancers780918654RCV000535586; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127808752127808752GA2:g.127808752G>AClinGen:CA1857055
NM_139343.3(BIN1):c.1412C>T (p.Ala471Val)274BIN1Uncertain significancers746346952RCV000525420; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127808779127808779GA2:g.127808779G>AClinGen:CA1857062
NM_139343.3(BIN1):c.1403C>T (p.Thr468Ile)274BIN1Uncertain significance-1RCV001056158; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127808788127808788GA2:g.127808788G>A-
NM_139343.3(BIN1):c.1395G>C (p.Ala465=)274BIN1Uncertain significance-1RCV001131837; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127808796127808796CG2:g.127808796C>G-
NM_139343.3(BIN1):c.1394C>T (p.Ala465Val)274BIN1Uncertain significance-1RCV001131838; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127808797127808797GA2:g.127808797G>A-
NM_139343.3(BIN1):c.1385C>T (p.Ser462Leu)274BIN1Likely benignrs200580275RCV000551683; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127808806127808806GA2:g.127808806G>AClinGen:CA1857072
NM_139343.3(BIN1):c.1371+1G>T274BIN1Pathogenic/Likely pathogenicrs556129959RCV000312478|RCV001213324; NMedGen:CN517202|MONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127809830127809830CA2:g.127809830C>AClinGen:CA1857088C0410204 255200 Autosomal recessive centronuclear myopathy;
NM_139343.3(BIN1):c.1362G>T (p.Gly454=)274BIN1Benign/Likely benignrs61748155RCV000145336|RCV000309589; NMedGen:CN169374|MONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127809840127809840CA2:g.127809840C>AClinGen:CA171387C0410204 255200 Autosomal recessive centronuclear myopathy;
NM_139343.3(BIN1):c.1359G>A (p.Pro453=)274BIN1Conflicting interpretations of pathogenicityrs201397427RCV000636920|RCV001132832; NMedGen:CN517202|MONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127809843127809843CT2:g.127809843C>TClinGen:CA1857092
NM_139343.3(BIN1):c.1358C>T (p.Pro453Leu)274BIN1Uncertain significance-1RCV001038283; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127809844127809844GA2:g.127809844G>A-
NM_139343.3(BIN1):c.1328C>T (p.Ala443Val)274BIN1Uncertain significancers758494519RCV000366610; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127809874127809874GA2:g.127809874G>AClinGen:CA10612042C0410204 255200 Autosomal recessive centronuclear myopathy;
NM_139343.3(BIN1):c.1328C>G (p.Ala443Gly)274BIN1Uncertain significancers758494519RCV000688764; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127809874127809874GC2:g.127809874G>C-
NM_139343.3(BIN1):c.1322C>T (p.Thr441Ile)274BIN1Uncertain significancers886054834RCV000395082; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127809880127809880GA2:g.127809880G>AClinGen:CA10611121C0410204 255200 Autosomal recessive centronuclear myopathy;
NM_139343.3(BIN1):c.1314C>T (p.Ala438=)274BIN1Likely benignrs747474627RCV000945615; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127809888127809888GA2:g.127809888G>A-
NM_139343.3(BIN1):c.1303C>A (p.Pro435Thr)274BIN1Uncertain significance-1RCV001248597; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127809899127809899GT2:g.127809899G>T-
NM_139343.3(BIN1):c.1292C>T (p.Pro431Leu)274BIN1Benign/Likely benignrs141119288RCV000254301|RCV000636918; NMedGen:CN169374|MONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127809910127809910GA2:g.127809910G>AClinGen:CA1857103C0410204 255200 Autosomal recessive centronuclear myopathy;
NM_139343.3(BIN1):c.1282G>A (p.Gly428Ser)274BIN1Uncertain significancers200124094RCV000636911; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127809920127809920CT2:g.127809920C>TClinGen:CA1857104
NM_139343.3(BIN1):c.1271A>G (p.Glu424Gly)274BIN1Uncertain significance-1RCV001132833; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127809931127809931TC2:g.127809931T>C-
NM_139343.3(BIN1):c.1264-11_1270del274BIN1Conflicting interpretations of pathogenicityrs776737413RCV000484415|RCV000724730|RCV001080356; NMedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127809932127809949TCTGTGGGCTGGTAACAGGT2:g.127809932_127809949delClinGen:CA1857107
NM_139343.3(BIN1):c.1264-5A>C274BIN1Likely benignrs541219767RCV000558619; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127809943127809943TG2:g.127809943T>GClinGen:CA1857110
NM_139343.3(BIN1):c.1263+11C>T274BIN1Conflicting interpretations of pathogenicityrs78967885RCV000192807|RCV000312988; NMedGen:CN169374|MONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127810987127810987GA2:g.127810987G>AClinGen:CA205892
NM_139343.3(BIN1):c.1240T>G (p.Ser414Ala)274BIN1Uncertain significance-1RCV001214403; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127811021127811021AC2:g.127811021A>C-
NM_139343.3(BIN1):c.1205C>T (p.Thr402Met)274BIN1Uncertain significancers747660857RCV000803034; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127811515127811515GA2:g.127811515G>A-
NM_139343.3(BIN1):c.1181A>G (p.Asp394Gly)274BIN1Uncertain significancers375322787RCV000822221; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127811539127811539TC2:g.127811539T>C-
NM_139343.3(BIN1):c.1154C>T (p.Ser385Leu)274BIN1Uncertain significancers368616652RCV000725377|RCV001054931; NMedGen:CN517202|MONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127811566127811566GA2:g.127811566G>AClinGen:CA10604662CN169374 not specified;
NM_139343.3(BIN1):c.1147C>T (p.Pro383Ser)274BIN1Uncertain significancers1573549506RCV000794777; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127811573127811573GA2:g.127811573G>A-
NM_139343.3(BIN1):c.1143G>A (p.Pro381=)274BIN1Conflicting interpretations of pathogenicityrs372360787RCV000370019|RCV000602053; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:169186|MedGen:CN1693742127811577127811577CT2:g.127811577C>TClinGen:CA1857167C0410204 255200 Autosomal recessive centronuclear myopathy;
NM_139343.3(BIN1):c.1142C>T (p.Pro381Leu)274BIN1Uncertain significancers794727107RCV000174616|RCV000765501; NMedGen:CN517202|MONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127811578127811578GA2:g.127811578G>AClinGen:CA240163CN169374 not specified;
NM_139343.3(BIN1):c.1138G>A (p.Ala380Thr)274BIN1Uncertain significancers200887814RCV000694980; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127811582127811582CT2:g.127811582C>T-C0410204 255200 Autosomal recessive centronuclear myopathy;
NM_139343.3(BIN1):c.1132-2A>G274BIN1Likely pathogenicrs1295546366RCV000686184; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127811590127811590TC2:g.127811590T>C-C0410204 255200 Autosomal recessive centronuclear myopathy;
NM_139343.3(BIN1):c.1132-6_1132-4dup274BIN1Uncertain significancers765093741RCV000819593; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127811591127811592TTGGC2:g.127811591_127811592insGGC-
NM_139343.3(BIN1):c.1132-22TGC[7]274BIN1Conflicting interpretations of pathogenicityrs748026377RCV000277662|RCV000874718; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:169186|MedGen:CN5172022127811592127811593GGGCA2:g.127811592_127811593insGCAClinGen:CA10612048C0410204 255200 Autosomal recessive centronuclear myopathy;
NM_139343.3(BIN1):c.1132-22TGC[8]274BIN1Likely benignrs748026377RCV000877119; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127811592127811593GGGCAGCA2:g.127811592_127811593insGCAGCA-
NM_139343.3(BIN1):c.1132-7T>C274BIN1Conflicting interpretations of pathogenicityrs115938552RCV000145335|RCV000536059; NMedGen:CN169374|MONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127811595127811595AG2:g.127811595A>GClinGen:CA171386C0410204 255200 Autosomal recessive centronuclear myopathy;
NM_139343.3(BIN1):c.1131+7_1131+26del274BIN1Likely benignrs555116802RCV000543062; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127815023127815042AGCTGGGCCGCGGCGGCCGCGA2:g.127815023_127815042delClinGen:CA1857178
NC_000002.11:g.(?_127815029)_(127864539_?)dup274BIN1Uncertain significance-1RCV000707869; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127815029127864539nana-
NM_139343.3(BIN1):c.1131+9C>T274BIN1Conflicting interpretations of pathogenicityrs138606879RCV000316364|RCV000858899; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:169186|MedGen:CN5172022127815040127815040GA2:g.127815040G>AClinGen:CA1857185C0410204 255200 Autosomal recessive centronuclear myopathy;
NM_139343.3(BIN1):c.1131+7C>T274BIN1Likely benignrs376590911RCV000426182|RCV000557755; NMedGen:CN169374|MONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127815042127815042GA2:g.127815042G>AClinGen:CA1857186C0410204 255200 Autosomal recessive centronuclear myopathy;
NM_139343.3(BIN1):c.1114G>A (p.Val372Met)274BIN1Uncertain significancers749198133RCV000435212|RCV001064060; NMedGen:CN169374|MONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127815066127815066CT2:g.127815066C>TClinGen:CA1857187CN169374 not specified;
NM_139343.3(BIN1):c.1111A>G (p.Ser371Gly)274BIN1Uncertain significancers1553456782RCV000532874; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127815069127815069TC2:g.127815069T>CClinGen:CA348378423C0410204 255200 Autosomal recessive centronuclear myopathy;
NM_139343.3(BIN1):c.1092C>T (p.Asp364=)274BIN1Uncertain significance-1RCV001136228; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127815088127815088GA2:g.127815088G>A-
NM_139343.3(BIN1):c.1060A>G (p.Lys354Glu)274BIN1Uncertain significancers886043420RCV000325514|RCV000636912; NMedGen:CN517202|MONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127815120127815120TC2:g.127815120T>CClinGen:CA10605499C0410204 255200 Autosomal recessive centronuclear myopathy;
NM_139343.3(BIN1):c.1047G>A (p.Pro349=)274BIN1Conflicting interpretations of pathogenicityrs148945502RCV000354884; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127815133127815133CT2:g.127815133C>TClinGen:CA1857193
NM_139343.3(BIN1):c.1046C>T (p.Pro349Leu)274BIN1Uncertain significancers775494528RCV000707242; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127815134127815134GA2:g.127815134G>A-
NM_139343.3(BIN1):c.1018C>T (p.Pro340Ser)274BIN1Uncertain significance-1RCV001136229; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127815162127815162GA2:g.127815162G>A-
NM_139343.3(BIN1):c.1003-6C>A274BIN1Uncertain significancers1406716458RCV000701181; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127815183127815183GT2:g.127815183G>T-
NM_139343.3(BIN1):c.1003-11C>G274BIN1Conflicting interpretations of pathogenicityrs759676621RCV000431662|RCV001136230; NMedGen:CN169374|MONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127815188127815188GC2:g.127815188G>CClinGen:CA1857200CN169374 not specified;
NM_139343.3(BIN1):c.1003-13C>T274BIN1Uncertain significance-1RCV001136231; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127815190127815190GA2:g.127815190G>A-
NM_139343.3(BIN1):c.968C>T (p.Thr323Met)274BIN1Uncertain significance-1RCV001227524; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127816621127816621GA2:g.127816621G>A-
NM_139343.3(BIN1):c.965C>T (p.Ala322Val)274BIN1Uncertain significance-1RCV001136232; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127816624127816624GA2:g.127816624G>A-
NM_139343.3(BIN1):c.961G>A (p.Gly321Arg)274BIN1Uncertain significancers557276019RCV000262446|RCV000442714; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:169186|MedGen:CN5172022127816628127816628CT2:g.127816628C>TClinGen:CA1857225
NM_139343.3(BIN1):c.957C>A (p.Ala319=)274BIN1Uncertain significancers2276579RCV000145351; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127816632127816632GT2:g.127816632G>TClinGen:CA171414
NM_139343.3(BIN1):c.957C>G (p.Ala319=)274BIN1Uncertain significancers2276579RCV000145352; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127816632127816632GC2:g.127816632G>CClinGen:CA171416
NM_139343.3(BIN1):c.957C>T (p.Ala319=)274BIN1Benign/Likely benignrs2276579RCV000145353|RCV000319647; NMedGen:CN169374|MONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127816632127816632GA2:g.127816632G>AClinGen:CA171417C0410204 255200 Autosomal recessive centronuclear myopathy;
NM_139343.3(BIN1):c.943G>C (p.Glu315Gln)274BIN1Uncertain significance-1RCV001238446; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127816646127816646CG2:g.127816646C>G-
NM_139343.3(BIN1):c.942C>T (p.His314=)274BIN1Conflicting interpretations of pathogenicityrs370911793RCV000174097|RCV000724853|RCV001087297; NMedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127816647127816647GA2:g.127816647G>AClinGen:CA239563CN169374 not specified;
NM_139343.3(BIN1):c.925G>A (p.Glu309Lys)274BIN1Uncertain significancers374565677RCV000445206|RCV001045898; NMedGen:CN517202|MONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127816664127816664CT2:g.127816664C>TClinGen:CA1857232CN169374 not specified;
NM_139343.3(BIN1):c.924C>T (p.Pro308=)274BIN1Conflicting interpretations of pathogenicityrs367611371RCV000372979|RCV000726110|RCV001088820; NMedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127816665127816665GA2:g.127816665G>AClinGen:CA1857233CN169374 not specified;
NM_139343.3(BIN1):c.920C>G (p.Thr307Ser)274BIN1Uncertain significance-1RCV001204344; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127816669127816669GC2:g.127816669G>C-
NM_139343.3(BIN1):c.906C>T (p.Gly302=)274BIN1Conflicting interpretations of pathogenicityrs371258305RCV000252539|RCV000636914; NMedGen:CN169374|MONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127816683127816683GA2:g.127816683G>AClinGen:CA1857240C0410204 255200 Autosomal recessive centronuclear myopathy;
NM_139343.3(BIN1):c.903T>C (p.Asp301=)274BIN1Likely benignrs141588262RCV000544828; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127816686127816686AG2:g.127816686A>GClinGen:CA1857241
NM_139343.3(BIN1):c.901G>T (p.Asp301Tyr)274BIN1Uncertain significance-1RCV001062598; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127816688127816688CA2:g.127816688C>A-
NM_139343.3(BIN1):c.894G>A (p.Ser298=)274BIN1Benign/Likely benignrs2228955RCV000145350|RCV000376667; NMedGen:CN169374|MONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127816695127816695CT2:g.127816695C>TClinGen:CA171412C0410204 255200 Autosomal recessive centronuclear myopathy;
NM_139343.3(BIN1):c.893C>T (p.Ser298Leu)274BIN1Uncertain significancers754707833RCV000487008|RCV001055348; NMedGen:CN517202|MONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127816696127816696GA2:g.127816696G>AClinGen:CA1857243CN169374 not specified;
NM_139343.3(BIN1):c.888C>T (p.Ser296=)274BIN1Conflicting interpretations of pathogenicityrs114833236RCV000145349|RCV000284692; NMedGen:CN169374|MONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127816701127816701GA2:g.127816701G>AClinGen:CA171410C0410204 255200 Autosomal recessive centronuclear myopathy;
NM_139343.3(BIN1):c.887G>A (p.Ser296Asn)274BIN1Uncertain significance-1RCV001227299; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127816702127816702CT2:g.127816702C>T-
NM_139343.3(BIN1):c.867G>A (p.Ala289=)274BIN1Likely benignrs201839857RCV000875950; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127816722127816722CT2:g.127816722C>T-
NM_139343.3(BIN1):c.866C>T (p.Ala289Val)274BIN1Uncertain significancers771112840RCV000817171; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127816723127816723GA2:g.127816723G>A-
NM_139343.3(BIN1):c.864C>T (p.Asn288=)274BIN1Likely benignrs746393271RCV000636917; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127816725127816725GA2:g.127816725G>AClinGen:CA1857250
NM_139343.3(BIN1):c.858-5C>T274BIN1Benign/Likely benignrs75328896RCV000560847|RCV000602308; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:169186|MedGen:CN1693742127816736127816736GA2:g.127816736G>AClinGen:CA1857252C0410204 255200 Autosomal recessive centronuclear myopathy;
NM_139343.3(BIN1):c.858-12C>A274BIN1Benignrs6720741RCV000145348|RCV000323294; NMedGen:CN169374|MONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127816743127816743GT2:g.127816743G>TClinGen:CA171409C0410204 255200 Autosomal recessive centronuclear myopathy;
NM_139343.3(BIN1):c.857+4C>T274BIN1Uncertain significancers61748156RCV000636909; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127819687127819687GA2:g.127819687G>AClinGen:CA1857310
NM_139343.3(BIN1):c.839C>T (p.Thr280Met)274BIN1Uncertain significancers201872255RCV000636908; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127819709127819709GA2:g.127819709G>AClinGen:CA1857311C0410204 255200 Autosomal recessive centronuclear myopathy;
NM_139343.3(BIN1):c.823G>A (p.Gly275Arg)274BIN1Uncertain significance-1RCV001227313; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127819725127819725CT2:g.127819725C>T-
NM_139343.3(BIN1):c.805G>A (p.Gly269Ser)274BIN1Conflicting interpretations of pathogenicityrs372072916RCV000420208|RCV000697587; NMedGen:CN169374|MONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127819743127819743CT2:g.127819743C>TClinGen:CA1857317C0410204 255200 Autosomal recessive centronuclear myopathy;
NM_139343.3(BIN1):c.791A>G (p.Asn264Ser)274BIN1Uncertain significance-1RCV001129261; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127819757127819757TC2:g.127819757T>C-
NM_139343.3(BIN1):c.775-4G>A274BIN1Benignrs61748157RCV000145347|RCV000381094; NMedGen:CN169374|MONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127819777127819777CT2:g.127819777C>TClinGen:CA171408C0410204 255200 Autosomal recessive centronuclear myopathy;
NC_000002.11:g.(?_127821127)_(127834302_?)dup274BIN1Uncertain significance-1RCV000636923; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127821127127834302nana-
NM_139343.3(BIN1):c.770G>A (p.Ser257Asn)274BIN1Uncertain significance-1RCV001059191; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127821151127821151CT2:g.127821151C>T-
NM_139343.3(BIN1):c.767T>C (p.Met256Thr)274BIN1Uncertain significancers975404965RCV000636905; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127821154127821154AG2:g.127821154A>GClinGen:CA55349049C0410204 255200 Autosomal recessive centronuclear myopathy;
NM_139343.3(BIN1):c.740G>A (p.Gly247Asp)274BIN1Uncertain significance-1RCV001230754; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127821181127821181CT2:g.127821181C>T-
NM_139343.3(BIN1):c.738G>A (p.Ala246=)274BIN1Likely benignrs751182086RCV000960392; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127821183127821183CT2:g.127821183C>T-
NM_139343.3(BIN1):c.715G>A (p.Val239Ile)274BIN1Uncertain significancers146573197RCV000546175|RCV000726561; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:169186|MedGen:CN5172022127821206127821206CT2:g.127821206C>TClinGen:CA1857358C0410204 255200 Autosomal recessive centronuclear myopathy;
NM_139343.3(BIN1):c.714C>T (p.Tyr238=)274BIN1Benignrs1137845RCV000145346|RCV000288997; NMedGen:CN169374|MONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127821207127821207GA2:g.127821207G>AClinGen:CA171406C0410204 255200 Autosomal recessive centronuclear myopathy;
NM_139343.3(BIN1):c.702C>T (p.Arg234=)274BIN1Likely benignrs775573748RCV000636922; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127821219127821219GA2:g.127821219G>AClinGen:CA1857360
NM_139343.3(BIN1):c.700C>T (p.Arg234Cys)274BIN1Likely pathogenicrs777176261RCV000754843; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127821221127821221GA2:g.127821221G>AOMIM:601248.0005
NM_139343.3(BIN1):c.698+15G>A274BIN1Uncertain significance-1RCV001131969; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127821494127821494CT2:g.127821494C>T-
NM_139343.3(BIN1):c.698+10A>G274BIN1Benignrs72481904RCV000145345|RCV000346183; NMedGen:CN169374|MONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127821499127821499TC2:g.127821499T>CClinGen:CA171405C0410204 255200 Autosomal recessive centronuclear myopathy;
NM_139343.3(BIN1):c.698+9C>T274BIN1Conflicting interpretations of pathogenicityrs763703697RCV000609715|RCV001131970; NMedGen:CN169374|MONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127821500127821500GA2:g.127821500G>AClinGen:CA1857388CN169374 not specified;
NM_139343.3(BIN1):c.696C>A (p.Asn232Lys)274BIN1Uncertain significancers143820618RCV000145344|RCV000514580|RCV000529083; NMedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127821511127821511GT2:g.127821511G>TClinGen:CA171403
NM_139343.3(BIN1):c.681G>A (p.Leu227=)274BIN1Conflicting interpretations of pathogenicityrs199658397RCV000384474; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127821526127821526CT2:g.127821526C>TClinGen:CA1857391
NM_139343.3(BIN1):c.679C>G (p.Leu227Val)274BIN1Uncertain significancers886054835RCV000292621; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127821528127821528GC2:g.127821528G>CClinGen:CA10612170
NM_139343.3(BIN1):c.675G>A (p.Glu225=)274BIN1Conflicting interpretations of pathogenicityrs148179522RCV000945400; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127821532127821532CT2:g.127821532C>T-
NM_139343.3(BIN1):c.630C>T (p.Ile210=)274BIN1Likely benignrs886038728RCV000241976|RCV000636921; NMedGen:CN169374|MONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127821577127821577GA2:g.127821577G>AClinGen:CA10586751C0410204 255200 Autosomal recessive centronuclear myopathy;
NM_139343.3(BIN1):c.613-5C>G274BIN1Uncertain significancers1408065039RCV000555336; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127821599127821599GC2:g.127821599G>CClinGen:CA535638772
NM_139343.3(BIN1):c.550C>G (p.Gln184Glu)274BIN1Uncertain significance-1RCV001204669; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127825801127825801GC2:g.127825801G>C-
NM_139343.3(BIN1):c.527C>T (p.Ser176Leu)274BIN1Uncertain significance-1RCV001037966; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127825824127825824GA2:g.127825824G>A-
NM_139343.3(BIN1):c.519+4A>G274BIN1Uncertain significancers1429919147RCV000697627; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127826496127826496TC2:g.127826496T>C-
NM_139343.3(BIN1):c.486T>C (p.Thr162=)274BIN1Benign/Likely benignrs1060743RCV000145343|RCV000349850; NMedGen:CN169374|MONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127826533127826533AG2:g.127826533A>GClinGen:CA171401C0410204 255200 Autosomal recessive centronuclear myopathy;
NM_139343.3(BIN1):c.478C>T (p.Leu160Phe)274BIN1Uncertain significance-1RCV001242608; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127826541127826541GA2:g.127826541G>A-
NM_139343.3(BIN1):c.472G>A (p.Glu158Lys)274BIN1Uncertain significancers764377144RCV000636907; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127826547127826547CT2:g.127826547C>TClinGen:CA1857470
NM_139343.3(BIN1):c.471C>T (p.Tyr157=)274BIN1Likely benignrs138885327RCV000606200|RCV000874522; NMedGen:CN169374|MONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127826548127826548GA2:g.127826548G>AClinGen:CA1857471CN169374 not specified;
NM_139343.3(BIN1):c.469T>C (p.Tyr157His)274BIN1Uncertain significancers1553466026RCV000545195; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127826550127826550AG2:g.127826550A>GClinGen:CA348367773
NM_139343.3(BIN1):c.461G>A (p.Arg154Gln)274BIN1Conflicting interpretations of pathogenicityrs267606681RCV000008798; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127826558127826558CT2:g.127826558C>TClinGen:CA119462,OMIM:601248.0004C0410204 255200 Autosomal recessive centronuclear myopathy;
NM_139343.3(BIN1):c.460C>T (p.Arg154Trp)274BIN1Uncertain significancers761914168RCV000811248; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127826559127826559GA2:g.127826559G>A-
NM_139343.3(BIN1):c.451G>A (p.Asp151Asn)274BIN1Pathogenicrs121909274RCV000008796; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127826568127826568CT2:g.127826568C>TClinGen:CA119459,UniProtKB:O00499#VAR_037426,OMIM:601248.0002C0410204 255200 Autosomal recessive centronuclear myopathy;
NM_139343.3(BIN1):c.434G>A (p.Arg145His)274BIN1Uncertain significance-1RCV001208067; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127826585127826585CT2:g.127826585C>T-
NM_139343.3(BIN1):c.433C>T (p.Arg145Cys)274BIN1Likely pathogenicrs1249621033RCV000754844; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127826586127826586GA2:g.127826586G>AOMIM:601248.0006
NM_139343.3(BIN1):c.430_432del (p.Gly144del)274BIN1Uncertain significance-1RCV001229874; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127826587127826589GCCCG2:g.127826587_127826589del-
NM_139343.3(BIN1):c.418A>C (p.Ile140Leu)274BIN1Uncertain significance-1RCV001242127; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127826601127826601TG2:g.127826601T>G-
NM_139343.3(BIN1):c.402C>T (p.Pro134=)274BIN1Likely benignrs144136512RCV000245446|RCV000877189; NMedGen:CN169374|MONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127827580127827580GA2:g.127827580G>AClinGen:CA1857494CN169374 not specified;
NM_139343.3(BIN1):c.393C>T (p.Gly131=)274BIN1Uncertain significancers1455926606RCV000695525; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127827589127827589GA2:g.127827589G>A-C0410204 255200 Autosomal recessive centronuclear myopathy;
NM_139343.3(BIN1):c.384G>A (p.Thr128=)274BIN1Conflicting interpretations of pathogenicityrs61748158RCV000403883|RCV000610549; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:169186|MedGen:CN1693742127827598127827598CT2:g.127827598C>TClinGen:CA1857497
NM_139343.3(BIN1):c.380_381AC[3] (p.Tyr129fs)274BIN1Pathogenicrs761813363RCV000687106; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127827598127827599CCGT2:g.127827598_127827599insGT-
NM_139343.3(BIN1):c.330G>A (p.Leu110=)274BIN1Uncertain significancers746946704RCV000314987; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127827652127827652CT2:g.127827652C>TClinGen:CA1857504
NM_139343.3(BIN1):c.315+7A>C274BIN1Likely benignrs1573647825RCV000982826; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127828122127828122TG2:g.127828122T>G-
NM_139343.3(BIN1):c.315+3G>C274BIN1Uncertain significance-1RCV001202482; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127828126127828126CG2:g.127828126C>G-
NM_139343.3(BIN1):c.313G>A (p.Glu105Lys)274BIN1Uncertain significance-1RCV001215101; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127828131127828131CT2:g.127828131C>T-
NM_139343.3(BIN1):c.286G>A (p.Gly96Ser)274BIN1Uncertain significancers769724273RCV000819262; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127828158127828158CT2:g.127828158C>T-
NM_139343.3(BIN1):c.285C>A (p.Pro95=)274BIN1Likely benignrs377467117RCV000877502; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127828159127828159GT2:g.127828159G>T-
NM_139343.3(BIN1):c.279T>C (p.Asp93=)274BIN1Likely benignrs770994335RCV000542004; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127828165127828165AG2:g.127828165A>GClinGen:CA1857529
NM_139343.3(BIN1):c.279T>A (p.Asp93Glu)274BIN1Uncertain significance-1RCV001238014; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127828165127828165AT2:g.127828165A>T-
NM_139343.3(BIN1):c.276C>T (p.Pro92=)274BIN1Likely benignrs1013293394RCV000876825; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127828168127828168GA2:g.127828168G>A-
NM_139343.3(BIN1):c.229G>A (p.Glu77Lys)274BIN1Uncertain significance-1RCV001245547; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127828215127828215CT2:g.127828215C>T-
NM_139343.3(BIN1):c.221-8C>T274BIN1Likely benignrs750040017RCV000636903; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127828231127828231GA2:g.127828231G>AClinGen:CA1857536C0410204 255200 Autosomal recessive centronuclear myopathy;
NM_139343.3(BIN1):c.213C>T (p.Ser71=)274BIN1Likely benignrs560078675RCV000636913; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127828345127828345GA2:g.127828345G>AClinGen:CA1857556
NM_139343.3(BIN1):c.173G>T (p.Gly58Val)274BIN1Uncertain significancers1282156307RCV000794378; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127828385127828385CA2:g.127828385C>A-
NM_139343.3(BIN1):c.168G>A (p.Thr56=)274BIN1Uncertain significance-1RCV001068838; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127828390127828390CT2:g.127828390C>T-
NM_139343.3(BIN1):c.165+6T>C274BIN1Uncertain significance-1RCV001038656; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127834196127834196AG2:g.127834196A>G-
NM_139343.3(BIN1):c.105G>T (p.Lys35Asn)274BIN1Pathogenicrs121909273RCV000008795; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127834262127834262CA2:g.127834262C>AUniProtKB:O00499#VAR_037425,OMIM:601248.0001,ClinGen:CA119458C0410204 255200 Autosomal recessive centronuclear myopathy;
NM_139343.3(BIN1):c.85-5G>A274BIN1Uncertain significancers371593265RCV000636906; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127834287127834287CT2:g.127834287C>TClinGen:CA1857595C0410204 255200 Autosomal recessive centronuclear myopathy;
NM_139343.3(BIN1):c.85-6C>T274BIN1Likely benignrs200855894RCV000636919; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127834288127834288GA2:g.127834288G>AClinGen:CA1857596
NC_000002.12:g.(?_127106850)_(127106953_?)dup274BIN1Uncertain significance-1RCV001033904; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127864426127864529nana-1-
NM_139343.3(BIN1):c.84+9G>A274BIN1Uncertain significancers762680903RCV000334262; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127864427127864427CT2:g.127864427C>TClinGen:CA1857621
NM_139343.3(BIN1):c.72C>T (p.Arg24=)274BIN1Uncertain significance-1RCV001215969; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127864448127864448GA2:g.127864448G>A-
NM_139343.3(BIN1):c.52G>A (p.Val18Met)274BIN1Uncertain significance-1RCV001071070; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127864468127864468CT2:g.127864468C>T-
NM_139343.3(BIN1):c.30G>A (p.Thr10=)274BIN1Conflicting interpretations of pathogenicityrs35535012RCV000145342|RCV000173567|RCV000724179; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:169186|MedGen:CN169374|MedGen:CN5172022127864490127864490CT2:g.127864490C>TClinGen:CA171399C0410204 255200 Autosomal recessive centronuclear myopathy;
NM_139343.3(BIN1):c.9G>C (p.Glu3Asp)274BIN1Uncertain significancers558639756RCV000559491; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127864511127864511CG2:g.127864511C>GClinGen:CA1857627
NM_139343.3(BIN1):c.-27C>T274BIN1Benignrs11554586RCV000252497|RCV000299689; NMedGen:CN169374|MONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127864546127864546GA2:g.127864546G>AClinGen:CA1857630C0410204 255200 Autosomal recessive centronuclear myopathy;
NM_139343.3(BIN1):c.-62G>A274BIN1Uncertain significancers886054836RCV000356829; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127864581127864581CT2:g.127864581C>TClinGen:CA10610724
NM_139343.3(BIN1):c.-105G>T274BIN1Uncertain significance-1RCV001136348; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127864624127864624CA2:g.127864624C>A-
NM_139343.3(BIN1):c.-105G>C274BIN1Uncertain significance-1RCV001136349; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127864624127864624CG2:g.127864624C>G-
NM_139343.3(BIN1):c.-114del274BIN1Uncertain significancers886054837RCV000264305; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127864633127864633GCG2:g.127864633_127864633delClinGen:CA10612174
NM_139343.3(BIN1):c.-146C>G274BIN1Uncertain significance-1RCV001136350; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127864665127864665GC2:g.127864665G>C-
NM_139343.3(BIN1):c.-163T>C274BIN1Uncertain significancers560690864RCV000303136; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127864682127864682AG2:g.127864682A>GClinGen:CA10610725
NM_139343.3(BIN1):c.-177_-174dup274BIN1Uncertain significancers886054838RCV000360110; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127864692127864693GGAGCC2:g.127864692_127864693insAGCCClinGen:CA10612175
NM_139343.3(BIN1):c.-192G>A274BIN1Uncertain significancers886054839RCV000267839; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127864711127864711CT2:g.127864711C>TClinGen:CA10612185
NM_139343.3(BIN1):c.-197C>A274BIN1Uncertain significancers886054840RCV000325664; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127864716127864716GT2:g.127864716G>TClinGen:CA10610727
NM_139343.2(BIN1):c.-214T>G274BIN1Uncertain significancers886054841RCV000382584; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127864733127864733AC2:g.127864733A>CClinGen:CA10612188
NM_139343.2(BIN1):c.-272G>A274BIN1Uncertain significancers886054842RCV000271831; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127864791127864791CT2:g.127864791C>TClinGen:CA10612069
NM_139343.2(BIN1):c.-314G>C274BIN1Uncertain significancers531361957RCV000329240; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127864833127864833CG2:g.127864833C>GClinGen:CA10612076
NM_139343.2(BIN1):c.-366C>A274BIN1Uncertain significancers886054843RCV000385865; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127864885127864885GT2:g.127864885G>TClinGen:CA10610729
NM_139343.2(BIN1):c.-389T>A274BIN1Likely benignrs56827597RCV000336665; NMONDO:MONDO:0009709,MedGen:C0410204,OMIM:255200, Orphanet:1691862127864908127864908AT2:g.127864908A>TClinGen:CA10654605C0410204 255200 Autosomal recessive centronuclear myopathy;
MSeqDR Portal