MSeqDR Mitochondrial Disease Portal


 
*:HP: HPO terms, UMDF: 1= Disease, ND: NAMDC terms.
  Most Studied  CPEO, Complex I Deficiency, COXPD1, Leigh, LHON, MELAS, MERRF, Myopathy, SANDO
Disease Browser
Parent Node:
expand
Hypoglycemia (D007003)
Parent Node:
expand
Lipid Metabolism, Inborn Errors (D008052)
..Starting node
..expand
Carnitine palmitoyl transferase 1A deficiency (C535588)

       Child Nodes:



 Sister Nodes: 
..expand2,4-Dienoyl-CoA Reductase Deficiency (C565624)
..expandAcetyl-Coa Carboxylase Deficiency (C562678)
..expandAlpha-Methylacyl-CoA Racemase Deficiency (C565768)
..expandApolipoprotein E, Deficiency or Defect of (C566260)
..expandBarth Syndrome (D056889) Child2  LSDB  L: 00399;
..expandCarnitine palmitoyl transferase 1A deficiency (C535588)  LSDB  L: 00440;
..expandCarnitine Palmitoyltransferase II Deficiency, Infantile (C563462)  LSDB  L: 00466;
..expandCarnitine Palmitoyltransferase II Deficiency, Late-Onset (C563461)  LSDB  L: 00486;
..expandCarnitine-Acylcarnitine Translocase Deficiency (C562812)  LSDB  L: 00437;
..expandChanarin-Dorfman Syndrome (C536560)
..expandCholesteryl Ester Transfer Protein Deficiency (C564591)
..expandCytosolic acetoacetyl-CoA thiolase deficiency (C536005)
..expandDesmosterolosis (C566555)
..expandGLYCOSYLPHOSPHATIDYLINOSITOL DEFICIENCY (OMIM:610293)
..expandHEPATIC LIPASE DEFICIENCY (OMIM:614025)
..expandHyperlipidemia, Familial Combined (D006950) Child2
..expandHyperlipoproteinemia Type I (D008072) Child1
..expandHyperlipoproteinemia Type II (D006938) Child4
..expandHyperlipoproteinemia Type III (D006952)
..expandHyperlipoproteinemia Type IV (D006953)
..expandHyperlipoproteinemia Type V (D006954)
..expandHypolipoproteinemias (D007009) Child14
..expandLipase deficiency combined (C535904)
..expandLipidoses (D008064) Child71
..expandLipodystrophy, Congenital Generalized (D052497) Child3
..expandLong-chain acyl-CoA dehydrogenase deficiency (C535690)
..expandLp(A) Deficiency, Congenital (C563618)
..expandMedium chain acyl CoA dehydrogenase deficiency (C536038)  LSDB  L: 00434;
..expandMyopathy with Abnormal Lipid Metabolism (C562935)
..expandNeutral Lipid Storage Disease with Myopathy (C565192)
..expandPANCREATIC LIPASE DEFICIENCY (OMIM:614338)
..expandPeroxisomal ACYL-COA oxidase deficiency (C536662)
..expandShort chain Acyl CoA dehydrogenase deficiency (C537596)  LSDB  L: 00435;
..expandSitosterolemia (C537345)
..expandSmith-Lemli-Opitz Syndrome (D019082) Child1
..expandTrifunctional Protein Deficiency With Myopathy And Neuropathy (C566945)  LSDB  L: 00417;
..expandTriglyceride Storage Disease, Type I (C566031)
..expandTriglyceride Storage Disease, Type II (C566030)
..expandVLCAD deficiency (C536353)  LSDB  L: 00436;
..expandXanthomatosis, Cerebrotendinous (D019294)
   

Human Disease MESH is developed by UMLS.
Further data from MedGen, OMIM,ClinVar, CTD
Term ID:1920
Name:Carnitine palmitoyl transferase 1A deficiency
Definition:
Alternative IDs:OMIM:255120
ParentIDs:MESH:D007003|MESH:D008052
TreeNumbers:C16.320.565.398/C535588 |C18.452.394.984/C535588 |C18.452.584.562/C535588 |C18.452.648.398/C535588
Synonyms:Carnitine palmitoyltransferase 1 deficiency |Carnitine Palmitoyltransferase IA Deficiency |Carnitine Palmitoyltransferase I Deficiency |CPT 1A Deficiency |CPT Deficiency, Hepatic, Type I |CPT I Deficiency |Hepatic carnitine palmitoyltransferase 1 deficiency |Li
Slim Mappings:Genetic disease (inborn)|Metabolic disease
Reference: MedGen: C535588
MeSH: C535588
OMIM: 255120;
MSeqDR LSDB: 00440;  
Genes: CPT1A;
Phenotypes
1 HP:0000007Autosomal recessive inheritance
2 HP:0011675Arrhythmia
NAMDC:  Cardiac conduction block
3 HP:0001640Cardiomegaly
4 HP:0001259Coma
5 HP:0002014Diarrhea
6 HP:0002910Elevated hepatic transaminases
7 HP:0003236Elevated serum creatine phosphokinase
8 HP:0008872Feeding difficulties in infancy
9 HP:0001290Generalized hypotonia
10 HP:0001397Hepatic steatosis
NAMDC:  Hepatopathy with steatosis or oncocytic changes by liver biopsy
11 HP:0002240Hepatomegaly
12 HP:0001987Hyperammonemia
13 HP:0001985Hypoketotic hypoglycemia
14 HP:0001254Lethargy
15 HP:0001252Muscular hypotonia
NAMDC:  Hypotonia
16 HP:0002686Prenatal maternal abnormality
17 HP:0007335Recurrent encephalopathy
18 HP:0001947Renal tubular acidosis
NAMDC:  Renal tubular acidosis
19 HP:0001250Seizures
NAMDC:  Seizures
20 HP:0008279Transient hyperlipidemia
Disease Causing ClinVar Variants
Variation_NameGeneIDGeneSymbolClinicalSignificancedbSNPRCVaccessionTestedInGTRPhenotypeIDsChromosomeStartStopHGVS_cHGVS_pHGVS_gOtherIDsDisease_ClinVar
NC_000011.9:g.(?_68522274)_(68530239_?)del1374CPT1APathogenic-1RCV001949321; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852227468530239nana-1-
NC_000011.9:g.(?_68525112)_(68582942_?)del1374CPT1APathogenic-1RCV001946638; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852511268582942nana-1-
NM_001876.4(CPT1A):c.2322A>G (p.Ter774=)1374CPT1ALikely benign-1RCV002187430; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852511268525112TC68525112-
NM_001876.4(CPT1A):c.2313C>T (p.Ser771=)1374CPT1ALikely benign-1RCV002079940; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852512168525121GA68525121-
NM_001876.4(CPT1A):c.2293T>C (p.Phe765Leu)1374CPT1AUncertain significancers1946717191RCV001034856; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852514168525141AG11:g.68525141A>G-
NM_001876.4(CPT1A):c.2283C>T (p.Ile761=)1374CPT1ALikely benign-1RCV001480265; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852515168525151GA68525151-
NM_001876.4(CPT1A):c.2280C>T (p.Asp760=)1374CPT1ALikely benign-1RCV001447294; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852515468525154GA68525154-
NM_001876.4(CPT1A):c.2271A>C (p.Ala757=)1374CPT1ALikely benign-1RCV002172684; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852516368525163TG68525163-
NM_001876.4(CPT1A):c.2259_2261dup (p.Leu754dup)1374CPT1ALikely pathogenicrs1594313040RCV000988590; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852517268525173CCAGG11:g.68525172_68525173insAGG-
NM_001876.4(CPT1A):c.2260C>T (p.Leu754=)1374CPT1ALikely benignrs144781827RCV000900095|RCV001704751; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156|MedGen:CN517202116852517468525174GA11:g.68525174G>AClinGen:CA6152022CN169374 not specified;
NM_001876.4(CPT1A):c.2259C>T (p.His753=)1374CPT1ALikely benign-1RCV002098534; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852517568525175GA68525175-
NM_001876.4(CPT1A):c.2244T>C (p.His748=)1374CPT1ALikely benign-1RCV001504743; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852519068525190AG68525190-
NM_001876.4(CPT1A):c.2243A>T (p.His748Leu)1374CPT1AUncertain significancers900349852RCV001234327; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852519168525191TA11:g.68525191T>A-
NM_001876.4(CPT1A):c.2238T>G (p.Asp746Glu)1374CPT1AUncertain significance-1RCV001359932; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852519668525196AC68525196-
NM_001876.4(CPT1A):c.2236-1G>A1374CPT1AUncertain significancers1555226004RCV000669252; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852519968525199CT11:g.68525199C>T-C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.2236-7A>G1374CPT1ALikely benign-1RCV002086784; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852520568525205TC68525205-
NM_001876.4(CPT1A):c.2236-14T>G1374CPT1ALikely benign-1RCV002195407; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852521268525212AC68525212-
NM_001876.4(CPT1A):c.2235+9G>A1374CPT1AUncertain significancers1946761066RCV001279742; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852702868527028CT11:g.68527028C>T-
NM_001876.4(CPT1A):c.2235+4T>C1374CPT1AConflicting interpretations of pathogenicityrs755308448RCV000609082|RCV000687180; NMedGen:CN169374|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852703368527033AG11:g.68527033A>GClinGen:CA6152040C1829703 Carnitine palmitoyl transferase 1 deficiency;
NM_001876.4(CPT1A):c.2235G>A (p.Thr745=)1374CPT1AUncertain significancers202208941RCV001279743|RCV001356689; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156|MedGen:CN517202116852703768527037CT11:g.68527037C>T-
NM_001876.4(CPT1A):c.2223T>C (p.Ser741=)1374CPT1ALikely benign-1RCV001463255; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852704968527049AG68527049-
NM_001876.4(CPT1A):c.2205C>T (p.His735=)1374CPT1ALikely benign-1RCV002088613; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852706768527067GA68527067-
NM_001876.4(CPT1A):c.2198A>G (p.Asn733Ser)1374CPT1AConflicting interpretations of pathogenicityrs151271754RCV000175297|RCV001081801; NMedGen:CN517202|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852707468527074TC11:g.68527074T>CClinGen:CA241021CN169374 not specified;
NM_001876.4(CPT1A):c.2178T>C (p.Leu726=)1374CPT1ALikely benignrs200501379RCV000931074; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852709468527094AG11:g.68527094A>G-
NM_001876.4(CPT1A):c.2173A>G (p.Ile725Val)1374CPT1ALikely benignrs773269662RCV000977436; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852709968527099TC11:g.68527099T>C-
NM_001876.4(CPT1A):c.2172C>T (p.Tyr724=)1374CPT1ALikely benign-1RCV002075731; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852710068527100GA68527100-
NM_001876.4(CPT1A):c.2169G>A (p.Ser723=)1374CPT1ALikely benign-1RCV002180657; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852710368527103CT68527103-
NM_001876.4(CPT1A):c.2166G>A (p.Val722=)1374CPT1ALikely benign-1RCV002125557; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852710668527106CT68527106-
NM_001876.4(CPT1A):c.2154C>T (p.Asp718=)1374CPT1ALikely benign-1RCV001456205; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852711868527118GA68527118-
NM_001876.4(CPT1A):c.2148T>C (p.Ala716=)1374CPT1ALikely benign-1RCV001399924; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852712468527124AG68527124-
NM_001876.4(CPT1A):c.2143-6C>T1374CPT1ALikely benign-1RCV002132950; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852713568527135GA68527135-
NM_001876.4(CPT1A):c.2142+93C>T1374CPT1ABenign-1RCV001533354|RCV001536716; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156|MedGen:CN517202116852760068527600GA68527600-
NM_001876.4(CPT1A):c.2142+11C>T1374CPT1AUncertain significance-1RCV001891645; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852768268527682GA68527682-
NM_001876.4(CPT1A):c.2142+9G>A1374CPT1ALikely benignrs753764564RCV000434869|RCV000877682; NMedGen:CN169374|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852768468527684CT11:g.68527684C>TClinGen:CA6152084CN169374 not specified;
NM_001876.4(CPT1A):c.2142+8C>T1374CPT1ABenign/Likely benignrs147563740RCV000367091|RCV000639504|RCV001092910; NMedGen:CN169374|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156|MedGen:CN517202116852768568527685GA11:g.68527685G>AClinGen:CA6152085C1829703 Carnitine palmitoyl transferase 1 deficiency;
NM_001876.4(CPT1A):c.2142+8C>A1374CPT1ALikely benign-1RCV001468694; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852768568527685GT68527685-
NM_001876.4(CPT1A):c.2142+6T>C1374CPT1AUncertain significancers777779540RCV001317845; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852768768527687AG68527687-
NM_001876.4(CPT1A):c.2142G>A (p.Pro714=)1374CPT1AConflicting interpretations of pathogenicityrs150792109RCV000429343|RCV000792417; NMedGen:CN169374|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852769368527693CTNC_000011.9:g.68527693C>TClinGen:CA6152088CN169374 not specified;
NM_001876.4(CPT1A):c.2129G>A (p.Gly710Glu)1374CPT1APathogenic/Likely pathogenicrs80356780RCV000009638|RCV000723829; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156|MedGen:CN517202116852770668527706CT11:g.68527706C>TClinGen:CA340863,UniProtKB:P50416#VAR_020559,OMIM:600528.0011C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.2126G>A (p.Gly709Glu)1374CPT1APathogenicrs28936374RCV000009636; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852770968527709CT11:g.68527709C>TClinGen:CA340860,UniProtKB:P50416#VAR_020558,OMIM:600528.0009C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.2124C>T (p.Ser708=)1374CPT1ALikely benignrs773748237RCV000944785|RCV001503270; NMedGen:CN517202|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852771168527711GA11:g.68527711G>A-
NM_001876.4(CPT1A):c.2124C>A (p.Ser708Arg)1374CPT1AUncertain significancers773748237RCV001067757; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852771168527711GT11:g.68527711G>T-
NM_001876.4(CPT1A):c.2115C>T (p.Tyr705=)1374CPT1ALikely benign-1RCV001444926; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852772068527720GA68527720-
NM_001031847.2(CPT1A):c.(?_1744)_2107del (p.Met582Glnfs)1374CPT1APathogenic-1RCV000009635; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852772868536100nanadbVar:nssv1415013,OMIM:600528.0008C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.2103T>C (p.Asn701=)1374CPT1ALikely benign-1RCV002092575; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852773268527732AG68527732-
NM_001876.4(CPT1A):c.2100G>A (p.Glu700=)1374CPT1ABenign-1RCV001515268; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852773568527735CT68527735-
NM_001876.4(CPT1A):c.2090T>C (p.Phe697Ser)1374CPT1AUncertain significance-1RCV001947692; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852774568527745AG68527745-
NM_001876.4(CPT1A):c.2088G>C (p.Leu696=)1374CPT1ALikely benign-1RCV001399983; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852774768527747CG68527747-
NM_001876.4(CPT1A):c.2088G>A (p.Leu696=)1374CPT1ALikely benign-1RCV001396961; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852774768527747CT68527747-
NM_001876.4(CPT1A):c.2084A>G (p.Glu695Gly)1374CPT1AUncertain significance-1RCV002029592; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852775168527751TC68527751-
NM_001876.4(CPT1A):c.2082G>A (p.Val694=)1374CPT1ALikely benign-1RCV002209706; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852775368527753CT68527753-
NM_001876.4(CPT1A):c.2071C>T (p.Gln691Ter)1374CPT1APathogenic/Likely pathogenicrs765161206RCV000409477; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852776468527764GANC_000011.9:g.68527764G>AClinGen:CA6152102C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.2067C>G (p.Thr689=)1374CPT1ALikely benign-1RCV002120822; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852776868527768GC68527768-
NM_001876.4(CPT1A):c.2061C>G (p.Ser687Arg)1374CPT1ALikely pathogenicrs1269472669RCV000550330; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852777468527774GCNC_000011.9:g.68527774G>CClinGen:CA381626128C1829703 Carnitine palmitoyl transferase 1 deficiency;
NM_001876.4(CPT1A):c.2037T>C (p.Ser679=)1374CPT1ALikely benign-1RCV002183212; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852779868527798AG68527798-
NM_001876.4(CPT1A):c.2031T>A (p.Val677=)1374CPT1ALikely benign-1RCV002114622; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852780468527804AT68527804-
NM_001876.4(CPT1A):c.2029-10C>T1374CPT1ALikely benign-1RCV001398673; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852781668527816GA68527816-
NM_001876.4(CPT1A):c.2028+9C>T1374CPT1ALikely benign-1RCV002090667; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852899468528994GA68528994-
NM_001876.4(CPT1A):c.2028+7C>G1374CPT1ALikely benignrs768465007RCV001279745; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852899668528996GC11:g.68528996G>C-
NM_001876.4(CPT1A):c.2028+3_2028+6del1374CPT1APathogenicrs80356799RCV000055864; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852899768529000GACTTG11:g.68528997_68529000delClinGen:CA344980C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.2028+2T>G1374CPT1ALikely pathogenicrs1555226417RCV000668441; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852900168529001AC11:g.68529001A>C-C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.2028+1G>A1374CPT1ALikely pathogenic-1RCV001966160; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852900268529002CT68529002-
NM_001876.4(CPT1A):c.2018_2022del (p.Pro672_Phe673insTer)1374CPT1APathogenic-1RCV001906586; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852900968529013TAAGGAT68529008-
NM_001876.4(CPT1A):c.2013C>A (p.Ser671=)1374CPT1ALikely benignrs755323437RCV000903032|RCV001271631; NMedGen:CN517202|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852901868529018GT11:g.68529018G>T-
NM_001876.4(CPT1A):c.2013C>T (p.Ser671=)1374CPT1ALikely benignrs755323437RCV000979911; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852901868529018GA11:g.68529018G>A-
NM_001876.4(CPT1A):c.2010G>A (p.Glu670=)1374CPT1ALikely benign-1RCV001445910; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852902168529021CT68529021-
NM_001876.4(CPT1A):c.2005G>T (p.Val669Leu)1374CPT1AUncertain significance-1RCV001986526; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852902668529026CA68529026-
NM_001876.4(CPT1A):c.2004T>C (p.Ala668=)1374CPT1ABenignrs2228503RCV000185823|RCV000639505; NMedGen:CN169374|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852902768529027AGNC_000011.9:g.68529027A>GClinGen:CA312410C1829703 Carnitine palmitoyl transferase 1 deficiency;
NM_001876.4(CPT1A):c.2001C>T (p.Leu667=)1374CPT1ALikely benign-1RCV001403793; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852903068529030GA68529030-
NM_001876.4(CPT1A):c.1997_1998insAAAA (p.Tyr666Ter)1374CPT1APathogenic/Likely pathogenicrs1057516800RCV000409196; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852903368529034AATTTTNC_000011.9:g.68529034_68529035insTTTTClinGen:CA16041534C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.1984dup (p.Val662fs)1374CPT1APathogenic-1RCV001951139; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852904668529047AAC68529046-
NM_001876.4(CPT1A):c.1983C>T (p.Tyr661=)1374CPT1ALikely benignrs374136875RCV000443677|RCV000939361; NMedGen:CN169374|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852904868529048GA11:g.68529048G>AClinGen:CA6152137CN169374 not specified;
NM_001876.4(CPT1A):c.1970T>C (p.Leu657Pro)1374CPT1AUncertain significancers1854618343RCV001072099; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852906168529061AG11:g.68529061A>G-
NM_001876.4(CPT1A):c.1967A>G (p.His656Arg)1374CPT1AUncertain significance-1RCV002008737; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852906468529064TC68529064-
NM_001876.4(CPT1A):c.1960G>A (p.Asp654Asn)1374CPT1AUncertain significance-1RCV001563775; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852907168529071CT68529071-
NM_001876.4(CPT1A):c.1959C>T (p.Ile653=)1374CPT1ALikely benignrs556392764RCV000937970; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852907268529072GA11:g.68529072G>A-
NM_001876.4(CPT1A):c.1948G>A (p.Gly650Ser)1374CPT1AUncertain significance-1RCV001954695; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852908368529083CT68529083-
NM_001876.4(CPT1A):c.1947C>T (p.Thr649=)1374CPT1ALikely benign-1RCV001477865; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852908468529084GA68529084-
NM_001876.4(CPT1A):c.1947C>G (p.Thr649=)1374CPT1ALikely benign-1RCV001466448; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852908468529084GC68529084-
NM_001876.4(CPT1A):c.1946C>T (p.Thr649Ile)1374CPT1AUncertain significance-1RCV001941235; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852908568529085GA68529085-
NM_001876.4(CPT1A):c.1941C>G (p.Ala647=)1374CPT1ABenignrs115731492RCV000185822|RCV000639503; NMedGen:CN169374|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852909068529090GC11:g.68529090G>CClinGen:CA312407C1829703 Carnitine palmitoyl transferase 1 deficiency;
NM_001876.4(CPT1A):c.1933C>T (p.Arg645Cys)1374CPT1AUncertain significance-1RCV001933335; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852909868529098GA68529098-
NM_001876.4(CPT1A):c.1923G>A (p.Gln641=)1374CPT1ALikely benign-1RCV002072660; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852910868529108CT68529108-
NM_001876.4(CPT1A):c.1912G>A (p.Glu638Lys)1374CPT1AUncertain significance-1RCV001958299; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852911968529119CT68529119-
NM_001876.4(CPT1A):c.1910C>T (p.Ser637Phe)1374CPT1ALikely benignrs150459546RCV000899458; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852912168529121GA11:g.68529121G>A-
NM_001876.4(CPT1A):c.1908G>A (p.Ala636=)1374CPT1ABenignrs111407620RCV000315030|RCV000872599; NMedGen:CN169374|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852912368529123CT11:g.68529123C>TClinGen:CA6152154CN169374 not specified;
NM_001876.4(CPT1A):c.1907C>T (p.Ala636Val)1374CPT1AUncertain significancers775438656RCV001061474; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852912468529124GA11:g.68529124G>A-
NM_001876.4(CPT1A):c.1903T>C (p.Leu635=)1374CPT1ALikely benignrs372215145RCV000944020; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852912868529128AG11:g.68529128A>G-
NM_001876.4(CPT1A):c.1902G>A (p.Lys634=)1374CPT1ALikely benign-1RCV002182785; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852912968529129CT68529129-
NM_001876.4(CPT1A):c.1901A>G (p.Lys634Arg)1374CPT1AUncertain significancers1854622463RCV001279746; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852913068529130TC11:g.68529130T>C-
NM_001876.4(CPT1A):c.1895T>A (p.Leu632Ter)1374CPT1APathogenic-1RCV001386789; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852913668529136AT68529136-
NM_001876.4(CPT1A):c.1890G>A (p.Leu630=)1374CPT1ALikely benign-1RCV001439760; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852914168529141CT68529141-
NM_001876.4(CPT1A):c.1877T>C (p.Val626Ala)1374CPT1AUncertain significancers768746064RCV001203365; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852915468529154AG11:g.68529154A>G-
NM_001876.4(CPT1A):c.1876G>C (p.Val626Leu)1374CPT1AUncertain significance-1RCV001583352|RCV001866114; NMedGen:CN517202|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852915568529155CG68529155-
NM_001876.4(CPT1A):c.1876-1G>A1374CPT1ALikely pathogenicrs80356798RCV000009634; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852915668529156CTNC_000011.9:g.68529156C>TClinGen:CA340858,OMIM:600528.0006C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.1876-1G>C1374CPT1ALikely pathogenicrs80356798RCV000671989; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116852915668529156CG11:g.68529156C>G-C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.1875+10_1875+33del1374CPT1ALikely benignrs1555226542RCV000671135; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116853006268530085AGCACGTTGTGTCCTCAGCCTGATGA11:g.68530062_68530085del-C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.1875+11A>G1374CPT1ALikely benign-1RCV002165862; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116853008468530084TC68530084-
NM_001876.4(CPT1A):c.1874C>T (p.Thr625Met)1374CPT1AUncertain significancers142473901RCV001233973; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116853009668530096GA11:g.68530096G>A-
NM_001876.4(CPT1A):c.1869C>T (p.Ala623=)1374CPT1ALikely benign-1RCV001473976; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116853010168530101GA68530101-
NM_001876.4(CPT1A):c.1869C>A (p.Ala623=)1374CPT1ALikely benign-1RCV002138930; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116853010168530101GT68530101-
NM_001876.4(CPT1A):c.1866G>A (p.Pro622=)1374CPT1ALikely benign-1RCV002098678; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116853010468530104CT68530104-
NM_001876.4(CPT1A):c.1865C>T (p.Pro622Leu)1374CPT1AUncertain significancers776782808RCV001244969; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116853010568530105GA11:g.68530105G>A-
NM_001876.4(CPT1A):c.1854C>A (p.Ala618=)1374CPT1ALikely benign-1RCV002137204; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116853011668530116GT68530116-
NM_001876.4(CPT1A):c.1854C>T (p.Ala618=)1374CPT1ALikely benign-1RCV002218315; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116853011668530116GA68530116-
NM_001876.4(CPT1A):c.1851G>A (p.Arg617=)1374CPT1ALikely benign-1RCV002101972; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116853011968530119CT68530119-
NM_001876.4(CPT1A):c.1850G>A (p.Arg617Gln)1374CPT1AUncertain significancers375224809RCV001240087; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116853012068530120CT11:g.68530120C>T-
NM_001876.4(CPT1A):c.1848G>A (p.Val616=)1374CPT1ALikely benign-1RCV001413512; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116853012268530122CT68530122-
NM_001876.4(CPT1A):c.1845C>T (p.Phe615=)1374CPT1ALikely benignrs144747588RCV000926578; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116853012568530125GA11:g.68530125G>A-
NM_001876.4(CPT1A):c.1840G>A (p.Asp614Asn)1374CPT1AUncertain significancers200893871RCV001278052; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116853013068530130CT11:g.68530130C>T-
NM_001876.4(CPT1A):c.1830T>G (p.Thr610=)1374CPT1ALikely benign-1RCV002094268; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116853014068530140AC68530140-
NM_001876.4(CPT1A):c.1818C>T (p.Arg606=)1374CPT1ALikely benign-1RCV001503325; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116853015268530152GA68530152-
NM_001876.4(CPT1A):c.1813G>A (p.Val605Met)1374CPT1AUncertain significance-1RCV002005779; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116853015768530157CT68530157-
NM_001876.4(CPT1A):c.1812C>T (p.Thr604=)1374CPT1ALikely benign-1RCV001425466; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116853015868530158GA68530158-
NM_001876.4(CPT1A):c.1806G>A (p.Thr602=)1374CPT1ALikely benignrs866075317RCV000877579; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116853016468530164CT11:g.68530164C>T-
NM_001876.4(CPT1A):c.1800G>A (p.Gly600=)1374CPT1ALikely benign-1RCV001463772; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116853017068530170CT68530170-
NM_001876.4(CPT1A):c.1799G>C (p.Gly600Ala)1374CPT1AUncertain significance-1RCV002017725; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116853017168530171CG68530171-
NM_001876.4(CPT1A):c.1793G>A (p.Arg598Gln)1374CPT1AUncertain significancers878856345RCV001247132; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116853017768530177CT11:g.68530177C>T-
NM_001876.4(CPT1A):c.1792C>T (p.Arg598Ter)1374CPT1APathogenicrs773153659RCV000814512; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116853017868530178GA11:g.68530178G>A-
NM_001876.4(CPT1A):c.1788C>T (p.Leu596=)1374CPT1ALikely benign-1RCV001403023; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116853018268530182GA68530182-
NM_001876.4(CPT1A):c.1782C>T (p.Thr594=)1374CPT1ALikely benign-1RCV002156600; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116853018868530188GA68530188-
NM_001876.4(CPT1A):c.1770G>A (p.Glu590=)1374CPT1AConflicting interpretations of pathogenicityrs61731905RCV000505913|RCV000693494; NMedGen:CN517202|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116853020068530200CTNC_000011.9:g.68530200C>TClinGen:CA6152202C1829703 Carnitine palmitoyl transferase 1 deficiency;
NM_001876.4(CPT1A):c.1767C>T (p.Tyr589=)1374CPT1ALikely benign-1RCV001448299; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116853020368530203GA68530203-
NM_001876.4(CPT1A):c.1762_1766dup (p.Tyr589Ter)1374CPT1APathogenic-1RCV002000046; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116853020368530204GGTATGT68530203-
NM_001876.4(CPT1A):c.1745T>G (p.Met582Arg)1374CPT1AUncertain significance-1RCV001883984; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116853022568530225AC68530225-
NM_001876.4(CPT1A):c.1743C>T (p.Asp581=)1374CPT1ALikely benign-1RCV002153706; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116853022768530227GA68530227-
NM_001876.4(CPT1A):c.1741-4C>G1374CPT1ALikely benign-1RCV001393754; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116853023368530233GC68530233-
NM_001876.4(CPT1A):c.1741-4C>T1374CPT1ALikely benign-1RCV002171876; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116853023368530233GA68530233-
NM_001876.4(CPT1A):c.1741-8T>C1374CPT1ALikely benign-1RCV001442441; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116853023768530237AG68530237-
NM_001876.4(CPT1A):c.1741-15C>T1374CPT1ALikely benign-1RCV002141910; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116853024468530244GA68530244-
NC_000011.9:g.(?_68540723)_(68549437_?)dup1374CPT1ALikely pathogenic-1RCV002035984; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854072368549437nana-1-
NM_001876.4(CPT1A):c.1740+10G>A1374CPT1ALikely benign-1RCV002167217; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854072368540723CT68540723-
NM_001876.4(CPT1A):c.1737C>A (p.Tyr579Ter)1374CPT1Anot providedrs80356785RCV000055862; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854073668540736GT11:g.68540736G>TClinGen:CA344977C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.1731G>A (p.Ala577=)1374CPT1ALikely benign-1RCV001482769; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854074268540742CT68540742-
NM_001876.4(CPT1A):c.1728G>A (p.Leu576=)1374CPT1ALikely benign-1RCV001395169; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854074568540745CT68540745-
NM_001876.4(CPT1A):c.1728G>T (p.Leu576=)1374CPT1ALikely benign-1RCV002111175; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854074568540745CA68540745-
NM_001876.4(CPT1A):c.1720C>T (p.Leu574Phe)1374CPT1AUncertain significancers1484699196RCV001053393; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854075368540753GA11:g.68540753G>A-
NM_001876.4(CPT1A):c.1719C>T (p.Ala573=)1374CPT1ALikely benign-1RCV001413158; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854075468540754GA68540754-
NM_001876.4(CPT1A):c.1711C>T (p.Gln571Ter)1374CPT1ALikely pathogenicrs1057516586RCV000409010; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854076268540762GA11:g.68540762G>AClinGen:CA16041535C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.1709_1710del (p.Val570fs)1374CPT1APathogenic-1RCV001389218; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854076368540764GCAG68540762-
NM_001876.4(CPT1A):c.1704C>T (p.Ala568=)1374CPT1AUncertain significancers1855045353RCV001278053; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854076968540769GA11:g.68540769G>A-
NM_001876.4(CPT1A):c.1702G>T (p.Ala568Ser)1374CPT1AUncertain significancers1046804RCV001042882; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854077168540771CA11:g.68540771C>A-
NM_001876.4(CPT1A):c.1694G>T (p.Ser565Ile)1374CPT1AUncertain significancers200826577RCV001210350; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854077968540779CA11:g.68540779C>A-
NM_001876.4(CPT1A):c.1692G>A (p.Thr564=)1374CPT1ALikely benign-1RCV001434676; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854078168540781CT68540781-
NM_001876.4(CPT1A):c.1686T>C (p.Cys562=)1374CPT1ALikely benign-1RCV001461091; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854078768540787AG68540787-
NM_001876.4(CPT1A):c.1677C>T (p.Ile559=)1374CPT1ALikely benign-1RCV002220533; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854079668540796GA68540796-
NM_001876.4(CPT1A):c.1675A>G (p.Ile559Val)1374CPT1AUncertain significance-1RCV001361587; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854079868540798TC68540798-
NM_001876.4(CPT1A):c.1662T>C (p.Phe554=)1374CPT1ALikely benign-1RCV001422235; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854081168540811AG68540811-
NM_001876.4(CPT1A):c.1658C>T (p.Ala553Val)1374CPT1AUncertain significance-1RCV002004801; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854081568540815GA68540815-
NM_001876.4(CPT1A):c.1656A>G (p.Val552=)1374CPT1ALikely benignrs1594326863RCV000979380|RCV001433743; NMedGen:CN517202|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854081768540817TC11:g.68540817T>C-
NM_001876.4(CPT1A):c.1654G>A (p.Val552Ile)1374CPT1AUncertain significancers764692013RCV000800466; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854081968540819CT11:g.68540819C>T-
NM_001876.4(CPT1A):c.1653C>T (p.Phe551=)1374CPT1ALikely benignrs1314725177RCV001278054; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854082068540820GA11:g.68540820G>A-
NM_001876.4(CPT1A):c.1650A>G (p.Pro550=)1374CPT1ALikely benign-1RCV001410204; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854082368540823TC68540823-
NM_001876.4(CPT1A):c.1644C>T (p.Ser548=)1374CPT1ALikely benignrs775058970RCV000922989; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854082968540829GA11:g.68540829G>A-
NM_001876.4(CPT1A):c.1630G>A (p.Val544Met)1374CPT1AUncertain significance-1RCV001991761; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854084368540843CT68540843-
NM_001876.4(CPT1A):c.1620G>C (p.Leu540=)1374CPT1ALikely benign-1RCV002079330; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854085368540853CG68540853-
NM_001876.4(CPT1A):c.1614T>C (p.Asn538=)1374CPT1ALikely benign-1RCV002194904; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854085968540859AG68540859-
NM_001876.4(CPT1A):c.1608C>T (p.Thr536=)1374CPT1ALikely benign-1RCV001503193; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854086568540865GA68540865-
NM_001876.4(CPT1A):c.1600del (p.Ser533_Leu534insTer)1374CPT1Anot providedrs80356801RCV000055861; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854087368540873AGA11:g.68540873_68540873delClinGen:CA344976C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.1597T>C (p.Ser533Pro)1374CPT1AUncertain significancers1855050882RCV001278055; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854087668540876AG11:g.68540876A>G-
NM_001876.4(CPT1A):c.1596C>G (p.Thr532=)1374CPT1ALikely benign-1RCV002163225; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854087768540877GC68540877-
NM_001876.4(CPT1A):c.1581A>G (p.Gln527=)1374CPT1ALikely benign-1RCV002082846; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854089268540892TC68540892-
NM_001876.4(CPT1A):c.1576-2A>G1374CPT1ALikely pathogenicrs1555227607RCV000674220; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854089968540899TC11:g.68540899T>C-C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.1576-11T>G1374CPT1ALikely benign-1RCV002093484; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854090868540908AC68540908-
NM_001876.4(CPT1A):c.1575+517_1575+521dup1374CPT1AUncertain significancers1169875761RCV001278056; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854224968542250CCAAAAA11:g.68542249_68542250insAAAAA-
NM_001876.4(CPT1A):c.1575+533_1575+534del1374CPT1APathogenicrs1169875761RCV000009631; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854225068542251CAACNC_000011.9:g.68542266_68542267delClinGen:CA340852,OMIM:600528.0007C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.1575+10G>A1374CPT1ALikely benign-1RCV001400013; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854277468542774CT68542774-
NM_001876.4(CPT1A):c.1575+9G>A1374CPT1ALikely benign-1RCV001476480; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854277568542775CT68542775-
NM_001876.4(CPT1A):c.1575+8C>T1374CPT1ABenign/Likely benignrs372364901RCV000608847|RCV000896489; NMedGen:CN169374|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854277668542776GA11:g.68542776G>AClinGen:CA6152270CN169374 not specified;
NM_001876.4(CPT1A):c.1575+1G>A1374CPT1ALikely pathogenicrs1282293820RCV000666394; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854278368542783CT11:g.68542783C>T-C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.1573dup (p.Glu525fs)1374CPT1APathogenic-1RCV001970195; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854278568542786TTC68542785-
NM_001876.4(CPT1A):c.1569G>A (p.Pro523=)1374CPT1ALikely benign-1RCV001473340; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854279068542790CT68542790-
NM_001876.4(CPT1A):c.1569G>C (p.Pro523=)1374CPT1ALikely benign-1RCV002109140; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854279068542790CG68542790-
NM_001876.4(CPT1A):c.1567C>G (p.Pro523Ala)1374CPT1AUncertain significance-1RCV001909784; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854279268542792GC68542792-
NM_001876.4(CPT1A):c.1563C>T (p.Asp521=)1374CPT1ALikely benignrs757551678RCV000943036|RCV001463582; NMedGen:CN517202|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854279668542796GA11:g.68542796G>A-
NM_001876.4(CPT1A):c.1557G>A (p.Gln519=)1374CPT1ALikely benignrs149983153RCV000540126; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854280268542802CTNC_000011.9:g.68542802C>TClinGen:CA6152279C1829703 Carnitine palmitoyl transferase 1 deficiency;
NM_001876.4(CPT1A):c.1539G>A (p.Pro513=)1374CPT1ALikely benignrs371923903RCV000873331; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854282068542820CT11:g.68542820C>T-
NM_001876.4(CPT1A):c.1530G>A (p.Pro510=)1374CPT1ALikely benign-1RCV001476903; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854282968542829CT68542829-
NM_001876.4(CPT1A):c.1529C>T (p.Pro510Leu)1374CPT1ABenignrs61731906RCV000419074|RCV000525124; NMedGen:CN169374|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854283068542830GA11:g.68542830G>AClinGen:CA6152285C1829703 Carnitine palmitoyl transferase 1 deficiency;
NM_001876.4(CPT1A):c.1528C>T (p.Pro510Ser)1374CPT1AUncertain significancers1279443212RCV001197737; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854283168542831GA11:g.68542831G>A-
NM_001876.4(CPT1A):c.1518C>T (p.Gly506=)1374CPT1AUncertain significancers573112017RCV001301992; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854284168542841GA68542841-
NM_001876.4(CPT1A):c.1509C>T (p.His503=)1374CPT1ALikely benign-1RCV002087101; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854285068542850GA68542850-
NM_001876.4(CPT1A):c.1500G>A (p.Glu500=)1374CPT1ALikely benignrs760474415RCV001278057; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854285968542859CT11:g.68542859C>T-
NM_001876.4(CPT1A):c.1496C>T (p.Ala499Val)1374CPT1AUncertain significancers753866589RCV000795564|RCV000994678; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156|MedGen:CN517202116854286368542863GA11:g.68542863G>A-
NM_001876.4(CPT1A):c.1494T>A (p.Tyr498Ter)1374CPT1Anot providedrs80356795RCV000055859; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854286568542865AT11:g.68542865A>TClinGen:CA344972C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.1493A>G (p.Tyr498Cys)1374CPT1AConflicting interpretations of pathogenicityrs80356791RCV000009633; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854286668542866TC11:g.68542866T>CClinGen:CA340856,UniProtKB:P50416#VAR_020557,OMIM:600528.0005C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.1488G>A (p.Leu496=)1374CPT1ALikely benign-1RCV002137792; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854287168542871CT68542871-
NM_001876.4(CPT1A):c.1465A>G (p.Met489Val)1374CPT1AUncertain significance-1RCV002006013; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854289468542894TC68542894-
NM_001876.4(CPT1A):c.1461C>T (p.Tyr487=)1374CPT1ALikely benignrs757568196RCV000424215|RCV000917962; NMedGen:CN169374|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854289868542898GA11:g.68542898G>AClinGen:CA6152293CN169374 not specified;
NM_001876.4(CPT1A):c.1459T>G (p.Tyr487Asp)1374CPT1AUncertain significance-1RCV002023655; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854290068542900AC68542900-
NM_001876.4(CPT1A):c.1459-1G>A1374CPT1ALikely pathogenicrs1057517046RCV001037328; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854290168542901CT11:g.68542901C>TClinGen:CA16041536C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.1459-6dup1374CPT1ALikely benignrs767372374RCV000927849|RCV001273374; NMedGen:CN517202|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854290568542906CCA11:g.68542905_68542906insA-
NC_000011.9:g.(?_68548098)_(68552488_?)dup1374CPT1ALikely pathogenic-1RCV002006721; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854809868552488nana-1-
NC_000011.9:g.(?_68548098)_(68548223_?)del1374CPT1APathogenic-1RCV001970042; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854809868548223nana-1-
NM_001876.4(CPT1A):c.1458+8T>G1374CPT1ALikely benign-1RCV001437061; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854810068548100AC68548100-
NM_001876.4(CPT1A):c.1458+1G>A1374CPT1ALikely pathogenicrs1555228470RCV000669248; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854810768548107CT11:g.68548107C>T-C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.1451T>C (p.Leu484Pro)1374CPT1Anot providedrs80356793RCV000055858; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854811568548115AG11:g.68548115A>GClinGen:CA344970,UniProtKB:P50416#VAR_020556C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.1449C>A (p.His483Gln)1374CPT1AUncertain significancers1165511243RCV001052557|RCV001759787; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156|MedGen:CN517202116854811768548117GT11:g.68548117G>T-
NM_001876.4(CPT1A):c.1440C>T (p.Ile480=)1374CPT1ALikely benign-1RCV001502077; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854812668548126GA68548126-
NM_001876.4(CPT1A):c.1437G>A (p.Pro479=)1374CPT1ALikely benignrs554525176RCV000639506; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854812968548129CT11:g.68548129C>TClinGen:CA6152308C1829703 Carnitine palmitoyl transferase 1 deficiency;
NM_001876.4(CPT1A):c.1437G>C (p.Pro479=)1374CPT1ALikely benign-1RCV002093321; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854812968548129CG68548129-
NM_001876.4(CPT1A):c.1436C>T (p.Pro479Leu)1374CPT1APathogenicrs80356779RCV000079911|RCV000551382|RCV000714476|RCV000714477; NMedGen:CN517202|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156||116854813068548130GA11:g.68548130G>AClinGen:CA221853,UniProtKB:P50416#VAR_020555,OMIM:600528.0012C1829703 Carnitine palmitoyl transferase 1 deficiency;
NM_001876.4(CPT1A):c.1434G>A (p.Ala478=)1374CPT1ALikely benign-1RCV001405211; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854813268548132CT68548132-
NM_001876.4(CPT1A):c.1433C>T (p.Ala478Val)1374CPT1AUncertain significance-1RCV002009258; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854813368548133GA68548133-
NM_001876.4(CPT1A):c.1425G>A (p.Trp475Ter)1374CPT1Anot providedrs80356794RCV000055856; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854814168548141CT11:g.68548141C>TClinGen:CA344967C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.1410C>T (p.Asn470=)1374CPT1ALikely benign-1RCV001403771; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854815668548156GA68548156-
NM_001876.4(CPT1A):c.1405C>T (p.Leu469Phe)1374CPT1AUncertain significancers1315026195RCV001239268; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854816168548161GA11:g.68548161G>A-
NM_001876.4(CPT1A):c.1395G>T (p.Gly465=)1374CPT1Anot provided-1RCV002052303; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854817168548171CA68548171-
NM_001876.4(CPT1A):c.1395G>A (p.Gly465=)1374CPT1ALikely benign-1RCV002155800; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854817168548171CT68548171-
NM_001876.4(CPT1A):c.1395G>C (p.Gly465=)1374CPT1ALikely benign-1RCV002210626; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854817168548171CG68548171-
NM_001876.4(CPT1A):c.1393G>T (p.Gly465Trp)1374CPT1APathogenicrs80356784RCV000055855; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854817368548173CA11:g.68548173C>AClinGen:CA344965,UniProtKB:P50416#VAR_046769C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.1393G>A (p.Gly465Arg)1374CPT1AUncertain significancers80356784RCV000666810; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854817368548173CT11:g.68548173C>T-C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.1392C>T (p.Asn464=)1374CPT1ALikely benignrs138700687RCV000937847|RCV001697880; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156|MedGen:CN517202116854817468548174GA11:g.68548174G>AClinGen:CA6152315CN169374 not specified;
NM_001876.4(CPT1A):c.1386del (p.Phe462fs)1374CPT1ALikely pathogenicrs753776604RCV000410594; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854818068548180TGT11:g.68548180_68548180delClinGen:CA6152316C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.1386C>A (p.Phe462Leu)1374CPT1AUncertain significance-1RCV002043758; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854818068548180GT68548180-
NM_001876.4(CPT1A):c.1383C>T (p.Val461=)1374CPT1ALikely benign-1RCV001437547; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854818368548183GA68548183-
NM_001876.4(CPT1A):c.1374G>A (p.Thr458=)1374CPT1ALikely benign-1RCV001410973; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854819268548192CT68548192-
NM_001876.4(CPT1A):c.1368G>A (p.Ser456=)1374CPT1ALikely benign-1RCV001460206; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854819868548198CT68548198-
NM_001876.4(CPT1A):c.1368G>C (p.Ser456=)1374CPT1ALikely benign-1RCV002079748; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854819868548198CG68548198-
NM_001876.4(CPT1A):c.1367C>T (p.Ser456Leu)1374CPT1AUncertain significancers1478167106RCV001203077; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854819968548199GA11:g.68548199G>A-C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.1367C>A (p.Ser456Ter)1374CPT1APathogenic-1RCV001882012; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854819968548199GT68548199-
NM_001876.4(CPT1A):c.1364A>C (p.Lys455Thr)1374CPT1ALikely pathogenicrs189174414RCV000169575; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854820268548202TGNC_000011.9:g.68548202T>GClinGen:CA274426C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.1361A>G (p.Asp454Gly)1374CPT1APathogenicrs80356778RCV000009628; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854820568548205TC11:g.68548205T>CClinGen:CA340848,UniProtKB:P50416#VAR_020554,OMIM:600528.0001C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.1353-4G>A1374CPT1ALikely benignrs577271875RCV000426803|RCV002059836; NMedGen:CN169374|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854821768548217CT11:g.68548217C>TClinGen:CA6152324CN169374 not specified;
NM_001876.4(CPT1A):c.1353-4G>T1374CPT1ALikely benign-1RCV002201030; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854821768548217CA68548217-
NM_001876.4(CPT1A):c.1353-5C>T1374CPT1ALikely benign-1RCV001480109; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854821868548218GA68548218-
NM_001876.4(CPT1A):c.1353-8T>C1374CPT1ALikely benign-1RCV002137332; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854822168548221AG68548221-
NM_001876.4(CPT1A):c.1353-15G>A1374CPT1ALikely benign-1RCV002006846; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854822868548228CT68548228-
NM_001876.4(CPT1A):c.1353-17_1353-16del1374CPT1AUncertain significance-1RCV002050065; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854822968548230CATC68548228-
NM_001876.4(CPT1A):c.1353-47G>T1374CPT1ABenign-1RCV001533355|RCV001647370; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156|MedGen:CN517202116854826068548260CA68548260-
NM_001876.4(CPT1A):c.1352+6G>A1374CPT1AUncertain significancers541440067RCV001067804; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854923368549233CT11:g.68549233C>T-
NM_001876.4(CPT1A):c.1348_1352+4del1374CPT1ALikely pathogenicrs1555228640RCV000665000; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854923568549243GGTACCTGTCG11:g.68549235_68549243del-C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.1350C>T (p.Asp450=)1374CPT1ALikely benign-1RCV002150979; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854924168549241GA68549241-
NM_001876.4(CPT1A):c.1348G>A (p.Asp450Asn)1374CPT1AUncertain significance-1RCV001945386; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854924368549243CT68549243-
NM_001876.4(CPT1A):c.1347C>T (p.Tyr449=)1374CPT1ALikely benign-1RCV001490618; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854924468549244GA68549244-
NM_001876.4(CPT1A):c.1340G>A (p.Arg447Gln)1374CPT1AUncertain significancers757593086RCV001278058; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854925168549251CT11:g.68549251C>T-
NM_001876.4(CPT1A):c.1339C>T (p.Arg447Ter)1374CPT1APathogenicrs397515543RCV000055854; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854925268549252GA11:g.68549252G>AClinGen:CA344962C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.1335C>T (p.His445=)1374CPT1ALikely benign-1RCV001442694; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854925668549256GA68549256-
NM_001876.4(CPT1A):c.1328dup (p.Leu444fs)1374CPT1APathogenic-1RCV001941664; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854926268549263TTA68549262-
NM_001876.4(CPT1A):c.1329A>G (p.Leu443=)1374CPT1ALikely benign-1RCV002119063; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854926268549262TC68549262-
NM_001876.4(CPT1A):c.1325C>A (p.Ser442Tyr)1374CPT1AUncertain significance-1RCV002051107; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854926668549266GT68549266-
NM_001876.4(CPT1A):c.1323A>G (p.Lys441=)1374CPT1ALikely benign-1RCV001428078; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854926868549268TC68549268-
NM_001876.4(CPT1A):c.1320C>T (p.Ala440=)1374CPT1ALikely benign-1RCV001491024; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854927168549271GA68549271-
NM_001876.4(CPT1A):c.1317C>T (p.Tyr439=)1374CPT1ALikely benignrs140332936RCV001278059; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854927468549274GA11:g.68549274G>A-
NM_001876.4(CPT1A):c.1302G>A (p.Thr434=)1374CPT1ALikely benignrs1424284180RCV000841296|RCV001413559; NMedGen:CN517202|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854928968549289CT11:g.68549289C>T-
NM_001876.4(CPT1A):c.1298del (p.Asp433fs)1374CPT1ALikely pathogenicrs1057516304RCV000410094; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854929368549293ATANC_000011.9:g.68549293delClinGen:CA16041537C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.1296G>A (p.Pro432=)1374CPT1ALikely benignrs756320661RCV000944900; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854929568549295CT11:g.68549295C>T-
NM_001876.4(CPT1A):c.1296G>C (p.Pro432=)1374CPT1ALikely benign-1RCV001443619; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854929568549295CG68549295-
NM_001876.4(CPT1A):c.1284A>G (p.Arg428=)1374CPT1ALikely benign-1RCV001472231; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854930768549307TC68549307-
NM_001876.4(CPT1A):c.1271AAG[1] (p.Glu425del)1374CPT1AUncertain significancers747376723RCV000664961; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854931568549317CCTTC11:g.68549315_68549317del-C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.1269T>C (p.Thr423=)1374CPT1ALikely benign-1RCV002209264; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854932268549322AG68549322-
NM_001876.4(CPT1A):c.1268C>T (p.Thr423Ile)1374CPT1AUncertain significancers1198520664RCV001278060; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854932368549323GA11:g.68549323G>A-
NM_001876.4(CPT1A):c.1257G>A (p.Thr419=)1374CPT1ALikely benignrs764443409RCV000600810|RCV000873669; NMedGen:CN169374|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854933468549334CT11:g.68549334C>TClinGen:CA6152365CN169374 not specified;
NM_001876.4(CPT1A):c.1251= (p.Phe417=)1374CPT1ABenignrs2228502RCV000124600|RCV000536914; NMedGen:CN169374|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854934068549340AANC_000011.9:g.68549340%3DClinGen:CA290510C1829703 Carnitine palmitoyl transferase 1 deficiency;
NM_001876.4(CPT1A):c.1251T>C (p.Phe417=)1374CPT1ABenignrs2228502RCV000153103|RCV001520685; NMedGen:CN169374|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854934068549340AG11:g.68549340A>GClinGen:CA179929CN169374 not specified;
NM_001876.4(CPT1A):c.1245G>A (p.Ala415=)1374CPT1ALikely benignrs750166396RCV000929887; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854934668549346CT11:g.68549346C>T-
NM_001876.4(CPT1A):c.1244C>T (p.Ala415Val)1374CPT1AUncertain significance-1RCV001563777; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854934768549347GA68549347-
NM_001876.4(CPT1A):c.1241C>T (p.Ala414Val)1374CPT1ALikely pathogenicrs80356790RCV000009632; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854935068549350GA11:g.68549350G>AClinGen:CA340854,UniProtKB:P50416#VAR_020553,OMIM:600528.0004C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.1239A>G (p.Lys413=)1374CPT1ALikely benign-1RCV002153762; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854935268549352TC68549352-
NM_001876.4(CPT1A):c.1234G>A (p.Glu412Lys)1374CPT1ALikely pathogenic-1RCV002210939; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854935768549357CT68549357-
NM_001876.4(CPT1A):c.1227T>C (p.Asp409=)1374CPT1ALikely benign-1RCV002083422; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854936468549364AG68549364-
NM_001876.4(CPT1A):c.1216C>T (p.Gln406Ter)1374CPT1APathogenicrs1594334937RCV000799501; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854937568549375GA11:g.68549375G>A-
NM_001876.4(CPT1A):c.1215G>A (p.Lys405=)1374CPT1ALikely benign-1RCV001441490; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854937668549376CT68549376-
NM_001876.4(CPT1A):c.1199G>C (p.Gly400Ala)1374CPT1AUncertain significancers889632692RCV000797134; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854939268549392CG11:g.68549392C>G-
NM_001876.4(CPT1A):c.1192T>C (p.Tyr398His)1374CPT1AUncertain significance-1RCV001895586; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854939968549399AG68549399-
NM_001876.4(CPT1A):c.1183C>T (p.Arg395Cys)1374CPT1AUncertain significance-1RCV001364399; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116854940868549408GA68549408-
NM_001876.4(CPT1A):c.1163+8G>A1374CPT1ALikely benign-1RCV002207143; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116855227568552275CT68552275-
NM_001876.4(CPT1A):c.1163+5G>A1374CPT1ALikely benignrs140999795RCV000526735; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116855227868552278CTNC_000011.9:g.68552278C>TClinGen:CA6152400C1829703 Carnitine palmitoyl transferase 1 deficiency;
NM_001876.4(CPT1A):c.1163+2T>C1374CPT1ALikely pathogenicrs1555229059RCV000664629; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116855228168552281AG11:g.68552281A>G-C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.1163+1G>A1374CPT1APathogenicrs148059333RCV000548200; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116855228268552282CT11:g.68552282C>TClinGen:CA6152404C1829703 Carnitine palmitoyl transferase 1 deficiency;
NM_001876.4(CPT1A):c.1152C>T (p.Thr384=)1374CPT1ALikely benign-1RCV001495959; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116855229468552294GA68552294-
NM_001876.4(CPT1A):c.1131G>A (p.Glu377=)1374CPT1ALikely benign-1RCV002157781; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116855231568552315CT68552315-
NM_001876.4(CPT1A):c.1113G>A (p.Ser371=)1374CPT1AUncertain significance-1RCV001888160; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116855233368552333CT68552333-
NM_001876.4(CPT1A):c.1112C>T (p.Ser371Leu)1374CPT1AUncertain significancers376430455RCV001197738; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116855233468552334GA11:g.68552334G>A-
NM_001876.4(CPT1A):c.1110C>T (p.Thr370=)1374CPT1ALikely benign-1RCV001392700; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116855233668552336GA68552336-
NM_001876.4(CPT1A):c.1104C>T (p.Asp368=)1374CPT1ALikely benign-1RCV001437417; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116855234268552342GA68552342-
NM_001876.4(CPT1A):c.1099C>T (p.Leu367=)1374CPT1ALikely benign-1RCV002182581; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116855234768552347GA68552347-
NM_001876.4(CPT1A):c.1098C>A (p.Ile366=)1374CPT1ALikely benign-1RCV001484440; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116855234868552348GT68552348-
NM_001876.4(CPT1A):c.1092G>A (p.Gln364=)1374CPT1AConflicting interpretations of pathogenicityrs199640034RCV000351929|RCV001089338; NMedGen:CN517202|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116855235468552354CT11:g.68552354C>TClinGen:CA6152420CN169374 not specified;
NM_001876.4(CPT1A):c.1083G>A (p.Gln361=)1374CPT1ALikely benign-1RCV001423880; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116855236368552363CT68552363-
NM_001876.4(CPT1A):c.1080G>A (p.Glu360=)1374CPT1ALikely benign-1RCV002163450; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116855236668552366CT68552366-
NM_001876.4(CPT1A):c.1079A>G (p.Glu360Gly)1374CPT1APathogenicrs80356787RCV000009629; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116855236768552367TC11:g.68552367T>CClinGen:CA340850,UniProtKB:P50416#VAR_020551,OMIM:600528.0002C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.1077G>A (p.Met359Ile)1374CPT1AUncertain significancers1432015707RCV000755990|RCV001274164; NMedGen:CN517202|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116855236968552369CTNC_000011.9:g.68552369C>T-
NM_001876.4(CPT1A):c.1069C>T (p.Arg357Trp)1374CPT1ALikely pathogenicrs80356777RCV000055853; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116855237768552377GA11:g.68552377G>AClinGen:CA344960,UniProtKB:P50416#VAR_020550C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.1065G>A (p.Lys355=)1374CPT1ALikely benign-1RCV002150229; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116855238168552381CT68552381-
NM_001876.4(CPT1A):c.1056G>A (p.Arg352=)1374CPT1ALikely benign-1RCV002196978; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116855239068552390CT68552390-
NM_001876.4(CPT1A):c.1055G>A (p.Arg352Gln)1374CPT1ABenignrs374383052RCV000441757|RCV000755989|RCV001080563; NMedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116855239168552391CT11:g.68552391C>TClinGen:CA6152426CN169374 not specified;
NM_001876.4(CPT1A):c.1054C>T (p.Arg352Trp)1374CPT1AUncertain significance-1RCV001563779; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116855239268552392GA68552392-
NM_001876.4(CPT1A):c.1053G>A (p.Gly351=)1374CPT1ALikely benignrs1594337533RCV000944515; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116855239368552393CT11:g.68552393C>T-
NM_001876.4(CPT1A):c.1047T>C (p.His349=)1374CPT1ALikely benign-1RCV001421759; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116855239968552399AG68552399-
NM_001876.4(CPT1A):c.1041C>T (p.Leu347=)1374CPT1ALikely benign-1RCV002175945; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116855240568552405GA68552405-
NM_001876.4(CPT1A):c.1027T>G (p.Phe343Val)1374CPT1AUncertain significancers80356783RCV000055852; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116855241968552419AC11:g.68552419A>CClinGen:CA344958,UniProtKB:P50416#VAR_046768C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.1018G>A (p.Gly340Arg)1374CPT1AUncertain significance-1RCV001563778; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116855242868552428CT68552428-
NM_001876.4(CPT1A):c.1015C>T (p.Arg339Ter)1374CPT1APathogenic-1RCV001382563; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116855243168552431GA68552431-
NM_001876.4(CPT1A):c.1003G>A (p.Val335Ile)1374CPT1AUncertain significancers112620511RCV001363169; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116855244368552443CT11:g.68552443C>T-
NM_001876.4(CPT1A):c.1002C>T (p.Ile334=)1374CPT1ALikely benign-1RCV001427176; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116855244468552444GA68552444-
NM_001876.4(CPT1A):c.990C>T (p.Asp330=)1374CPT1ALikely benign-1RCV001419063; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116855245668552456GA68552456-
NM_001876.4(CPT1A):c.981C>T (p.His327=)1374CPT1ALikely benign-1RCV002194071; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116855246568552465GA68552465-
NM_001876.4(CPT1A):c.968-3C>G1374CPT1AUncertain significancers1594337667RCV000790370; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116855248168552481GC11:g.68552481G>C-
NM_001876.4(CPT1A):c.968-4T>C1374CPT1ALikely benign-1RCV001483595; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116855248268552482AG68552482-
NM_001876.4(CPT1A):c.968-5C>T1374CPT1ALikely benign-1RCV001394803; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116855248368552483GA68552483-
NM_001876.4(CPT1A):c.968-8C>T1374CPT1ABenignrs2305507RCV000079921|RCV001521378; NMedGen:CN169374|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116855248668552486GA11:g.68552486G>AClinGen:CA285507CN169374 not specified;
NM_001876.4(CPT1A):c.968-11G>A1374CPT1AUncertain significance-1RCV001896141; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116855248968552489CT68552489-
NC_000011.9:g.(?_68560773)_(68564411_?)dup1374CPT1ALikely pathogenic-1RCV001379585; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856077368564411nana-1-
NC_000011.9:g.(?_68560773)_(68562389_?)del1374CPT1APathogenic-1RCV001382020; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856077368562389nana-1-
NM_001876.4(CPT1A):c.967+10G>A1374CPT1ALikely benign-1RCV002212358; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856077368560773CT68560773-
NM_001876.4(CPT1A):c.967+10G>C1374CPT1ALikely benign-1RCV002157429; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856077368560773CG68560773-
NM_001876.4(CPT1A):c.967+9A>G1374CPT1ALikely benign-1RCV001447279; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856077468560774TC68560774-
NM_001876.4(CPT1A):c.967+3G>A1374CPT1ABenignrs75677837RCV000079920|RCV000553044; NMedGen:CN169374|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856078068560780CT11:g.68560780C>TClinGen:CA285506C1829703 Carnitine palmitoyl transferase 1 deficiency;
NM_001876.4(CPT1A):c.967+2T>C1374CPT1ALikely pathogenicrs1224226554RCV000672741; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856078168560781AG11:g.68560781A>G-C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.967+1G>A1374CPT1ALikely pathogenicrs112498048RCV000412145; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856078268560782CTNC_000011.9:g.68560782C>TClinGen:CA16041538C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.963G>A (p.Glu321=)1374CPT1ABenignrs2229737RCV000079919|RCV001275356; NMedGen:CN169374|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856078768560787CT11:g.68560787C>TClinGen:CA285503CN169374 not specified;
NM_001876.4(CPT1A):c.961G>A (p.Glu321Lys)1374CPT1AConflicting interpretations of pathogenicityrs114030714RCV000951726|RCV001558613; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156|MedGen:CN517202116856078968560789CT11:g.68560789C>T-
NM_001876.4(CPT1A):c.957A>G (p.Gly319=)1374CPT1ALikely benign-1RCV002180557; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856079368560793TC68560793-
NM_001876.4(CPT1A):c.948del (p.Ile317fs)1374CPT1APathogenicrs80356800RCV000009637; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856080268560802TCT11:g.68560802_68560802delClinGen:CA340862,OMIM:600528.0010C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.946C>G (p.Arg316Gly)1374CPT1AUncertain significancers80356796RCV000055872|RCV000298507; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156|MedGen:CN517202116856080468560804GC11:g.68560804G>CClinGen:CA344991,UniProtKB:P50416#VAR_046767C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.945C>G (p.Ser315=)1374CPT1ALikely benign-1RCV002075363; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856080568560805GC68560805-
NM_001876.4(CPT1A):c.941C>T (p.Thr314Ile)1374CPT1Anot providedrs80356776RCV000055870; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856080968560809GA11:g.68560809G>AClinGen:CA344989,UniProtKB:P50416#VAR_020549C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.937A>G (p.Asn313Asp)1374CPT1AUncertain significance-1RCV002033430; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856081368560813TC68560813-
NM_001876.4(CPT1A):c.930G>C (p.Arg310=)1374CPT1ALikely benignrs147373480RCV000872832; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856082068560820CG11:g.68560820C>G-
NM_001876.4(CPT1A):c.929G>A (p.Arg310Gln)1374CPT1AUncertain significancers536671702RCV001343156; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856082168560821CT68560821-
NM_001876.4(CPT1A):c.924G>A (p.Trp308Ter)1374CPT1APathogenic-1RCV001901121; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856082668560826CT68560826-
NM_001876.4(CPT1A):c.919C>T (p.Gln307Ter)1374CPT1ALikely pathogenicrs1057516396RCV000411254; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856083168560831GA11:g.68560831G>AClinGen:CA16041539C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.916G>A (p.Ala306Thr)1374CPT1AUncertain significancers775746905RCV001278063; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856083468560834CT11:g.68560834C>T-
NM_001876.4(CPT1A):c.915C>T (p.Ser305=)1374CPT1ALikely benign-1RCV001414995; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856083568560835GA68560835-
NM_001876.4(CPT1A):c.912C>G (p.Cys304Trp)1374CPT1Anot providedrs80356789RCV000055869; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856083868560838GC11:g.68560838G>CClinGen:CA344987,UniProtKB:P50416#VAR_020548C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.912C>T (p.Cys304=)1374CPT1ALikely benign-1RCV002172480; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856083868560838GA68560838-
NM_001876.4(CPT1A):c.900G>T (p.Thr300=)1374CPT1ALikely benign-1RCV001429248; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856085068560850CA68560850-
NM_001876.4(CPT1A):c.900G>A (p.Thr300=)1374CPT1ALikely benign-1RCV001478795; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856085068560850CT68560850-
NM_001876.4(CPT1A):c.893G>T (p.Gly298Val)1374CPT1AUncertain significancers1310052561RCV001278064; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856085768560857CA11:g.68560857C>A-
NM_001876.4(CPT1A):c.879+10C>T1374CPT1ALikely benign-1RCV001440165; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856226268562262GA68562262-
NM_001876.4(CPT1A):c.873C>T (p.Ile291=)1374CPT1ALikely benign-1RCV002219122; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856227868562278GA68562278-
NM_001876.4(CPT1A):c.863G>A (p.Arg288Gln)1374CPT1ABenignrs140958507RCV000185825|RCV000538266; NMedGen:CN169374|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856228868562288CT11:g.68562288C>TClinGen:CA312413C1829703 Carnitine palmitoyl transferase 1 deficiency;
NM_001876.4(CPT1A):c.853A>C (p.Lys285Gln)1374CPT1AConflicting interpretations of pathogenicityrs77477448RCV000965846|RCV001593152; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156|MedGen:CN517202116856229868562298TG11:g.68562298T>G-
NM_001876.4(CPT1A):c.851G>A (p.Arg284His)1374CPT1AUncertain significancers144866081RCV000697594|RCV000732851; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156|MedGen:CN517202116856230068562300CTNC_000011.9:g.68562300C>T-C1829703 Carnitine palmitoyl transferase 1 deficiency;
NM_001876.4(CPT1A):c.847A>C (p.Arg283=)1374CPT1ALikely benignrs1173914550RCV000946225|RCV001441693; NMedGen:CN517202|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856230468562304TG11:g.68562304T>G-
NM_001876.4(CPT1A):c.823G>A (p.Ala275Thr)1374CPT1ABenign/Likely benignrs2229738RCV000055868|RCV000180224; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156|MedGen:CN169374116856232868562328CT11:g.68562328C>TClinGen:CA303058,UniProtKB:P50416#VAR_020547C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.822C>T (p.Asn274=)1374CPT1ALikely benignrs774440104RCV000905380|RCV001459091; NMedGen:CN517202|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856232968562329GA11:g.68562329G>A-
NM_001876.4(CPT1A):c.816C>T (p.Ala272=)1374CPT1ALikely benign-1RCV001450693; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856233568562335GA68562335-
NM_001876.4(CPT1A):c.795T>C (p.Thr265=)1374CPT1ALikely benign-1RCV002212122; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856235668562356AG68562356-
NM_001876.4(CPT1A):c.789T>C (p.Leu263=)1374CPT1ALikely benign-1RCV002162699; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856236268562362AG68562362-
NM_001876.4(CPT1A):c.775C>T (p.Leu259=)1374CPT1ALikely benign-1RCV002145347; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856237668562376GA68562376-
NM_001876.4(CPT1A):c.772-1G>A1374CPT1ALikely pathogenicrs1555230326RCV000671449; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856238068562380CT11:g.68562380C>T-C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.772-2A>G1374CPT1ALikely pathogenicrs1057517245RCV000409488; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856238168562381TCNC_000011.9:g.68562381T>CClinGen:CA16041540C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.772-8C>T1374CPT1ALikely benign-1RCV002091849; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856238768562387GA68562387-
NM_001876.4(CPT1A):c.772-9G>A1374CPT1ALikely benign-1RCV001479690; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856238868562388CT68562388-
NM_001876.4(CPT1A):c.772-9G>T1374CPT1ALikely benign-1RCV002151943; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856238868562388CA68562388-
NM_001876.4(CPT1A):c.772-10C>T1374CPT1ALikely benign-1RCV001491933; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856238968562389GA68562389-
NM_001876.4(CPT1A):c.771+18G>T1374CPT1ALikely benign-1RCV002190615; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856430668564306CA68564306-
NM_001876.4(CPT1A):c.771+16C>T1374CPT1ALikely benign-1RCV002123400; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856430868564308GA68564308-
NM_001876.4(CPT1A):c.771+1G>C1374CPT1ALikely pathogenicrs1555230494RCV000666015; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856432368564323CG11:g.68564323C>G-C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.756C>T (p.Ser252=)1374CPT1AUncertain significancers1855767126RCV001052145; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856433968564339GA11:g.68564339G>A-
NM_001876.4(CPT1A):c.753C>T (p.Asn251=)1374CPT1ALikely benignrs765615450RCV000922627; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856434268564342GA11:g.68564342G>A-
NM_001876.4(CPT1A):c.744C>T (p.Leu248=)1374CPT1ALikely benign-1RCV002207825; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856435168564351GA68564351-
NM_001876.4(CPT1A):c.742del (p.Leu248fs)1374CPT1APathogenic-1RCV001924623; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856435368564353AGA68564352-
NM_001876.4(CPT1A):c.741G>A (p.Pro247=)1374CPT1ALikely benign-1RCV001456642; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856435468564354CT68564354-
NM_001876.4(CPT1A):c.733C>T (p.Arg245Ter)1374CPT1APathogenicrs767241290RCV001248371; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856436268564362GA11:g.68564362G>A-
NM_001876.4(CPT1A):c.727C>T (p.Arg243Ter)1374CPT1ALikely pathogenicrs779893091RCV000410747; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856436868564368GANC_000011.9:g.68564368G>AClinGen:CA16041541C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.727C>A (p.Arg243=)1374CPT1ALikely benign-1RCV002124111; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856436868564368GT68564368-
NM_001876.4(CPT1A):c.717C>T (p.Tyr239=)1374CPT1ALikely benign-1RCV001394386; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856437868564378GA68564378-
NM_001876.4(CPT1A):c.699C>T (p.Ser233=)1374CPT1ALikely benign-1RCV001429752; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856439668564396GA68564396-
NM_001876.4(CPT1A):c.694-2A>G1374CPT1ALikely pathogenicrs1555230518RCV000670948; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856440368564403TC11:g.68564403T>C-C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.694-5A>G1374CPT1ALikely benignrs533087846RCV000900369|RCV002068641; NMedGen:CN517202|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856440668564406TC11:g.68564406T>C-
NM_001876.4(CPT1A):c.694-10C>T1374CPT1ALikely benignrs201198921RCV000936744|RCV001721388; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156|MedGen:CN517202116856441168564411GA11:g.68564411G>AClinGen:CA6152562CN169374 not specified;
NM_001876.4(CPT1A):c.693+34dup1374CPT1ABenign-1RCV001661307; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856664768566648GGA68566647-
NM_001876.4(CPT1A):c.693+37T>C1374CPT1ABenign-1RCV001659119|RCV001659118; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156|MedGen:CN517202116856664968566649AG68566649-
NM_001876.4(CPT1A):c.693+36T>G1374CPT1ABenign-1RCV001661308; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856665068566650AC68566650-
NM_001876.4(CPT1A):c.693+35T>A1374CPT1ABenign-1RCV001661309; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856665168566651AT68566651-
NM_001876.4(CPT1A):c.693+7C>T1374CPT1ALikely benignrs370181471RCV000876354; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856667968566679GA11:g.68566679G>A-
NM_001876.4(CPT1A):c.693+1G>C1374CPT1ALikely pathogenicrs1055176086RCV000409157; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856668568566685CG11:g.68566685C>GClinGen:CA16041542C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.693+1G>T1374CPT1ALikely pathogenicrs1055176086RCV000664818; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856668568566685CA11:g.68566685C>A-C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.693+1G>A1374CPT1ALikely pathogenicrs1055176086RCV001217441; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856668568566685CT11:g.68566685C>T-
NM_001876.4(CPT1A):c.675C>T (p.Ser225=)1374CPT1ALikely benign-1RCV001403895; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856670468566704GA68566704-
NM_001876.4(CPT1A):c.669A>G (p.Leu223=)1374CPT1ALikely benignrs373563983RCV000532948; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856671068566710TCNC_000011.9:g.68566710T>CClinGen:CA6152599C1829703 Carnitine palmitoyl transferase 1 deficiency;
NM_001876.4(CPT1A):c.668T>G (p.Leu223Ter)1374CPT1APathogenic-1RCV001890053; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856671168566711AC68566711-
NM_001876.4(CPT1A):c.647G>A (p.Arg216Lys)1374CPT1AUncertain significancers955789237RCV001278065; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856673268566732CT11:g.68566732C>T-
NM_001876.4(CPT1A):c.642A>G (p.Gly214=)1374CPT1ALikely benignrs377534215RCV000943577; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856673768566737TC11:g.68566737T>C-
NM_001876.4(CPT1A):c.634G>A (p.Gly212Ser)1374CPT1AUncertain significance-1RCV001371711; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856674568566745CT68566745-
NM_001876.4(CPT1A):c.633C>T (p.Val211=)1374CPT1ALikely benignrs775908039RCV000942838; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856674668566746GA11:g.68566746G>A-
NM_001876.4(CPT1A):c.620A>G (p.Gln207Arg)1374CPT1AUncertain significancers1855839019RCV001278066; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856675968566759TC11:g.68566759T>C-
NM_001876.4(CPT1A):c.603G>A (p.Arg201=)1374CPT1ALikely benign-1RCV001479778; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856677668566776CT68566776-
NM_001876.4(CPT1A):c.601C>T (p.Arg201Trp)1374CPT1AUncertain significancers373344573RCV001351022; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856677868566778GA68566778-
NM_001876.4(CPT1A):c.597C>T (p.Phe199=)1374CPT1ALikely benign-1RCV002174811; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856678268566782GA68566782-
NM_001876.4(CPT1A):c.589G>T (p.Glu197Ter)1374CPT1APathogenic-1RCV001955535; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856679068566790CA68566790-
NM_001876.4(CPT1A):c.588A>G (p.Glu196=)1374CPT1ALikely benign-1RCV001446314; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856679168566791TC68566791-
NM_001876.4(CPT1A):c.567G>A (p.Ser189=)1374CPT1ALikely benign-1RCV001452978; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856681268566812CT68566812-
NM_001876.4(CPT1A):c.557A>G (p.Tyr186Cys)1374CPT1AUncertain significancers759188040RCV000224865|RCV001833236; NMedGen:CN517202|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856682268566822TC11:g.68566822T>CClinGen:CA6152620CN517202 not provided;
NM_001876.4(CPT1A):c.556-4C>T1374CPT1ALikely benign-1RCV001500819; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856682768566827GA68566827-
NM_001876.4(CPT1A):c.556-12del1374CPT1ABenignrs113037606RCV000079916|RCV002055145; NMedGen:CN169374|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856683568566835TGT11:g.68566835_68566835delClinGen:CA285500CN169374 not specified;
NM_001876.4(CPT1A):c.556-16_556-15insT1374CPT1ABenign-1RCV002165055; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856683868566839GGA68566838-
NM_001876.4(CPT1A):c.556-16C>T1374CPT1ABenignrs3019603RCV000079917|RCV001520686; NMedGen:CN169374|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856683968566839GA11:g.68566839G>AClinGen:CA285501CN169374 not specified;
NM_001876.4(CPT1A):c.556-19T>G1374CPT1ABenignrs117610994RCV000079918|RCV001516155; NMedGen:CN169374|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116856684268566842AC11:g.68566842A>CClinGen:CA285502CN169374 not specified;
NM_001876.4(CPT1A):c.555+9G>A1374CPT1ALikely benign-1RCV002080881; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857145968571459CT68571459-
NM_001876.4(CPT1A):c.539_540del (p.Lys180fs)1374CPT1APathogenicrs1319341024RCV001203078; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857148368571484CTTC11:g.68571483_68571484del-
NM_001876.4(CPT1A):c.535G>A (p.Val179Ile)1374CPT1AUncertain significancers542856213RCV001246631; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857148868571488CT11:g.68571488C>T-
NM_001876.4(CPT1A):c.534T>C (p.Ala178=)1374CPT1ALikely benign-1RCV002153666; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857148968571489AG68571489-
NM_001876.4(CPT1A):c.530del (p.Pro177fs)1374CPT1APathogenic-1RCV001951062; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857149368571493CGC68571492-
NM_001876.4(CPT1A):c.528C>A (p.Val176=)1374CPT1ALikely benign-1RCV001454772; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857149568571495GT68571495-
NM_001876.4(CPT1A):c.525G>A (p.Pro175=)1374CPT1ALikely benignrs371805329RCV000876633; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857149868571498CT11:g.68571498C>T-
NM_001876.4(CPT1A):c.524C>T (p.Pro175Leu)1374CPT1AUncertain significance-1RCV001878982; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857149968571499GA68571499-
NM_001876.4(CPT1A):c.519C>A (p.Arg173=)1374CPT1ALikely benign-1RCV002175380; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857150468571504GT68571504-
NM_001876.4(CPT1A):c.518G>A (p.Arg173His)1374CPT1ABenignrs199589844RCV000431057|RCV000873678; NMedGen:CN169374|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857150568571505CT11:g.68571505C>TClinGen:CA6152639CN169374 not specified;
NM_001876.4(CPT1A):c.517C>T (p.Arg173Cys)1374CPT1AUncertain significancers774388890RCV000554631; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857150668571506GANC_000011.9:g.68571506G>AClinGen:CA6152641C1829703 Carnitine palmitoyl transferase 1 deficiency;
NM_001876.4(CPT1A):c.510G>A (p.Ser170=)1374CPT1ALikely benign-1RCV001500221; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857151368571513CT68571513-
NM_001876.4(CPT1A):c.507A>G (p.Thr169=)1374CPT1ALikely benign-1RCV001404735; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857151668571516TC68571516-
NM_001876.4(CPT1A):c.507A>C (p.Thr169=)1374CPT1ALikely benign-1RCV001453950; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857151668571516TG68571516-
NM_001876.4(CPT1A):c.504G>A (p.Gln168=)1374CPT1ALikely benign-1RCV001494518; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857151968571519CT68571519-
NM_001876.4(CPT1A):c.495C>T (p.Tyr165=)1374CPT1AConflicting interpretations of pathogenicityrs139789100RCV000347532|RCV001078636; NMedGen:CN517202|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857152868571528GA11:g.68571528G>AClinGen:CA6152646C1829703 Carnitine palmitoyl transferase 1 deficiency;
NM_001876.4(CPT1A):c.492G>A (p.Leu164=)1374CPT1ALikely benignrs200836324RCV000873677; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857153168571531CT11:g.68571531C>T-
NM_001876.4(CPT1A):c.491T>C (p.Leu164Ser)1374CPT1AUncertain significance-1RCV001888688; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857153268571532AG68571532-
NM_001876.4(CPT1A):c.478C>T (p.Arg160Ter)1374CPT1APathogenicrs80356782RCV000694487; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857154568571545GA11:g.68571545G>AClinGen:CA344984C1829703 Carnitine palmitoyl transferase 1 deficiency;
NM_001876.4(CPT1A):c.477C>A (p.Gly159=)1374CPT1ALikely benign-1RCV002105235; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857154668571546GT68571546-
NM_001876.4(CPT1A):c.466A>G (p.Ile156Val)1374CPT1AUncertain significancers201398937RCV000704593; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857155768571557TCNC_000011.9:g.68571557T>C-C1829703 Carnitine palmitoyl transferase 1 deficiency;
NM_001876.4(CPT1A):c.465del (p.Ile156fs)1374CPT1APathogenicrs1855979917RCV001047675; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857155868571558TCT11:g.68571558_68571558del-
NM_001876.4(CPT1A):c.454-6C>A1374CPT1ALikely benign-1RCV001460708; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857157568571575GT68571575-
NM_001876.4(CPT1A):c.454-6C>T1374CPT1ALikely benign-1RCV001480332; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857157568571575GA68571575-
NM_001876.4(CPT1A):c.454-7T>C1374CPT1ALikely benign-1RCV001473782; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857157668571576AG68571576-
NM_001876.4(CPT1A):c.454-10C>T1374CPT1ALikely benign-1RCV001396010; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857157968571579GA68571579-
NM_001876.4(CPT1A):c.454-10C>G1374CPT1ALikely benign-1RCV001440952; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857157968571579GC68571579-
NM_001876.4(CPT1A):c.453+9G>A1374CPT1ABenign/Likely benignrs183694834RCV000436427|RCV000877069; NMedGen:CN169374|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857492668574926CT11:g.68574926C>TClinGen:CA6152676CN169374 not specified;
NM_001876.4(CPT1A):c.453+9G>C1374CPT1ALikely benignrs183694834RCV000884572|RCV001472382; NMedGen:CN517202|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857492668574926CG11:g.68574926C>G-
NM_001876.4(CPT1A):c.440C>T (p.Thr147Ile)1374CPT1AUncertain significance-1RCV001864933; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857494868574948GA68574948-
NM_001876.4(CPT1A):c.434G>A (p.Arg145His)1374CPT1AUncertain significancers373015421RCV001239870; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857495468574954CT11:g.68574954C>T-
NM_001876.4(CPT1A):c.433C>T (p.Arg145Cys)1374CPT1AUncertain significance-1RCV001372609; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857495568574955GA68574955-
NM_001876.4(CPT1A):c.432T>C (p.Ser144=)1374CPT1ALikely benignrs751979703RCV000940830|RCV001274172; NMedGen:CN517202|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857495668574956AG11:g.68574956A>G-
NM_001876.4(CPT1A):c.421G>A (p.Gly141Ser)1374CPT1AUncertain significancers1309112630RCV001196715; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857496768574967CT11:g.68574967C>T-
NM_001876.4(CPT1A):c.420C>T (p.His140=)1374CPT1ALikely benign-1RCV001422835; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857496868574968GA68574968-
NM_001876.4(CPT1A):c.399C>T (p.His133=)1374CPT1ALikely benign-1RCV001449397; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857498968574989GA68574989-
NM_001876.4(CPT1A):c.398A>C (p.His133Pro)1374CPT1AUncertain significance-1RCV001970709; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857499068574990TG68574990-
NM_001876.4(CPT1A):c.390C>T (p.Leu130=)1374CPT1ALikely benign-1RCV001398047; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857499868574998GA68574998-
NM_001876.4(CPT1A):c.390C>A (p.Leu130=)1374CPT1ALikely benign-1RCV002119186; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857499868574998GT68574998-
NM_001876.4(CPT1A):c.388C>T (p.Leu130Phe)1374CPT1AUncertain significance-1RCV002026971; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857500068575000GA68575000-
NM_001876.4(CPT1A):c.384G>A (p.Val128=)1374CPT1ALikely benign-1RCV001499852; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857500468575004CT68575004-
NM_001876.4(CPT1A):c.367C>T (p.Arg123Cys)1374CPT1AUncertain significancers80356775RCV000055866|RCV000079915; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156|MedGen:CN517202116857502168575021GA11:g.68575021G>AClinGen:CA221862,UniProtKB:P50416#VAR_020546C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.357C>T (p.Ile119=)1374CPT1ALikely benignrs138011726RCV000603778|RCV000945719; NMedGen:CN169374|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857503168575031GA11:g.68575031G>AClinGen:CA6152700CN169374 not specified;
NM_001876.4(CPT1A):c.340C>T (p.Leu114=)1374CPT1ALikely benign-1RCV001410574; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857504868575048GA68575048-
NM_001876.4(CPT1A):c.339C>A (p.Gly113=)1374CPT1ALikely benign-1RCV001431294; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857504968575049GT68575049-
NM_001876.4(CPT1A):c.337G>A (p.Gly113Ser)1374CPT1AUncertain significancers555444012RCV001239402|RCV001545991; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156|MedGen:CN517202116857505168575051CT11:g.68575051C>T-
NM_001876.4(CPT1A):c.336C>T (p.Thr112=)1374CPT1ABenign/Likely benignrs61731902RCV000905804; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857505268575052GA11:g.68575052G>A-
NM_001876.4(CPT1A):c.327G>A (p.Leu109=)1374CPT1ALikely benign-1RCV001424973; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857506168575061CT68575061-
NM_001876.4(CPT1A):c.319G>A (p.Gly107Ser)1374CPT1AUncertain significancers773497434RCV000697214; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857506968575069CTNC_000011.9:g.68575069C>T-C1829703 Carnitine palmitoyl transferase 1 deficiency;
NM_001876.4(CPT1A):c.318C>T (p.Ser106=)1374CPT1ALikely benign-1RCV001495392; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857507068575070GA68575070-
NM_001876.4(CPT1A):c.317G>A (p.Ser106Asn)1374CPT1AConflicting interpretations of pathogenicity-1RCV001563504|RCV001563776; NMedGen:CN517202|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857507168575071CT68575071-
NM_001876.4(CPT1A):c.315C>T (p.Val105=)1374CPT1ALikely benign-1RCV001501600; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857507368575073GA68575073-
NM_001876.4(CPT1A):c.312G>C (p.Val104=)1374CPT1ALikely benign-1RCV001423239; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857507668575076CG68575076-
NM_001876.4(CPT1A):c.309C>T (p.Asn103=)1374CPT1ALikely benignrs200536266RCV000909938; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857507968575079GA11:g.68575079G>A-
NM_001876.4(CPT1A):c.303G>A (p.Thr101=)1374CPT1ALikely benignrs553777167RCV000942109; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857508568575085CT11:g.68575085C>T-
NM_001876.4(CPT1A):c.303G>C (p.Thr101=)1374CPT1ALikely benign-1RCV002190495; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857508568575085CG68575085-
NM_001876.4(CPT1A):c.302C>T (p.Thr101Met)1374CPT1ABenign/Likely benignrs61731903RCV000757135|RCV001079186; NMedGen:CN517202|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857508668575086GANC_000011.9:g.68575086G>A-
NM_001876.4(CPT1A):c.298C>T (p.Gln100Ter)1374CPT1APathogenic/Likely pathogenicrs80356774RCV000009630|RCV000790812; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156|MedGen:CN517202116857509068575090GANC_000011.9:g.68575090G>AClinGen:CA221859,OMIM:600528.0003C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.292T>A (p.Ser98Thr)1374CPT1AUncertain significancers201446439RCV001341008; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857509668575096AT68575096-
NM_001876.4(CPT1A):c.282-1G>A1374CPT1ALikely pathogenicrs1057517188RCV000412419; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857510768575107CTNC_000011.9:g.68575107C>TClinGen:CA16041543C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.282-10G>A1374CPT1ALikely benign-1RCV001896394; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857511668575116CT68575116-
NM_001876.4(CPT1A):c.282-10G>C1374CPT1ALikely benign-1RCV002152008; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857511668575116CG68575116-
NM_001876.4(CPT1A):c.281+1G>A1374CPT1APathogenic/Likely pathogenicrs191107774RCV000177139|RCV001854409; NMedGen:CN517202|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857990468579904CT11:g.68579904C>TClinGen:CA221858C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.279G>T (p.Thr93=)1374CPT1ALikely benign-1RCV001457529; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857990768579907CA68579907-
NM_001876.4(CPT1A):c.277A>C (p.Thr93Pro)1374CPT1AUncertain significance-1RCV001920994; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857990968579909TG68579909-
NM_001876.4(CPT1A):c.266G>A (p.Arg89Gln)1374CPT1AUncertain significancers751235722RCV001278068; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857992068579920CT11:g.68579920C>T-
NM_001876.4(CPT1A):c.265C>T (p.Arg89Trp)1374CPT1AUncertain significancers574346392RCV001278069; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857992168579921GA11:g.68579921G>A-
NM_001876.4(CPT1A):c.263A>G (p.Asn88Ser)1374CPT1AUncertain significancers781040444RCV001278070; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857992368579923TC11:g.68579923T>C-
NM_001876.4(CPT1A):c.261C>T (p.Ile87=)1374CPT1ALikely benign-1RCV001478949; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857992568579925GA68579925-
NM_001876.4(CPT1A):c.247A>G (p.Ile83Val)1374CPT1AUncertain significancers748174436RCV001278071; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857993968579939TC11:g.68579939T>C-
NM_001876.4(CPT1A):c.244G>A (p.Gly82Arg)1374CPT1AUncertain significance-1RCV001900850; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857994268579942CT68579942-
NM_001876.4(CPT1A):c.243A>G (p.Leu81=)1374CPT1ALikely benign-1RCV002205212; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857994368579943TC68579943-
NM_001876.4(CPT1A):c.221_241del (p.Tyr74_Ser80del)1374CPT1AUncertain significancers1856241184RCV001307893; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857994568579965AACGAGGGGTCGATCTTGGCGTA68579944-
NM_001876.4(CPT1A):c.240G>A (p.Ser80=)1374CPT1ABenignrs61731904RCV000185821|RCV000524920; NMedGen:CN169374|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857994668579946CTNC_000011.9:g.68579946C>TClinGen:CA312404C1829703 Carnitine palmitoyl transferase 1 deficiency;
NM_001876.4(CPT1A):c.231C>T (p.Ile77=)1374CPT1ALikely benign-1RCV001423374; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857995568579955GA68579955-
NM_001876.4(CPT1A):c.228G>A (p.Lys76=)1374CPT1ALikely benign-1RCV001400276; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857995868579958CT68579958-
NM_001876.4(CPT1A):c.222C>A (p.Tyr74Ter)1374CPT1APathogenic/Likely pathogenicrs398123654RCV000790814|RCV000793676; NMedGen:CN517202|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857996468579964GTNC_000011.9:g.68579964G>TClinGen:CA221855C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.222C>T (p.Tyr74=)1374CPT1ALikely benign-1RCV001409988; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857996468579964GA68579964-
NM_001876.4(CPT1A):c.216G>A (p.Thr72=)1374CPT1ALikely benign-1RCV001472116; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857997068579970CT68579970-
NM_001876.4(CPT1A):c.194TGG[2] (p.Val67del)1374CPT1AUncertain significancers1555232255RCV000669476; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857998468579986CCCAC11:g.68579984_68579986del-C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.192C>T (p.Ile64=)1374CPT1ALikely benignrs142691028RCV000431380|RCV000904647; NMedGen:CN169374|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116857999468579994GA11:g.68579994G>AClinGen:CA6152751CN169374 not specified;
NM_001876.4(CPT1A):c.186G>A (p.Trp62Ter)1374CPT1ALikely pathogenicrs1057516434RCV000409874; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116858000068580000CTNC_000011.9:g.68580000C>TClinGen:CA16041544C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.183T>C (p.Ser61=)1374CPT1ALikely benign-1RCV002154655; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116858000368580003AG68580003-
NM_001876.4(CPT1A):c.176C>T (p.Pro59Leu)1374CPT1AUncertain significancers201762212RCV001278072; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116858001068580010GA11:g.68580010G>A-
NM_001876.4(CPT1A):c.171A>G (p.Ala57=)1374CPT1ALikely benignrs758539295RCV000959062; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116858001568580015TC11:g.68580015T>C-
NM_001876.4(CPT1A):c.160G>T (p.Val54Leu)1374CPT1AUncertain significancers147389938RCV001244558|RCV001550146; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156|MedGen:CN517202116858002668580026CA11:g.68580026C>A-
NM_001876.4(CPT1A):c.160G>A (p.Val54Met)1374CPT1AUncertain significance-1RCV001943240; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116858002668580026CT68580026-
NM_001876.4(CPT1A):c.159C>A (p.Gly53=)1374CPT1ALikely benign-1RCV001445337; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116858002768580027GT68580027-
NM_001876.4(CPT1A):c.147C>G (p.Gly49=)1374CPT1ALikely benignrs138011017RCV000639507; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116858003968580039GC11:g.68580039G>CClinGen:CA6152762C1829703 Carnitine palmitoyl transferase 1 deficiency;
NM_001876.4(CPT1A):c.145G>A (p.Gly49Ser)1374CPT1AUncertain significancers552007692RCV000415847|RCV001278073; NMedGen:CN517202|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116858004168580041CT11:g.68580041C>TClinGen:CA6152764CN517202 not provided;
NM_001876.4(CPT1A):c.144C>T (p.Asn48=)1374CPT1ALikely benignrs182451427RCV000610290|RCV000876618; NMedGen:CN169374|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116858004268580042GA11:g.68580042G>AClinGen:CA6152765CN169374 not specified;
NM_001876.4(CPT1A):c.142-16G>A1374CPT1ABenign/Likely benignrs201717907RCV000433471|RCV002063382; NMedGen:CN169374|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116858006068580060CT11:g.68580060C>TClinGen:CA6152769CN169374 not specified;
NM_001876.4(CPT1A):c.142-17C>G1374CPT1ABenign-1RCV002130546; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116858006168580061GC68580061-
NM_001876.4(CPT1A):c.141+6C>G1374CPT1AUncertain significancers1856354034RCV001206097; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116858279668582796GC11:g.68582796G>C-
NM_001876.4(CPT1A):c.123G>A (p.Lys41=)1374CPT1ALikely benign-1RCV001419638; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116858282068582820CT68582820-
NM_001876.4(CPT1A):c.122del (p.Lys41fs)1374CPT1APathogenicrs1856354768RCV001038812; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116858282168582821CTC11:g.68582821_68582821del-
NM_001876.4(CPT1A):c.116G>C (p.Trp39Ser)1374CPT1AUncertain significancers766209790RCV001339138; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116858282768582827CG68582827-
NM_001876.4(CPT1A):c.105A>G (p.Gly35=)1374CPT1ALikely benign-1RCV002192646; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116858283868582838TC68582838-
NM_001876.4(CPT1A):c.101C>T (p.Ser34Phe)1374CPT1AUncertain significancers1856355607RCV001313594; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116858284268582842GA68582842-
NM_001876.4(CPT1A):c.100T>C (p.Ser34Pro)1374CPT1AConflicting interpretations of pathogenicityrs398123653RCV000079910|RCV000693588|RCV000723488; NMedGen:CN169374|MONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156|MedGen:CN517202116858284368582843AG11:g.68582843A>GClinGen:CA221850C1829703 Carnitine palmitoyl transferase 1 deficiency;
NM_001876.4(CPT1A):c.96T>G (p.Tyr32Ter)1374CPT1Anot providedrs80356786RCV000055874; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116858284768582847AC11:g.68582847A>CClinGen:CA344993C0342789 255120 Carnitine palmitoyltransferase I deficiency;
NM_001876.4(CPT1A):c.76G>T (p.Glu26Ter)1374CPT1APathogenic-1RCV001384119; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116858286768582867CA68582867-
NM_001876.4(CPT1A):c.75T>C (p.His25=)1374CPT1ALikely benign-1RCV001484521; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116858286868582868AG68582868-
NM_001876.4(CPT1A):c.61C>T (p.Leu21=)1374CPT1ALikely benign-1RCV001394535; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116858288268582882GA68582882-
NM_001876.4(CPT1A):c.56T>C (p.Ile19Thr)1374CPT1AUncertain significancers1306340710RCV001246345; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116858288768582887AG11:g.68582887A>G-
NM_001876.4(CPT1A):c.52G>A (p.Gly18Arg)1374CPT1AUncertain significancers767491846RCV001351960; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116858289168582891CT68582891-
NM_001876.4(CPT1A):c.51C>T (p.Asp17=)1374CPT1ALikely benign-1RCV001479078; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116858289268582892GA68582892-
NM_001876.4(CPT1A):c.48G>C (p.Pro16=)1374CPT1ALikely benign-1RCV002072462; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116858289568582895CG68582895-
NM_001876.4(CPT1A):c.47C>T (p.Pro16Leu)1374CPT1AUncertain significance-1RCV001884011; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116858289668582896GA68582896-
NM_001876.4(CPT1A):c.36C>T (p.Phe12=)1374CPT1ALikely benign-1RCV002146225; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116858290768582907GA68582907-
NM_001876.4(CPT1A):c.18A>G (p.Gln6=)1374CPT1ALikely benign-1RCV002184522; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116858292568582925TC68582925-
NM_001876.4(CPT1A):c.-6C>G1374CPT1AUncertain significancers561418145RCV001278074; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116858294868582948GC11:g.68582948G>C-
NM_001876.4(CPT1A):c.-6C>A1374CPT1AUncertain significancers561418145RCV001278075; NMONDO:MONDO:0009705,MedGen:C1829703,OMIM:255120, Orphanet:156116858294868582948GT11:g.68582948G>T-
MSeqDR Portal
Ensembl Gene IDAssociated Gene NameLSDB GenesLSDB VariantsclinVar hitsDescriptionDisease id
ENSG00000110090 MSeqDR Search EnsemblCPT1A129505carnitine palmitoyltransferase 1A (liver) [Source:HGNC Symbol;Acc:2328]00440

*Click on gene and variants to check details. Or view all variants in new page