MSeqDR Mitochondrial Disease Portal


 
*:HP: HPO terms, UMDF: 1= Disease, ND: NAMDC terms.
  Most Studied  CPEO, Complex I Deficiency, COXPD1, Leigh, LHON, MELAS, MERRF, Myopathy, SANDO
Disease Browser
Parent Node:
expand
Abnormalities, Multiple (D000015)
Parent Node:
expand
Eye Abnormalities (D005124)
Parent Node:
expand
Syndactyly (D013576)
Parent Node:
expand
Urogenital Abnormalities (D014564)
..Starting node
..expand
Fraser Syndrome (D058497)

       Child Nodes:



 Sister Nodes: 
..expandAllanson Pantzar McLeod syndrome (C537048) Child1
..expandANTLEY-BIXLER SYNDROME WITH GENITAL ANOMALIES AND DISORDERED STEROIDOGENESIS (OMIM:201750)
..expandAtrioventricular Septal Defect with Blepharophimosis and Anal and Radial Defects (C563994)
..expandB-Cell Immunodeficiency, Distal Limb Anomalies, And Urogenital Malformations (C563745)
..expandBEAULIEU-BOYCOTT-INNES SYNDROME (OMIM:613680)
..expandBladder Exstrophy (D001746) Child1
..expandBlepharophimosis, Ptosis, and Epicanthus Inversus (C562419)
..expandBRAIN MALFORMATIONS WITH OR WITHOUT URINARY TRACT DEFECTS (OMIM:613735)
..expandCakut (C566906)
..expandCalabro syndrome (C537960)
..expandCleft Palate, Cardiac Defect, Genital Anomalies, and Ectrodactyly (C563936)
..expandCorpus Callosum, Agenesis of, with Facial Anomalies and Robin Sequence (C563127)
..expandCryptorchidism (D003456) Child12
..expandDisorders of Sex Development (D012734) Child107
..expandDK Phocomelia Syndrome (C565618)
..expandDuker Weiss Siber syndrome (C535719)
..expandEpispadias (D004842) Child1
..expandFraser Syndrome (D058497)
..expandFused Kidney (D000069337)
..expandGenitopatellar Syndrome (C565255)
..expandGenitourinary Tract Anomalies (C564424)
..expandHand foot uterus syndrome (C535627)
..expandHemolytic Anemia, Lethal Congenital Nonspherocytic, with Genital and Other Abnormalities (C563935)
..expandHypospadias (D007021) Child17
..expandIntrauterine Growth Retardation, Metaphyseal Dysplasia, Adrenal Hypoplasia Congenita, And Genital Anomalies (C564543)
..expandLissencephaly, X-Linked, 2 (C564563)
..expandMicrocephaly seizures genital hypoplasia (C537540)
..expandMicrophthalmia, Syndromic 6 (C566440)
..expandMIRAGE SYNDROME (OMIM:617053)
..expandMulticystic Dysplastic Kidney (D021782) Child2
..expandMyotubular Myopathy with Abnormal Genital Development (C564561)
..expandNephritis, Hereditary (D009394) Child11
..expandNephrosis deafness urinary tract digital malformation (C536402)
..expandNoduli Cutanei, Multiple, with Urinary Tract Abnormalities (C563512)
..expandOmphalocele exstrophy imperforate anus (C537748)
..expandPiepkorn Karp Hickok syndrome (C535774)
..expandPopliteal Pterygium Syndrome (C562509)
..expandProud Syndrome (C563110)
..expandPyelectasis (D058536)
..expandRenal Adysplasia (C563261)
..expandRenal dysplasia - limb defects syndrome (C537754)
..expandRenal, Genital, and Middle Ear Anomalies (C564849)
..expandRetrocaval Ureter (D064749)
..expandRobinow Syndrome, Autosomal Dominant (C562492)
..expandRosselli-Gulienetti Syndrome (C563117)
..expandSolitary Kidney (D000075529)
..expandSplit-Hand With Obstructive Uropathy, Spina Bifida, And Diaphragmatic Defects (C566662)
..expandSpondylocostal Dysostosis with Anal Atresia and Urogenital Anomalies (C564799)
..expandToe Syndactyly, Telecanthus, and Anogenital and Renal Malformations (C567475)
..expandUreter, Bifid Or Double (C566012)
..expandUrinary Fistula (D014548) Child2
..expandUterine Anomalies (C562565)
   

Human Disease MESH is developed by UMLS.
Further data from MedGen, OMIM,ClinVar, CTD
Term ID:4863
Name:Fraser Syndrome
Definition:Rare autosomal recessive congenital malformation syndrome characterized by cryptophthalmos, SYNDACTYLY and UROGENITAL ABNORMALITIES. Other anomalies of bone, ear, lung, and nose are common. Mutations on FRAS1 and FREM2 are associated with the syndrome.
Alternative IDs:DO:DOID:0090001|OMIM:219000
ParentIDs:MESH:D000015|MESH:D005124|MESH:D013576|MESH:D014564
TreeNumbers:C05.116.099.370.894.819.428 |C05.660.585.800.428 |C05.660.906.819.428 |C11.250.390 |C12.706.410 |C13.351.875.397 |C16.131.077.371 |C16.131.384.442 |C16.131.621.585.800.428 |C16.131.621.906.819.428 |C16.131.939.410
Synonyms:Cryptophthalmos Syndactyly Syndrome |Cryptophthalmos-Syndactyly Syndrome |Cryptophthalmos-Syndactyly Syndromes |Cryptophthalmos with Other Malformations |FRASER SYNDROME |FRASER SYNDROME 1 |FRASRS1 |Syndrome, Fraser
Slim Mappings:Congenital abnormality|Eye disease|Musculoskeletal disease|Urogenital disease (female)|Urogenital disease (male)
Reference: MedGen: D058497
MeSH: D058497
OMIM: 219000;
MSeqDR LSDB:  
Genes: FRAS1; FREM2; GRIP1;
Phenotypes
1 HP:0000007Autosomal recessive inheritance
2 HP:0002536Abnormal cortical gyration
3 HP:0001627Abnormal heart morphology
4 HP:0004378Abnormality of the anus
5 HP:0000377Abnormality of the pinna
6 HP:0002244Abnormality of the small intestine
7 HP:0000777Abnormality of the thymus
8 HP:0001551Abnormality of the umbilicus
9 HP:0002223Absent eyebrow
10 HP:0000561Absent eyelashes
11 HP:0000528Anophthalmia
12 HP:0009767Aplasia/Hypoplasia of the phalanges of the hand
13 HP:0006714Aplasia/Hypoplasia of the sternum
14 HP:0009601Aplasia/Hypoplasia of the thumb
15 HP:0000413Atresia of the external auditory canal
16 HP:0000813Bicornuate uterus
17 HP:0007633Bilateral microphthalmos
18 HP:0000618Blindness
19 HP:0001362Calvarial skull defect
20 HP:0000452Choanal stenosis
21 HP:0003191Cleft ala nasi
22 HP:0000175Cleft palate
23 HP:0000204Cleft upper lip
24 HP:0008665Clitoral hypertrophy
25 HP:0000405Conductive hearing impairment
26 HP:0007957Corneal opacity
27 HP:0001126Cryptophthalmos
28 HP:0000028Cryptorchidism
29 HP:0000378Cupped ear
30 HP:0010554Cutaneous finger syndactyly
31 HP:0000678Dental crowding
32 HP:0000689Dental malocclusion
33 HP:0005280Depressed nasal bridge
34 HP:0000183Difficulty in tongue movements
35 HP:0002084Encephalocele
36 HP:0005325Extension of hair growth on temples to lateral eyebrow
37 HP:0002006Facial cleft
38 HP:0000238Hydrocephalus
39 HP:0000316Hypertelorism
40 HP:0008559Hypoplastic superior helix
41 HP:0000047Hypospadias
42 HP:0001249Intellectual disability
43 HP:0007925Lacrimal duct aplasia
44 HP:0008750Laryngeal atresia
45 HP:0001602Laryngeal stenosis
46 HP:0005950Laryngeal web
47 HP:0000369Low-set ears
48 HP:0007993Malformed lacrimal ducts
49 HP:0000252Microcephaly
50 HP:0000054Micropenis
51 HP:0004112Midline nasal groove
52 HP:0008609Morphological abnormality of the middle ear
53 HP:0002475Myelomeningocele
54 HP:0002089Pulmonary hypoplasia
55 HP:0000089Renal hypoplasia
56 HP:0008678Renal hypoplasia/aplasia
57 HP:0005352Severe T-cell immunodeficiency
58 HP:0001607Subglottic stenosis
59 HP:0000430Underdeveloped nasal alae
60 HP:0000636Upper eyelid coloboma
61 HP:0000148Vaginal atresia
62 HP:0006610Wide intermamillary distance
63 HP:0000431Wide nasal bridge
64 HP:0000445Wide nose
65 HP:0003183Wide pubic symphysis
Disease Causing ClinVar Variants
Variation_NameGeneIDGeneSymbolClinicalSignificancedbSNPRCVaccessionTestedInGTRPhenotypeIDsChromosomeStartStopHGVS_cHGVS_pHGVS_gOtherIDsDisease_ClinVar
NM_025074.7(FRAS1):c.-422C>G80144FRAS1Uncertain significancers886059622RCV000261189; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247897874278978742CG4:g.78978742C>GClinGen:CA10618270
NM_025074.7(FRAS1):c.-257G>T80144FRAS1Benignrs78363185RCV000318768; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247897890778978907GT4:g.78978907G>TClinGen:CA10619218C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.-245C>G80144FRAS1Uncertain significancers886059623RCV000385592; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247897891978978919CG4:g.78978919C>GClinGen:CA10618277C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.-233A>T80144FRAS1Uncertain significance-1RCV001156614; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247897893178978931AT4:g.78978931A>T-
NM_025074.7(FRAS1):c.-188C>T80144FRAS1Uncertain significancers886059624RCV000293567; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247897897678978976CT4:g.78978976C>TClinGen:CA10618278
NM_025074.7(FRAS1):c.-185G>T80144FRAS1Uncertain significancers559206528RCV000350769; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247897897978978979GT4:g.78978979G>TClinGen:CA10621693
NM_025074.7(FRAS1):c.-65T>C80144FRAS1Benignrs6832285RCV000388974; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247897909978979099TC4:g.78979099T>CClinGen:CA10619219
NM_025074.7(FRAS1):c.-23C>T80144FRAS1Benignrs34237418RCV000287519; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247897914178979141CT4:g.78979141C>TClinGen:CA2975755
NM_025074.7(FRAS1):c.-18G>T80144FRAS1Uncertain significancers750662462RCV000344884; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247897914678979146GT4:g.78979146G>TClinGen:CA2975757
NM_025074.7(FRAS1):c.47A>C (p.Glu16Ala)80144FRAS1Uncertain significance-1RCV001156615; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247897921078979210AC4:g.78979210A>C-
NM_025074.7(FRAS1):c.76+5G>A80144FRAS1Uncertain significancers886059625RCV000389965; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247897924478979244GA4:g.78979244G>AClinGen:CA10618288
NM_025074.7(FRAS1):c.77-9T>C80144FRAS1Uncertain significance-1RCV001151139; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247898713078987130TC4:g.78987130T>C-
NM_025074.7(FRAS1):c.95A>G (p.Asp32Gly)80144FRAS1Benignrs4859905RCV000251438|RCV000309845; NMedGen:CN169374|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247898715778987157AG4:g.78987157A>GClinGen:CA2975818
NM_025074.7(FRAS1):c.108+2546T>C80144FRAS1Benignrs10008489RCV000601466; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247898971678989716TC4:g.78989716T>CClinGen:CA2975833
NM_025074.7(FRAS1):c.118A>C (p.Ile40Leu)80144FRAS1Uncertain significance-1RCV001151140; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247915867379158673AC4:g.79158673A>C-
NM_025074.7(FRAS1):c.160G>C (p.Asp54His)80144FRAS1Benignrs17003071RCV000339420; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247915871579158715GC4:g.79158715G>CClinGen:CA2975849
NM_025074.7(FRAS1):c.195C>T (p.Asn65=)80144FRAS1Uncertain significancers200429476RCV000407938; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247915875079158750CT4:g.79158750C>TClinGen:CA2975857
NM_025074.7(FRAS1):c.201A>G (p.Gln67=)80144FRAS1Benign/Likely benignrs117876433RCV000304412|RCV000864877; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247915875679158756AG4:g.79158756A>GClinGen:CA2975859
NM_025074.7(FRAS1):c.227T>G (p.Leu76Arg)80144FRAS1Uncertain significancers199745197RCV000361503; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247916639779166397TG4:g.79166397T>GClinGen:CA2975879
NM_025074.7(FRAS1):c.237T>C (p.Ala79=)80144FRAS1Uncertain significancers370345916RCV000178368|RCV000259756; NMedGen:CN517202|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247916640779166407TC4:g.79166407T>CClinGen:CA245447C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.285C>A (p.Cys95Ter)80144FRAS1Pathogenic-1RCV001172405; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247916645579166455CA4:g.79166455C>A-
NM_025074.7(FRAS1):c.308A>T (p.Glu103Val)80144FRAS1Benignrs78711748RCV000298543; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247916647879166478AT4:g.79166478A>TClinGen:CA2975888
NM_025074.7(FRAS1):c.370C>T (p.Arg124Ter)80144FRAS1Pathogenicrs377046630RCV000178998|RCV001172407; NMedGen:CN517202|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247917360679173606CT4:g.79173606C>TClinGen:CA203126C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.371G>A (p.Arg124Gln)80144FRAS1Uncertain significance-1RCV001154209; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247917360779173607GA4:g.79173607G>A-
NM_025074.7(FRAS1):c.380C>G (p.Pro127Arg)80144FRAS1Benignrs147709711RCV000355670; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247917361679173616CG4:g.79173616C>GClinGen:CA2975924
NM_025074.7(FRAS1):c.384A>G (p.Gln128=)80144FRAS1Uncertain significance-1RCV001154210; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247917362079173620AG4:g.79173620A>G-
NM_025074.7(FRAS1):c.395C>T (p.Pro132Leu)80144FRAS1Uncertain significancers376122558RCV000263222; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247917363179173631CT4:g.79173631C>TClinGen:CA2975933
NM_025074.7(FRAS1):c.446G>A (p.Cys149Tyr)80144FRAS1Uncertain significance-1RCV001154211; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247917368279173682GA4:g.79173682G>A-
NM_025074.7(FRAS1):c.470-4C>G80144FRAS1Benignrs59429199RCV000330254|RCV000864282; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247917639279176392CG4:g.79176392C>GClinGen:CA2975971
NM_025074.7(FRAS1):c.516G>A (p.Trp172Ter)80144FRAS1Pathogenicrs1432850828RCV000790410; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247917644279176442GA4:g.79176442G>A-
NM_025074.7(FRAS1):c.518G>A (p.Arg173Gln)80144FRAS1Benignrs147332320RCV000387133; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247917644479176444GA4:g.79176444G>AClinGen:CA2975977
NM_025074.7(FRAS1):c.524G>A (p.Ser175Asn)80144FRAS1Uncertain significancers772288910RCV000276392; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247917645079176450GA4:g.79176450G>AClinGen:CA2975979
NM_025074.7(FRAS1):c.527G>A (p.Arg176Gln)80144FRAS1Uncertain significance-1RCV001155052; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247917645379176453GA4:g.79176453G>A-
NM_025074.7(FRAS1):c.570_571CA[4] (p.Ala192fs)80144FRAS1Pathogenic-1RCV001172411; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247917649579176496TTCACA4:g.79176495_79176496insCACA-
NM_025074.7(FRAS1):c.585G>T (p.Gln195His)80144FRAS1Uncertain significance-1RCV001155053; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247917651179176511GT4:g.79176511G>T-
NM_025074.7(FRAS1):c.604-132G>A80144FRAS1Benignrs6856362RCV000606403; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247918604779186047GA4:g.79186047G>AClinGen:CA2976006C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.604-11T>A80144FRAS1Uncertain significancers886059626RCV000333777; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247918616879186168TA4:g.79186168T>AClinGen:CA10618294
NM_025074.7(FRAS1):c.604-8G>A80144FRAS1Benignrs2867014RCV000252006|RCV000381460; NMedGen:CN169374|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247918617179186171GA4:g.79186171G>AClinGen:CA2976022
NM_025074.7(FRAS1):c.619C>T (p.Arg207Ter)80144FRAS1Pathogenic-1RCV001172414; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247918619479186194CT4:g.79186194C>T-
NM_025074.7(FRAS1):c.625C>T (p.Pro209Ser)80144FRAS1Benignrs7699637RCV000289381|RCV000864283; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247918620079186200CT4:g.79186200C>TClinGen:CA2976028
NM_025074.7(FRAS1):c.641C>T (p.Pro214Leu)80144FRAS1Conflicting interpretations of pathogenicityrs200053639RCV000346722|RCV000598265; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247918621679186216CT4:g.79186216C>TClinGen:CA2976030
NM_025074.7(FRAS1):c.667G>A (p.Ala223Thr)80144FRAS1Conflicting interpretations of pathogenicityrs200123398RCV000384983|RCV000875699; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247918624279186242GA4:g.79186242G>AClinGen:CA2976033
NM_025074.7(FRAS1):c.682T>C (p.Tyr228His)80144FRAS1Benignrs7682296RCV000281855|RCV000864284; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247918625779186257TC4:g.79186257T>CClinGen:CA2976037
NM_025074.7(FRAS1):c.688-13T>C80144FRAS1Benignrs144657066RCV000336829; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247918797579187975TC4:g.79187975T>CClinGen:CA2976051
NM_025074.7(FRAS1):c.688-5T>G80144FRAS1Pathogenic-1RCV001172413; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247918798379187983TG4:g.79187983T>G-
NM_025074.7(FRAS1):c.706G>A (p.Glu236Lys)80144FRAS1Uncertain significancers373994193RCV000400860; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247918800679188006GA4:g.79188006G>AClinGen:CA2976056
NM_025074.7(FRAS1):c.727A>G (p.Ile243Val)80144FRAS1Benignrs6848030RCV000297027|RCV000864601; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247918802779188027AG4:g.79188027A>GClinGen:CA2976060
NM_025074.7(FRAS1):c.763G>A (p.Ala255Thr)80144FRAS1Uncertain significancers886059627RCV000342487; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247918806379188063GA4:g.79188063G>AClinGen:CA10621701
NM_025074.7(FRAS1):c.776T>G (p.Leu259Arg)80144FRAS1Benign/Likely benignrs148509395RCV000180373|RCV000514095|RCV001156714|RCV001258255; NMedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MONDO:MONDO:0011558,MedGen:C2931213,OMIM:605472, Orphanet:231178, Orphanet:88647918807679188076TG4:g.79188076T>GClinGen:CA203673CN517202 not provided;
NM_025074.7(FRAS1):c.789+12T>G80144FRAS1Benign-1RCV001151263; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247918810179188101TG4:g.79188101T>G-
NM_025074.7(FRAS1):c.809G>A (p.Arg270His)80144FRAS1Uncertain significance-1RCV001151264; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247918841479188414GA4:g.79188414G>A-
NM_025074.7(FRAS1):c.826G>A (p.Glu276Lys)80144FRAS1Uncertain significancers886059628RCV000402290; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247918843179188431GA4:g.79188431G>AClinGen:CA10619240
NM_025074.7(FRAS1):c.856T>A (p.Ser286Thr)80144FRAS1Uncertain significance-1RCV001151265; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247918846179188461TA4:g.79188461T>A-
NM_025074.7(FRAS1):c.885C>T (p.Asp295=)80144FRAS1Uncertain significance-1RCV001151266; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247918849079188490CT4:g.79188490C>T-
NM_025074.7(FRAS1):c.886G>A (p.Glu296Lys)80144FRAS1Uncertain significancers186811333RCV000302837; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247918849179188491GA4:g.79188491G>AClinGen:CA2976109
NM_025074.7(FRAS1):c.903G>A (p.Ser301=)80144FRAS1Uncertain significance-1RCV001151267; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247918850879188508GA4:g.79188508G>A-
NM_025074.7(FRAS1):c.969G>A (p.Val323=)80144FRAS1Conflicting interpretations of pathogenicityrs377333036RCV000311638|RCV000357606; NMedGen:CN517202|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247918857479188574GA4:g.79188574G>AClinGen:CA2976122C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.979C>T (p.Arg327Trp)80144FRAS1Benignrs61999335RCV000272027; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247918858479188584CT4:g.79188584C>TClinGen:CA2976124
NM_025074.7(FRAS1):c.981+9C>T80144FRAS1Benignrs112081709RCV000308483; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247918859579188595CT4:g.79188595C>TClinGen:CA2976127
NM_025074.7(FRAS1):c.1072-5C>T80144FRAS1Benign-1RCV001154325; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247920254779202547CT4:g.79202547C>T-
NM_025074.7(FRAS1):c.1087A>G (p.Ser363Gly)80144FRAS1Uncertain significance-1RCV001154326; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247920256779202567AG4:g.79202567A>G-
NM_025074.7(FRAS1):c.1121G>A (p.Trp374Ter)80144FRAS1Pathogenic-1RCV001172419; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247920398779203987GA4:g.79203987G>A-
NM_025074.7(FRAS1):c.1153C>T (p.Arg385Ter)80144FRAS1Pathogenic-1RCV001172416; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247920401979204019CT4:g.79204019C>T-
NM_025074.7(FRAS1):c.1186T>C (p.Cys396Arg)80144FRAS1Uncertain significance-1RCV001154327; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247920405279204052TC4:g.79204052T>C-
NM_025074.7(FRAS1):c.1250C>T (p.Thr417Ile)80144FRAS1Uncertain significance-1RCV001154328; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247920411679204116CT4:g.79204116C>T-
NM_025074.7(FRAS1):c.1255+10T>C80144FRAS1Benign/Likely benignrs540508144RCV000899770|RCV001154329; NMedGen:CN517202|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247920413179204131TC4:g.79204131T>C-
NM_025074.7(FRAS1):c.1256-12C>T80144FRAS1Uncertain significancers370606261RCV000363207; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247920554779205547CT4:g.79205547C>TClinGen:CA2976241
NM_025074.7(FRAS1):c.1270G>C (p.Asp424His)80144FRAS1Uncertain significance-1RCV001155161; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247920557379205573GC4:g.79205573G>C-
NM_025074.7(FRAS1):c.1286C>A (p.Ser429Tyr)80144FRAS1Benignrs6838959RCV000277768|RCV000864602; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247920558979205589CA4:g.79205589C>AClinGen:CA2976248C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.1371T>C (p.Gly457=)80144FRAS1Uncertain significance-1RCV001155162; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247920567479205674TC4:g.79205674T>C-
NM_025074.7(FRAS1):c.1396T>A (p.Leu466Ile)80144FRAS1Benignrs12504081RCV000243148|RCV000333069; NMedGen:CN169374|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247920569979205699TA4:g.79205699T>AClinGen:CA2976263
NM_025074.7(FRAS1):c.1399+1G>A80144FRAS1Pathogenic-1RCV001172421; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247920570379205703GA4:g.79205703G>A-
NM_025074.7(FRAS1):c.1416C>T (p.Cys472=)80144FRAS1Benignrs35690113RCV000369014|RCV000865158; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247920757579207575CT4:g.79207575C>TClinGen:CA2976303C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.1486G>T (p.Val496Leu)80144FRAS1Uncertain significancers201490843RCV000274361; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247920764579207645GT4:g.79207645G>TClinGen:CA2976313C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.1528T>C (p.Cys510Arg)80144FRAS1Uncertain significance-1RCV001155163; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247920768779207687TC4:g.79207687T>C-
NM_025074.7(FRAS1):c.1598A>T (p.Asp533Val)80144FRAS1Uncertain significancers886059629RCV000320115; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247922928379229283AT4:g.79229283A>TClinGen:CA10621704C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.1609G>A (p.Val537Met)80144FRAS1Uncertain significancers367598897RCV000374408; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247922929479229294GA4:g.79229294G>AClinGen:CA2976362C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.1617A>G (p.Arg539=)80144FRAS1Benignrs345528RCV000279819; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247922930279229302AG4:g.79229302A>GClinGen:CA2976366C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.1635C>T (p.Ser545=)80144FRAS1Benign/Likely benignrs528765554RCV000316325|RCV000591566|RCV000873307; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN169374|MedGen:CN51720247922932079229320CT4:g.79229320C>TClinGen:CA2976378C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.1650C>A (p.Gly550=)80144FRAS1Uncertain significance-1RCV001156814; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247922933579229335CA4:g.79229335C>A-
NM_025074.7(FRAS1):c.1710C>T (p.Pro570=)80144FRAS1Benignrs17003124RCV000380193|RCV000873267; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247923677979236779CT4:g.79236779C>TClinGen:CA2976413C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.1722G>T (p.Arg574Ser)80144FRAS1Uncertain significancers886059630RCV000285883; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247923679179236791GT4:g.79236791G>TClinGen:CA10621724C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.1766G>A (p.Cys589Tyr)80144FRAS1Uncertain significance-1RCV001172422; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247923683579236835GA4:g.79236835G>A-
NM_025074.7(FRAS1):c.1769T>C (p.Met590Thr)80144FRAS1Benign/Likely benignrs35030041RCV000224361|RCV000340861; NMedGen:CN517202|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247923683879236838TC4:g.79236838T>CClinGen:CA2976422C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.1783G>A (p.Gly595Ser)80144FRAS1Uncertain significancers149843493RCV000398678; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247923685279236852GA4:g.79236852G>AClinGen:CA2976424C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.1796C>T (p.Ala599Val)80144FRAS1Uncertain significance-1RCV001151395; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247923686579236865CT4:g.79236865C>T-
NM_025074.7(FRAS1):c.1820-11C>T80144FRAS1Uncertain significancers117925872RCV000346162; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247923851179238511CT4:g.79238511C>TClinGen:CA2976457C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.1820-11C>G80144FRAS1Likely benignrs117925872RCV000291844; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247923851179238511CG4:g.79238511C>GClinGen:CA2976456C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.1848T>C (p.Ser616=)80144FRAS1Uncertain significancers878902352RCV000399519; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247923855079238550TC4:g.79238550T>CClinGen:CA10619244C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.1885C>G (p.Pro629Ala)80144FRAS1Uncertain significancers765144262RCV000306376; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247923858779238587CG4:g.79238587C>GClinGen:CA2976471C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.1905C>T (p.Gly635=)80144FRAS1Uncertain significance-1RCV001151396; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247923860779238607CT4:g.79238607C>T-
NM_025074.7(FRAS1):c.1914G>A (p.Leu638=)80144FRAS1Uncertain significancers778155926RCV000370427; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247923861679238616GA4:g.79238616G>AClinGen:CA2976483C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.1918C>T (p.Arg640Cys)80144FRAS1Conflicting interpretations of pathogenicity-1RCV001151397|RCV001171737; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247923862079238620CT4:g.79238620C>T-
NM_025074.7(FRAS1):c.1947T>C (p.His649=)80144FRAS1Benignrs345514RCV000175235|RCV000407507; NMedGen:CN169374|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247923864979238649TC4:g.79238649T>CClinGen:CA201354C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.2010T>A (p.Cys670Ter)80144FRAS1Pathogenic-1RCV001172424; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247924001379240013TA4:g.79240013T>A-
NM_025074.7(FRAS1):c.2027C>T (p.Pro676Leu)80144FRAS1Uncertain significancers202043019RCV000494487|RCV001154421; NMedGen:CN517202|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247924003079240030CT4:g.79240030C>TClinGen:CA2976533CN169374 not specified;
NM_025074.7(FRAS1):c.2060A>G (p.Asp687Gly)80144FRAS1Benignrs345513RCV000252679|RCV000312084; NMedGen:CN169374|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247924006379240063AG4:g.79240063A>GClinGen:CA2976538
NM_025074.7(FRAS1):c.2128A>C (p.Ile710Leu)80144FRAS1Benignrs345512RCV000366872; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247924013179240131AC4:g.79240131A>CClinGen:CA2976553
NM_025074.7(FRAS1):c.2132G>A (p.Cys711Tyr)80144FRAS1Uncertain significancers201740573RCV000262864; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247924013579240135GA4:g.79240135G>AClinGen:CA2976555
NM_025074.7(FRAS1):c.2137G>C (p.Ala713Pro)80144FRAS1Uncertain significancers369605412RCV000318364; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247924014079240140GC4:g.79240140G>CClinGen:CA2976556
NM_025074.7(FRAS1):c.2313G>T (p.Pro771=)80144FRAS1Benignrs396790RCV000354533; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247925886279258862GT4:g.79258862G>TClinGen:CA2976611
NM_025074.7(FRAS1):c.2328C>T (p.Cys776=)80144FRAS1Uncertain significancers776037240RCV000259530; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247925887779258877CT4:g.79258877C>TClinGen:CA2976614
NM_025074.7(FRAS1):c.2345A>T (p.His782Leu)80144FRAS1Uncertain significance-1RCV001155257; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247925889479258894AT4:g.79258894A>T-
NM_025074.7(FRAS1):c.2375C>A (p.Thr792Asn)80144FRAS1Uncertain significance-1RCV001155258; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247925892479258924CA4:g.79258924C>A-
NM_025074.7(FRAS1):c.2433C>T (p.His811=)80144FRAS1Uncertain significancers756276943RCV000324069; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247928467779284677CT4:g.79284677C>TClinGen:CA2976654
NM_025074.7(FRAS1):c.2450C>T (p.Ala817Val)80144FRAS1Benignrs6835769RCV000242783|RCV000378902; NMedGen:CN169374|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247928469479284694CT4:g.79284694C>TClinGen:CA2976656
NM_025074.7(FRAS1):c.2575+15G>A80144FRAS1Benignrs79624813RCV000284463; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247928483479284834GA4:g.79284834G>AClinGen:CA2976674
NM_025074.7(FRAS1):c.2598C>T (p.Thr866=)80144FRAS1Conflicting interpretations of pathogenicityrs149802708RCV000320715|RCV000877523; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247928508479285084CT4:g.79285084C>TClinGen:CA2976692
NM_025074.7(FRAS1):c.2647G>A (p.Val883Met)80144FRAS1Conflicting interpretations of pathogenicityrs377068014RCV000871923|RCV001155259; NMedGen:CN517202|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247928513379285133GA4:g.79285133G>A-
NM_025074.7(FRAS1):c.2660C>G (p.Thr887Ser)80144FRAS1Benignrs74510691RCV000384636|RCV000870651; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247928514679285146CG4:g.79285146C>GClinGen:CA2976709
NM_025074.7(FRAS1):c.2719C>T (p.Gln907Ter)80144FRAS1Pathogenic/Likely pathogenicrs755750961RCV000500822|RCV000760330; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247928520579285205CT4:g.79285205C>TClinGen:CA2976718
NM_025074.7(FRAS1):c.2722+1G>A80144FRAS1Pathogenicrs794727365RCV000224135|RCV001172426; NMedGen:CN517202|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247928520979285209GA4:g.79285209G>AClinGen:CA201906C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.2818G>C (p.Glu940Gln)80144FRAS1Uncertain significancers573458782RCV000289239; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247929108779291087GC4:g.79291087G>CClinGen:CA2976743
NM_025074.7(FRAS1):c.2835G>A (p.Gln945=)80144FRAS1Conflicting interpretations of pathogenicityrs137923783RCV000902046|RCV001156924; NMedGen:CN517202|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247929110479291104GA4:g.79291104G>A-
NM_025074.7(FRAS1):c.2846A>T (p.Asp949Val)80144FRAS1Uncertain significance-1RCV001156925; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247929111579291115AT4:g.79291115A>T-
NM_025074.7(FRAS1):c.2861C>T (p.Thr954Met)80144FRAS1Likely benignrs17003166RCV000732334|RCV000871682|RCV001156926; NMedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247929113079291130CT4:g.79291130C>T-
NM_025074.7(FRAS1):c.2870-5T>C80144FRAS1Uncertain significance-1RCV001156927; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247929386779293867TC4:g.79293867T>C-
NM_025074.7(FRAS1):c.2894G>T (p.Cys965Phe)80144FRAS1Likely pathogenicrs1325190118RCV000782359; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247929389679293896GT4:g.79293896G>T-
NM_025074.7(FRAS1):c.2934T>G (p.Asp978Glu)80144FRAS1Uncertain significance-1RCV001156928; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247929393679293936TG4:g.79293936T>G-
NM_025074.7(FRAS1):c.2935G>T (p.Gly979Cys)80144FRAS1Uncertain significance-1RCV001156929; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247929393779293937GT4:g.79293937G>T-
NM_025074.7(FRAS1):c.2939A>G (p.Tyr980Cys)80144FRAS1Uncertain significance-1RCV001156930; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247929394179293941AG4:g.79293941A>G-
NM_025074.7(FRAS1):c.2956G>A (p.Ala986Thr)80144FRAS1Conflicting interpretations of pathogenicityrs111554790RCV000514473|RCV001151503; NMedGen:CN517202|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247929395879293958GA4:g.79293958G>AClinGen:CA2976778CN517202 not provided;
NM_025074.7(FRAS1):c.3010+9G>A80144FRAS1Uncertain significancers148841455RCV000344196|RCV000396312; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247929402179294021GA4:g.79294021G>AClinGen:CA2976790C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.3048T>C (p.His1016=)80144FRAS1Uncertain significancers886059631RCV000394947; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247929530279295302TC4:g.79295302T>CClinGen:CA10618312
NM_025074.7(FRAS1):c.3058C>T (p.Arg1020Cys)80144FRAS1Uncertain significancers200292361RCV000295202|RCV000397108; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247929531279295312CT4:g.79295312C>TClinGen:CA2976813C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.3065A>C (p.Lys1022Thr)80144FRAS1Likely benignrs201252328RCV000876608|RCV001151504; NMedGen:CN517202|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247929531979295319AC4:g.79295319A>C-
NM_025074.7(FRAS1):c.3068G>A (p.Gly1023Glu)80144FRAS1Benignrs17459809RCV000350153; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247929532279295322GA4:g.79295322G>AClinGen:CA2976818
NM_025074.7(FRAS1):c.3124G>A (p.Ala1042Thr)80144FRAS1Benignrs114077522RCV000398347; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247929537879295378GA4:g.79295378G>AClinGen:CA2976831
NM_025074.7(FRAS1):c.3128A>G (p.Asp1043Gly)80144FRAS1Uncertain significancers886059632RCV000300692; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247929538279295382AG4:g.79295382A>GClinGen:CA10618313
NM_025074.7(FRAS1):c.3151+14_3151+15dup80144FRAS1Benignrs398092530RCV000246753|RCV000355496; NMedGen:CN169374|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247929541879295419CCTG4:g.79295418_79295419insTGClinGen:CA2976837
NM_025074.7(FRAS1):c.3152-10T>C80144FRAS1Uncertain significancers776449329RCV000398648; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247929688379296883TC4:g.79296883T>CClinGen:CA2976856
NM_025074.7(FRAS1):c.3157C>A (p.Pro1053Thr)80144FRAS1Uncertain significance-1RCV001154519; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247929689879296898CA4:g.79296898C>A-
NM_025074.7(FRAS1):c.3286T>C (p.Cys1096Arg)80144FRAS1Uncertain significancers765732994RCV000297107; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247929702779297027TC4:g.79297027T>CClinGen:CA2976886
NM_025074.7(FRAS1):c.3312T>C (p.Ser1104=)80144FRAS1Benignrs35774552RCV000176765|RCV000361100; NMedGen:CN169374|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247930089979300899TC4:g.79300899T>CClinGen:CA202103C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.3406G>A (p.Glu1136Lys)80144FRAS1Benignrs12512164RCV000176766|RCV000266510; NMedGen:CN169374|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247930099379300993GA4:g.79300993G>AClinGen:CA202105C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.3529A>C (p.Lys1177Gln)80144FRAS1Uncertain significance-1RCV001154520; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247930111679301116AC4:g.79301116A>C-
NM_025074.7(FRAS1):c.3567A>G (p.Lys1189=)80144FRAS1Uncertain significance-1RCV001154521; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247930521679305216AG4:g.79305216A>G-
NM_025074.7(FRAS1):c.3648+12G>A80144FRAS1Uncertain significance-1RCV001154522; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247930530979305309GA4:g.79305309G>A-
NM_025074.7(FRAS1):c.3649-9A>C80144FRAS1Conflicting interpretations of pathogenicityrs763538373RCV000897188|RCV001155343; NMedGen:CN517202|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247930852079308520AC4:g.79308520A>C-
NM_025074.7(FRAS1):c.3730C>T (p.Arg1244Ter)80144FRAS1Pathogenic-1RCV001172412; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247930861079308610CT4:g.79308610C>T-
NM_025074.7(FRAS1):c.3799C>T (p.Gln1267Ter)80144FRAS1Pathogenicrs120074158RCV000002946; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247930867979308679CT4:g.79308679C>TClinGen:CA115773,OMIM:607830.0004C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.3824C>G (p.Pro1275Arg)80144FRAS1Uncertain significance-1RCV001155344; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247930870479308704CG4:g.79308704C>G-
NM_025074.7(FRAS1):c.3873T>C (p.Tyr1291=)80144FRAS1Uncertain significance-1RCV001155345; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247930875379308753TC4:g.79308753T>C-
NM_025074.7(FRAS1):c.3951G>A (p.Leu1317=)80144FRAS1Benignrs76107832RCV000302768|RCV000870806; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247930883179308831GA4:g.79308831G>AClinGen:CA2977049
NM_025074.7(FRAS1):c.3986G>A (p.Gly1329Asp)80144FRAS1Uncertain significance-1RCV001155346; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247932189879321898GA4:g.79321898G>A-
NM_025074.7(FRAS1):c.4009A>G (p.Met1337Val)80144FRAS1Uncertain significancers765572525RCV000357532; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247932192179321921AG4:g.79321921A>GClinGen:CA2977076
NM_025074.7(FRAS1):c.4019T>C (p.Val1340Ala)80144FRAS1Uncertain significance-1RCV001155347; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247932193179321931TC4:g.79321931T>C-
NM_025074.7(FRAS1):c.4032dup (p.Met1345fs)80144FRAS1Pathogenic-1RCV001172429; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247932193879321939AAG4:g.79321938_79321939insG-
NM_025074.7(FRAS1):c.4095C>T (p.Ile1365=)80144FRAS1Conflicting interpretations of pathogenicityrs79869130RCV000502497|RCV000871789|RCV001155348; NMedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247932200779322007CT4:g.79322007C>TClinGen:CA2977089
NM_025074.7(FRAS1):c.4111C>T (p.Gln1371Ter)80144FRAS1Pathogenic-1RCV001172408; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247932202379322023CT4:g.79322023C>T-
NM_025074.7(FRAS1):c.4143T>C (p.Leu1381=)80144FRAS1Benignrs113301188RCV000870937|RCV001157030; NMedGen:CN517202|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247932883079328830TC4:g.79328830T>C-
NM_025074.7(FRAS1):c.4159G>T (p.Ala1387Ser)80144FRAS1Uncertain significance-1RCV001157031; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247932884679328846GT4:g.79328846G>T-
NM_025074.7(FRAS1):c.4160C>T (p.Ala1387Val)80144FRAS1Conflicting interpretations of pathogenicityrs201864889RCV000272259|RCV000958083; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247932884779328847CT4:g.79328847C>TClinGen:CA2977121
NM_025074.7(FRAS1):c.4181G>C (p.Gly1394Ala)80144FRAS1Uncertain significancers376487875RCV000327375; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247932886879328868GC4:g.79328868G>CClinGen:CA2977123
NM_025074.7(FRAS1):c.4183C>T (p.Gln1395Ter)80144FRAS1Pathogenic-1RCV001172430; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247932887079328870CT4:g.79328870C>T-
NM_025074.7(FRAS1):c.4255G>A (p.Val1419Ile)80144FRAS1Uncertain significance-1RCV001157032; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247932894279328942GA4:g.79328942G>A-
NM_025074.7(FRAS1):c.4271C>G (p.Ser1424Ter)80144FRAS1Pathogenicrs120074159RCV000002947; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247932895879328958CG4:g.79328958C>GClinGen:CA115775,OMIM:607830.0005C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.4346G>T (p.Ser1449Ile)80144FRAS1Conflicting interpretations of pathogenicityrs201131604RCV000877954|RCV001157033; NMedGen:CN517202|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247933416079334160GT4:g.79334160G>T-
NM_025074.7(FRAS1):c.4364C>T (p.Ala1455Val)80144FRAS1Uncertain significancers201693179RCV000382855|RCV000735054; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247933417879334178CT4:g.79334178C>TClinGen:CA2977173
NM_025074.7(FRAS1):c.4367T>C (p.Ile1456Thr)80144FRAS1Uncertain significance-1RCV001157034; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247933418179334181TC4:g.79334181T>C-
NM_025074.7(FRAS1):c.4555C>T (p.Arg1519Trp)80144FRAS1Uncertain significancers761970312RCV000269617; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247934303179343031CT4:g.79343031C>TClinGen:CA2977245
NM_025074.7(FRAS1):c.4557G>A (p.Arg1519=)80144FRAS1Conflicting interpretations of pathogenicityrs773736914RCV000333996|RCV000930389; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247934303379343033GA4:g.79343033G>AClinGen:CA2977247
NM_025074.7(FRAS1):c.4578C>G (p.Ile1526Met)80144FRAS1Uncertain significance-1RCV001254010; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247934305479343054CG4:g.79343054C>G-
NM_025074.7(FRAS1):c.4579C>T (p.Arg1527Trp)80144FRAS1Conflicting interpretations of pathogenicityrs1872267RCV000388525|RCV000658999; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247934305579343055CT4:g.79343055C>TClinGen:CA244749C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.4580G>A (p.Arg1527Gln)80144FRAS1Uncertain significance-1RCV001254011; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247934305679343056GA4:g.79343056G>A-
NM_025074.7(FRAS1):c.4634C>T (p.Pro1545Leu)80144FRAS1Uncertain significancers201675499RCV000294415; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247934311079343110CT4:g.79343110C>TClinGen:CA2977263
NM_025074.7(FRAS1):c.4635G>A (p.Pro1545=)80144FRAS1Benignrs78575519RCV000243307|RCV000349386; NMedGen:CN169374|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247934311179343111GA4:g.79343111G>AClinGen:CA2977264
NM_025074.7(FRAS1):c.4648C>T (p.Leu1550Phe)80144FRAS1Conflicting interpretations of pathogenicityrs148663672RCV000375909|RCV000488060; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247934312479343124CT4:g.79343124C>TClinGen:CA2977267
NM_025074.7(FRAS1):c.4678+5T>C80144FRAS1Uncertain significancers76993002RCV000281504; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247934315979343159TC4:g.79343159T>CClinGen:CA2977271
NM_025074.7(FRAS1):c.4679-9C>T80144FRAS1Conflicting interpretations of pathogenicity-1RCV001154630|RCV001253867; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247934553379345533CT4:g.79345533C>T-
NM_025074.7(FRAS1):c.4682T>C (p.Leu1561Pro)80144FRAS1Uncertain significancers376814395RCV000336087; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247934554579345545TC4:g.79345545T>CClinGen:CA2977292
NM_025074.7(FRAS1):c.4737G>A (p.Pro1579=)80144FRAS1Uncertain significancers373137263RCV000401213; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247935027479350274GA4:g.79350274G>AClinGen:CA2977319
NM_025074.7(FRAS1):c.4808G>A (p.Arg1603Gln)80144FRAS1Uncertain significance-1RCV001154631; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247935034579350345GA4:g.79350345G>A-
NM_025074.7(FRAS1):c.4815G>A (p.Ala1605=)80144FRAS1Benign/Likely benignrs201188262RCV000305718|RCV000871712; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247935035279350352GA4:g.79350352G>AClinGen:CA2977335
NM_025074.7(FRAS1):c.4874C>T (p.Thr1625Ile)80144FRAS1Uncertain significance-1RCV001154632; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247935147679351476CT4:g.79351476C>T-
NM_025074.7(FRAS1):c.4940C>T (p.Thr1647Ile)80144FRAS1Benignrs34271211RCV000341961|RCV000864826; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247935154279351542CT4:g.79351542C>TClinGen:CA2977368
NM_025074.7(FRAS1):c.4959G>A (p.Pro1653=)80144FRAS1Benign/Likely benignrs372154997RCV000402329|RCV000879378; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247935156179351561GA4:g.79351561G>AClinGen:CA2977371C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.5034T>C (p.Ser1678=)80144FRAS1Uncertain significance-1RCV001155470; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247935357579353575TC4:g.79353575T>C-
NM_025074.7(FRAS1):c.5039G>A (p.Arg1680Gln)80144FRAS1Uncertain significancers201110914RCV000302495; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247935358079353580GA4:g.79353580G>AClinGen:CA2977410C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.5046C>G (p.Asp1682Glu)80144FRAS1Conflicting interpretations of pathogenicityrs35219594RCV000177952|RCV000366484|RCV000870983; NMedGen:CN169374|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247935358779353587CG4:g.79353587C>GClinGen:CA202671C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.5056A>C (p.Ile1686Leu)80144FRAS1Uncertain significance-1RCV001155471; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247935359779353597AC4:g.79353597A>C-
NM_025074.7(FRAS1):c.5134C>T (p.Arg1712Ter)80144FRAS1Pathogenic-1RCV001172415; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247935367579353675CT4:g.79353675C>T-
NM_025074.7(FRAS1):c.5169_5175del (p.Ala1724fs)80144FRAS1Pathogenic-1RCV001172423; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247935370879353714TGTTGCCAT4:g.79353708_79353714del-
NM_025074.7(FRAS1):c.5208T>C (p.Leu1736=)80144FRAS1Benignrs35608396RCV000271918|RCV000870846; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247935374979353749TC4:g.79353749T>CClinGen:CA2977444C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.5218-9C>T80144FRAS1Uncertain significancers369761349RCV000306455; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247935971579359715CT4:g.79359715C>TClinGen:CA2977466C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.5366+13T>G80144FRAS1Benignrs2170899RCV000178008|RCV000370507; NMedGen:CN169374|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247935988579359885TG4:g.79359885T>GClinGen:CA202688C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.5370C>G (p.Tyr1790Ter)80144FRAS1Likely pathogenicrs757311669RCV000761280; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247936005979360059CG4:g.79360059C>G-
NM_025074.7(FRAS1):c.5374G>A (p.Ala1792Thr)80144FRAS1Conflicting interpretations of pathogenicityrs150916370RCV000872516|RCV001157148; NMedGen:CN517202|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247936006379360063GA4:g.79360063G>A-
NM_025074.7(FRAS1):c.5419_5424del (p.Phe1807_Ser1808del)80144FRAS1Uncertain significancers730882178RCV000002948; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247936010779360112ATTTCTCA4:g.79360107_79360112delClinGen:CA212802,OMIM:607830.0006C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.5474T>G (p.Met1825Arg)80144FRAS1Uncertain significance-1RCV001157149; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247936016379360163TG4:g.79360163T>G-
NM_025074.7(FRAS1):c.5516C>T (p.Ala1839Val)80144FRAS1Uncertain significancers769089211RCV000275946; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247936020579360205CT4:g.79360205C>TClinGen:CA2977525C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.5574dup (p.Ala1859fs)80144FRAS1Pathogenic-1RCV001172427; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247936235379362354AAT4:g.79362353_79362354insT-
NM_025074.7(FRAS1):c.5664_5665+19delinsT80144FRAS1Pathogenicrs886037766RCV000257997; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247936245079362470AGGTACTACTTCCTGTAAAACT4:g.79362451_79362470delClinGen:CA10575841
NM_025074.7(FRAS1):c.5670T>C (p.Asp1890=)80144FRAS1Uncertain significance-1RCV001157150; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247936668079366680TC4:g.79366680T>C-
NM_025074.7(FRAS1):c.5716del (p.Ile1906fs)80144FRAS1Pathogenic-1RCV001172432; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247936672679366726TAT4:g.79366726_79366726del-
NM_025074.7(FRAS1):c.5756G>A (p.Ser1919Asn)80144FRAS1Uncertain significancers763355889RCV000330987; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247936676679366766GA4:g.79366766G>AClinGen:CA2977599C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.5788A>G (p.Ile1930Val)80144FRAS1Uncertain significancers373432682RCV000385357; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247936679879366798AG4:g.79366798A>GClinGen:CA2977605C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.5862G>T (p.Lys1954Asn)80144FRAS1Uncertain significance-1RCV001157151; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247936788679367886GT4:g.79367886G>T-
NM_025074.7(FRAS1):c.5865C>T (p.Asn1955=)80144FRAS1Conflicting interpretations of pathogenicityrs201750748RCV000262786|RCV000873523; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247936788979367889CT4:g.79367889C>TClinGen:CA2977649C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.5952dup (p.Asp1985fs)80144FRAS1Pathogenic-1RCV001172434; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247936797479367975CCA4:g.79367974_79367975insA-
NM_025074.7(FRAS1):c.6010G>A (p.Gly2004Ser)80144FRAS1Pathogenic-1RCV001172433; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247936803479368034GA4:g.79368034G>A-
NM_025074.7(FRAS1):c.6010+8A>G80144FRAS1Benignrs7670555RCV000318010; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247936804279368042AG4:g.79368042A>GClinGen:CA2977677
NM_025074.7(FRAS1):c.6010+10G>A80144FRAS1Benignrs78537685RCV000372672; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247936804479368044GA4:g.79368044G>AClinGen:CA2977679C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.6010+13C>T80144FRAS1Benignrs75774018RCV000278438; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247936804779368047CT4:g.79368047C>TClinGen:CA2977680C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.6039T>C (p.Ser2013=)80144FRAS1Benignrs76472539RCV000342802|RCV000864603; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247936923579369235TC4:g.79369235T>CClinGen:CA2977688C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.6124C>T (p.Pro2042Ser)80144FRAS1Benignrs60539739RCV000378700|RCV000872358; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247936932079369320CT4:g.79369320C>TClinGen:CA2977703C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.6252C>T (p.Asn2084=)80144FRAS1Benignrs114956797RCV000284259|RCV000864604; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247936944879369448CT4:g.79369448C>TClinGen:CA2977726C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.6286C>T (p.Arg2096Cys)80144FRAS1Uncertain significance-1RCV001151693; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247937131679371316CT4:g.79371316C>T-
NM_025074.7(FRAS1):c.6301C>T (p.His2101Tyr)80144FRAS1Benign/Likely benignrs183398121RCV000339469|RCV000871375; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247937133179371331CT4:g.79371331C>TClinGen:CA2977747C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.6303C>G (p.His2101Gln)80144FRAS1Uncertain significance-1RCV001197810; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247937133379371333CG4:g.79371333C>G-
NM_025074.7(FRAS1):c.6444C>T (p.Thr2148=)80144FRAS1Benignrs17003235RCV000243803|RCV000396201; NMedGen:CN169374|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247937147479371474CT4:g.79371474C>TClinGen:CA2977783
NM_025074.7(FRAS1):c.6468C>T (p.His2156=)80144FRAS1Benignrs753752RCV000178609|RCV000309112; NMedGen:CN169374|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247937293079372930CT4:g.79372930C>TClinGen:CA202954C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.6530T>C (p.Val2177Ala)80144FRAS1Benign/Likely benignrs76345011RCV000274838|RCV000907976|RCV001152933; NMedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247937299279372992TC4:g.79372992T>CClinGen:CA2977816CN169374 not specified;
NM_025074.7(FRAS1):c.6569C>T (p.Ser2190Phe)80144FRAS1Conflicting interpretations of pathogenicityrs200166354RCV000345247|RCV000980053; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247937303179373031CT4:g.79373031C>TClinGen:CA2977821
NM_025074.7(FRAS1):c.6608C>T (p.Thr2203Ile)80144FRAS1Benignrs114373602RCV000399402|RCV000864605; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247937335379373353CT4:g.79373353C>TClinGen:CA2977842
NM_025074.7(FRAS1):c.6622C>T (p.Leu2208=)80144FRAS1Uncertain significancers373744776RCV000315047; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247937336779373367CT4:g.79373367C>TClinGen:CA2977843
NM_025074.7(FRAS1):c.6681C>G (p.Asp2227Glu)80144FRAS1Uncertain significance-1RCV001152934; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247937342679373426CG4:g.79373426C>G-
NM_025074.7(FRAS1):c.6684G>A (p.Gln2228=)80144FRAS1Uncertain significancers759150629RCV000369746; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247937342979373429GA4:g.79373429G>AClinGen:CA2977853
NM_025074.7(FRAS1):c.6691G>A (p.Gly2231Arg)80144FRAS1Benignrs76623027RCV000407561|RCV000864606; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247937343679373436GA4:g.79373436G>AClinGen:CA2977857
NM_025074.7(FRAS1):c.6726G>A (p.Gln2242=)80144FRAS1Uncertain significancers761562615RCV000312500; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247937347179373471GA4:g.79373471G>AClinGen:CA2977863
NM_025074.7(FRAS1):c.6727C>T (p.Pro2243Ser)80144FRAS1Uncertain significancers764783509RCV000355589; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247937347279373472CT4:g.79373472C>TClinGen:CA2977864
NM_025074.7(FRAS1):c.6754G>A (p.Ala2252Thr)80144FRAS1Benignrs78404051RCV000263041|RCV000864607; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247937349979373499GA4:g.79373499G>AClinGen:CA2977868
NM_025074.7(FRAS1):c.6763+12A>G80144FRAS1Likely benign-1RCV001155568; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247937352079373520AG4:g.79373520A>G-
NM_025074.7(FRAS1):c.6806G>A (p.Arg2269Gln)80144FRAS1Uncertain significancers771923121RCV000315946; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247938521779385217GA4:g.79385217G>AClinGen:CA2977895
NM_025074.7(FRAS1):c.6924C>T (p.Val2308=)80144FRAS1Benignrs13123710RCV000253422|RCV000354292; NMedGen:CN169374|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247938563279385632CT4:g.79385632C>TClinGen:CA2977932
NM_025074.7(FRAS1):c.6932C>T (p.Ser2311Leu)80144FRAS1Uncertain significancers202092409RCV000266447; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247938564079385640CT4:g.79385640C>TClinGen:CA2977936
NM_025074.7(FRAS1):c.6939C>T (p.Pro2313=)80144FRAS1Benign/Likely benignrs150936204RCV000324038|RCV000876609; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247938564779385647CT4:g.79385647C>TClinGen:CA2977938
NM_025074.7(FRAS1):c.6963_6964dup (p.Val2322fs)80144FRAS1Pathogenicrs730882179RCV000002949|RCV001093377; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247938566979385670CCGG4:g.79385669_79385670insGGClinGen:CA212804,OMIM:607830.0007C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.7011G>A (p.Ala2337=)80144FRAS1Benignrs6851427RCV000246034|RCV000376269; NMedGen:CN169374|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247938571979385719GA4:g.79385719G>AClinGen:CA2977955
NM_025074.7(FRAS1):c.7029+7G>A80144FRAS1Conflicting interpretations of pathogenicityrs183687186RCV000733473|RCV001157257; NMedGen:CN517202|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247938574479385744GA4:g.79385744G>A-
NM_025074.7(FRAS1):c.7029+9A>C80144FRAS1Benign/Likely benignrs188606284RCV000283913|RCV000865347; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247938574679385746AC4:g.79385746A>CClinGen:CA2977960
NM_025074.7(FRAS1):c.7033G>A (p.Glu2345Lys)80144FRAS1Conflicting interpretations of pathogenicityrs56291926RCV000305628|RCV001157258; NMedGen:CN517202|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247938736579387365GA4:g.79387365G>AClinGen:CA2977978CN169374 not specified;
NM_025074.7(FRAS1):c.7035G>A (p.Glu2345=)80144FRAS1Uncertain significancers886059633RCV000327285; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247938736779387367GA4:g.79387367G>AClinGen:CA10621737
NM_025074.7(FRAS1):c.7039G>T (p.Val2347Phe)80144FRAS1Uncertain significancers201369510RCV000384240|RCV000488371; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247938737179387371GT4:g.79387371G>TClinGen:CA246305C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.7074C>T (p.Gly2358=)80144FRAS1Benignrs7660641RCV000287606|RCV000872359; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247938740679387406CT4:g.79387406C>TClinGen:CA2977990
NM_025074.7(FRAS1):c.7085G>A (p.Arg2362Gln)80144FRAS1Uncertain significance-1RCV001157259; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247938741779387417GA4:g.79387417G>A-
NM_025074.7(FRAS1):c.7110C>T (p.His2370=)80144FRAS1Benignrs7660664RCV000249146|RCV000351573; NMedGen:CN169374|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247938744279387442CT4:g.79387442C>TClinGen:CA2977998
NM_025074.7(FRAS1):c.7132A>G (p.Lys2378Glu)80144FRAS1Benignrs7684722RCV000253922|RCV000395153; NMedGen:CN169374|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247938746479387464AG4:g.79387464A>GClinGen:CA2978000
NM_025074.7(FRAS1):c.7219A>T (p.Thr2407Ser)80144FRAS1Uncertain significancers886059634RCV000293042; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247938755179387551AT4:g.79387551A>TClinGen:CA10619267
NM_025074.7(FRAS1):c.7223A>G (p.Asn2408Ser)80144FRAS1Uncertain significancers201277074RCV000350355; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247938755579387555AG4:g.79387555A>GClinGen:CA2978013
NM_025074.7(FRAS1):c.7238T>C (p.Ile2413Thr)80144FRAS1Uncertain significance-1RCV001151797; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247938757079387570TC4:g.79387570T>C-
NM_025074.7(FRAS1):c.7254A>G (p.Lys2418=)80144FRAS1Benignrs34840208RCV000398451; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247938758679387586AG4:g.79387586A>GClinGen:CA2978020
NM_025074.7(FRAS1):c.7371+11T>C80144FRAS1Benignrs7664505RCV000245741|RCV000301405; NMedGen:CN169374|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247939125679391256TC4:g.79391256T>CClinGen:CA2978069
NM_025074.7(FRAS1):c.7422C>A (p.Thr2474=)80144FRAS1Uncertain significance-1RCV001151798; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247939338479393384CA4:g.79393384C>A-
NM_025074.7(FRAS1):c.7441T>A (p.Tyr2481Asn)80144FRAS1Uncertain significance-1RCV001153047; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247939340379393403TA4:g.79393403T>A-
NM_025074.7(FRAS1):c.7451C>T (p.Thr2484Met)80144FRAS1Uncertain significancers200888184RCV000354018; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247939341379393413CT4:g.79393413C>TClinGen:CA2978101
NM_025074.7(FRAS1):c.7522+1G>T80144FRAS1Pathogenicrs730882180RCV000002950; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247939348579393485GT4:g.79393485G>TClinGen:CA212805,OMIM:607830.0008
NM_025074.7(FRAS1):c.7522+12C>G80144FRAS1Uncertain significancers188066525RCV000400371; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247939349679393496CG4:g.79393496C>GClinGen:CA2978123
NM_025074.7(FRAS1):c.7551T>A (p.Tyr2517Ter)80144FRAS1Conflicting interpretations of pathogenicityrs745597204RCV000223984|RCV000778741; NMedGen:CN517202|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247939462079394620TA4:g.79394620T>AClinGen:CA2978147
NM_025074.7(FRAS1):c.7573C>T (p.Arg2525Cys)80144FRAS1Uncertain significance-1RCV001153048; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247939464279394642CT4:g.79394642C>T-
NM_025074.7(FRAS1):c.7622A>G (p.Asn2541Ser)80144FRAS1Likely benignrs144530996RCV000304479|RCV000873180; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247939469179394691AG4:g.79394691A>GClinGen:CA2978164
NM_025074.7(FRAS1):c.7633G>A (p.Asp2545Asn)80144FRAS1Benignrs4388111RCV000361577|RCV000870847; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247939470279394702GA4:g.79394702G>AClinGen:CA2978166
NM_025074.7(FRAS1):c.7652A>G (p.Gln2551Arg)80144FRAS1Benignrs183712679RCV000265000|RCV000870879; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247939472179394721AG4:g.79394721A>GClinGen:CA2978167
NM_025074.7(FRAS1):c.7701G>A (p.Lys2567=)80144FRAS1Benignrs79849142RCV000322445|RCV000870678; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247939661079396610GA4:g.79396610G>AClinGen:CA2978185
NM_025074.7(FRAS1):c.7722G>A (p.Thr2574=)80144FRAS1Conflicting interpretations of pathogenicityrs569422992RCV000365383|RCV000916600; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247939663179396631GA4:g.79396631G>AClinGen:CA2978191
NM_025074.7(FRAS1):c.7758C>T (p.Ile2586=)80144FRAS1Benignrs77602894RCV000273188|RCV000870679; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247939666779396667CT4:g.79396667C>TClinGen:CA2978201
NM_025074.7(FRAS1):c.7923T>C (p.Asn2641=)80144FRAS1Uncertain significancers765455808RCV000325784; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247939904079399040TC4:g.79399040T>CClinGen:CA2978251
NM_025074.7(FRAS1):c.8002A>G (p.Asn2668Asp)80144FRAS1Uncertain significance-1RCV001155667; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247939911979399119AG4:g.79399119A>G-
NM_025074.7(FRAS1):c.8004C>T (p.Asn2668=)80144FRAS1Uncertain significancers886059635RCV000382746; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247939912179399121CT4:g.79399121C>TClinGen:CA10621738
NM_025074.7(FRAS1):c.8010C>T (p.Thr2670=)80144FRAS1Conflicting interpretations of pathogenicityrs370597256RCV000872609|RCV001155668; NMedGen:CN517202|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247939912779399127CT4:g.79399127C>T-
NM_025074.7(FRAS1):c.8098+1G>T80144FRAS1Pathogenic-1RCV001172435; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247939921679399216GT4:g.79399216G>T-
NM_025074.7(FRAS1):c.8125A>G (p.Ile2709Val)80144FRAS1Uncertain significancers762129626RCV000294681; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247940055479400554AG4:g.79400554A>GClinGen:CA2978292
NM_025074.7(FRAS1):c.8215G>A (p.Ala2739Thr)80144FRAS1Benignrs192476468RCV000872043|RCV001155669; NMedGen:CN517202|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247940064479400644GA4:g.79400644G>A-
NM_025074.7(FRAS1):c.8295G>A (p.Glu2765=)80144FRAS1Uncertain significance-1RCV001157345; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247940072479400724GA4:g.79400724G>A-
NM_025074.7(FRAS1):c.8329T>C (p.Ser2777Pro)80144FRAS1Uncertain significance-1RCV001157346; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247940075879400758TC4:g.79400758T>C-
NM_025074.7(FRAS1):c.8341C>T (p.Arg2781Cys)80144FRAS1Uncertain significance-1RCV001157347; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247940077079400770CT4:g.79400770C>T-
NM_025074.7(FRAS1):c.8414A>G (p.Asn2805Ser)80144FRAS1Conflicting interpretations of pathogenicityrs117838818RCV000864878|RCV001157348|RCV001252860; NMedGen:CN517202|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|Human Phenotype Ontology:HP:0000252,Human Phenotype Ontology:HP:0001366,Human Phenotype Ontology:HP:0005485,Human Phenotype Ontology:HP:0005489,Human Phenotype Ontology:HP:00047940084379400843AG4:g.79400843A>G-
NM_025074.7(FRAS1):c.8417C>T (p.Thr2806Met)80144FRAS1Benignrs114190041RCV000333266|RCV000870652; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247940084679400846CT4:g.79400846C>TClinGen:CA2978352
NM_025074.7(FRAS1):c.8439C>T (p.Asp2813=)80144FRAS1Benignrs11098194RCV000251274|RCV000385525; NMedGen:CN169374|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247940086879400868CT4:g.79400868C>TClinGen:CA2978357
NM_025074.7(FRAS1):c.8440G>A (p.Ala2814Thr)80144FRAS1Uncertain significance-1RCV001157349; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247940086979400869GA4:g.79400869G>A-
NM_025074.7(FRAS1):c.8440G>T (p.Ala2814Ser)80144FRAS1Uncertain significance-1RCV001157350; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247940086979400869GT4:g.79400869G>T-
NM_025074.7(FRAS1):c.8441C>T (p.Ala2814Val)80144FRAS1Uncertain significancers886059636RCV000293603; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247940087079400870CT4:g.79400870C>TClinGen:CA10618351
NM_025074.7(FRAS1):c.8443+8A>G80144FRAS1Conflicting interpretations of pathogenicityrs373820698RCV000336626|RCV000926026; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247940088079400880AG4:g.79400880A>GClinGen:CA2978361C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.8444-15T>C80144FRAS1Uncertain significancers373332959RCV000394370; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247940294379402943TC4:g.79402943T>CClinGen:CA2978374C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.8460A>G (p.Pro2820=)80144FRAS1Uncertain significance-1RCV001151898; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247940297479402974AG4:g.79402974A>G-
NM_025074.7(FRAS1):c.8486C>A (p.Ser2829Tyr)80144FRAS1Likely benignrs376788346RCV000278244; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247940300079403000CA4:g.79403000C>AClinGen:CA2978389C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.8515C>T (p.Arg2839Trp)80144FRAS1Uncertain significancers373073168RCV000335599; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247940302979403029CT4:g.79403029C>TClinGen:CA2978400C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.8535T>A (p.Ser2845=)80144FRAS1Uncertain significance-1RCV001151899; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247940304979403049TA4:g.79403049T>A-
NM_025074.7(FRAS1):c.8556C>T (p.Tyr2852=)80144FRAS1Uncertain significancers778885038RCV000394378; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247940307079403070CT4:g.79403070C>TClinGen:CA2978409C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.8574G>A (p.Lys2858=)80144FRAS1Benign/Likely benignrs201745281RCV000305485|RCV000872020; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247940308879403088GA4:g.79403088G>AClinGen:CA2978413C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.8602C>T (p.Gln2868Ter)80144FRAS1Pathogenicrs120074156RCV000002943; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247940311679403116CT4:g.79403116C>TClinGen:CA115769,OMIM:607830.0001C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.8604+5G>A80144FRAS1Likely pathogenic-1RCV001172428; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247940312379403123GA4:g.79403123G>A-
NM_025074.7(FRAS1):c.8605-7C>T80144FRAS1Uncertain significancers765550592RCV000339255; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247940353579403535CT4:g.79403535C>TClinGen:CA2978447C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.8613C>G (p.Thr2871=)80144FRAS1Uncertain significancers758106272RCV000400902; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247940355079403550CG4:g.79403550C>GClinGen:CA2978449C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.8643G>A (p.Pro2881=)80144FRAS1Uncertain significancers749014065RCV000309042; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247940358079403580GA4:g.79403580G>AClinGen:CA2978457C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.8698G>A (p.Glu2900Lys)80144FRAS1Likely benignrs150998139RCV000366027|RCV000903182; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247940363579403635GA4:g.79403635G>AClinGen:CA2978467C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.8705C>T (p.Thr2902Ile)80144FRAS1Uncertain significancers757116242RCV000269170; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247940364279403642CT4:g.79403642C>TClinGen:CA2978469C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.8725A>T (p.Ile2909Phe)80144FRAS1Uncertain significance-1RCV001153158; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247940366279403662AT4:g.79403662A>T-
NM_025074.7(FRAS1):c.8745C>T (p.Phe2915=)80144FRAS1Benignrs41327848RCV000243075|RCV000307968; NMedGen:CN169374|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247940368279403682CT4:g.79403682C>TClinGen:CA2978475
NM_025074.7(FRAS1):c.8832C>T (p.Ser2944=)80144FRAS1Benign/Likely benignrs114854941RCV000729980|RCV000870746|RCV001155759; NMedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247941010879410108CT4:g.79410108C>T-
NM_025074.7(FRAS1):c.8844C>T (p.Ser2948=)80144FRAS1Uncertain significance-1RCV001155760; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247941012079410120CT4:g.79410120C>T-
NM_025074.7(FRAS1):c.8846A>T (p.Tyr2949Phe)80144FRAS1Uncertain significancers200212920RCV000179228|RCV001155761; NMedGen:CN517202|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247941012279410122AT4:g.79410122A>TClinGen:CA246504CN169374 not specified;
NM_025074.7(FRAS1):c.8940A>G (p.Thr2980=)80144FRAS1Conflicting interpretations of pathogenicityrs375788413RCV000864267|RCV001155762; NMedGen:CN517202|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247941021679410216AG4:g.79410216A>G-
NM_025074.7(FRAS1):c.8958+4A>G80144FRAS1Uncertain significancers368613886RCV000370839; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247941023879410238AG4:g.79410238A>GClinGen:CA2978529C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.8959-11A>G80144FRAS1Benignrs112232078RCV000273855; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247941794879417948AG4:g.79417948A>GClinGen:CA2978545C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.8985C>T (p.His2995=)80144FRAS1Conflicting interpretations of pathogenicityrs201241555RCV000331250|RCV000895641; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247941798579417985CT4:g.79417985C>TClinGen:CA2978550C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.9013C>T (p.Gln3005Ter)80144FRAS1Pathogenicrs120074157RCV000002944; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247941801379418013CT4:g.79418013C>TClinGen:CA115771,OMIM:607830.0002C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.9111A>G (p.Glu3037=)80144FRAS1Uncertain significance-1RCV001155763; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247941811179418111AG4:g.79418111A>G-
NM_025074.7(FRAS1):c.9116-11T>C80144FRAS1Benignrs7677541RCV000246248|RCV000374156; NMedGen:CN169374|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247942086479420864TC4:g.79420864T>CClinGen:CA2978585
NM_025074.7(FRAS1):c.9116-6C>T80144FRAS1Benignrs76630865RCV000241899|RCV001157469; NMedGen:CN169374|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247942086979420869CT4:g.79420869C>TClinGen:CA2978587
NM_025074.7(FRAS1):c.9116-5C>G80144FRAS1Benignrs7695038RCV000250938|RCV000263121; NMedGen:CN169374|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247942087079420870CG4:g.79420870C>GClinGen:CA2978588
NM_025074.7(FRAS1):c.9154C>T (p.Arg3052Trp)80144FRAS1Uncertain significancers779931297RCV000316018; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247942091379420913CT4:g.79420913C>TClinGen:CA2978598C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.9161C>G (p.Pro3054Arg)80144FRAS1Uncertain significance-1RCV001157470; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247942092079420920CG4:g.79420920C>G-
NM_025074.7(FRAS1):c.9163G>A (p.Ala3055Thr)80144FRAS1Uncertain significance-1RCV001157471; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247942092279420922GA4:g.79420922G>A-
NM_025074.7(FRAS1):c.9182C>T (p.Ala3061Val)80144FRAS1Uncertain significancers886059637RCV000372844; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247942094179420941CT4:g.79420941C>TClinGen:CA10619287
NM_025074.7(FRAS1):c.9183G>A (p.Ala3061=)80144FRAS1Benignrs139589570RCV000285466|RCV000870934; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247942094279420942GA4:g.79420942G>AClinGen:CA2978605
NM_025074.7(FRAS1):c.9252G>T (p.Arg3084=)80144FRAS1Benignrs11933630RCV000246697|RCV000342606; NMedGen:CN169374|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247942101179421011GT4:g.79421011G>TClinGen:CA2978620C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.9291G>A (p.Lys3097=)80144FRAS1Conflicting interpretations of pathogenicityrs376458338RCV000376218|RCV000865063; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247942105079421050GA4:g.79421050G>AClinGen:CA2978626
NM_025074.7(FRAS1):c.9296G>A (p.Arg3099Gln)80144FRAS1Benign/Likely benignrs149692526RCV000872021|RCV001151993; NMedGen:CN517202|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247942105579421055GA4:g.79421055G>A-
NM_025074.7(FRAS1):c.9316+2T>A80144FRAS1Pathogenic-1RCV001172406; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247942107779421077TA4:g.79421077T>A-
NM_025074.7(FRAS1):c.9364C>T (p.Arg3122Trp)80144FRAS1Conflicting interpretations of pathogenicityrs200346497RCV000179606|RCV000207380|RCV001151994; NMedGen:CN517202|MedGen:CN235161|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247942862279428622CT4:g.79428622C>TClinGen:CA246910CN235161 Anophthalmia - microphthalmia;
NM_025074.7(FRAS1):c.9446C>T (p.Thr3149Met)80144FRAS1Benign/Likely benignrs150680111RCV000872022|RCV001151995; NMedGen:CN517202|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247942870479428704CT4:g.79428704C>T-
NM_025074.7(FRAS1):c.9466G>T (p.Glu3156Ter)80144FRAS1Pathogenic-1RCV001172431; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247942872479428724GT4:g.79428724G>T-
NM_025074.7(FRAS1):c.9478A>G (p.Ser3160Gly)80144FRAS1Uncertain significance-1RCV001151996; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247942873679428736AG4:g.79428736A>G-
NM_025074.7(FRAS1):c.9505-4G>A80144FRAS1Uncertain significancers367680303RCV000284151; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247942988179429881GA4:g.79429881G>AClinGen:CA2978685
NM_025074.7(FRAS1):c.9538G>A (p.Glu3180Lys)80144FRAS1Uncertain significance-1RCV001153257; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247942991879429918GA4:g.79429918G>A-
NM_025074.7(FRAS1):c.9541G>A (p.Val3181Ile)80144FRAS1Uncertain significance-1RCV001153258; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247942992179429921GA4:g.79429921G>A-
NM_025074.7(FRAS1):c.9602C>T (p.Pro3201Leu)80144FRAS1Uncertain significancers886059638RCV000346175; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247942998279429982CT4:g.79429982C>TClinGen:CA10619290
NM_025074.7(FRAS1):c.9607G>A (p.Asp3203Asn)80144FRAS1Uncertain significancers540286890RCV000396675; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247942998779429987GA4:g.79429987G>AClinGen:CA2978710
NM_025074.7(FRAS1):c.9621del (p.Arg3208fs)80144FRAS1Uncertain significancers1560418388RCV000778742; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247942999879429998TCT4:g.79429998_79429998del-
NM_025074.7(FRAS1):c.9627C>T (p.Tyr3209=)80144FRAS1Conflicting interpretations of pathogenicityrs377369857RCV000281353|RCV001153259; NMedGen:CN517202|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247943000779430007CT4:g.79430007C>TClinGen:CA2978715CN169374 not specified;
NM_025074.7(FRAS1):c.9627C>A (p.Tyr3209Ter)80144FRAS1Pathogenic-1RCV001172436; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247943000779430007CA4:g.79430007C>A-
NM_025074.7(FRAS1):c.9630T>C (p.Ala3210=)80144FRAS1Uncertain significancers761161131RCV000306470; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247943001079430010TC4:g.79430010T>CClinGen:CA2978717
NM_025074.7(FRAS1):c.9658G>A (p.Gly3220Ser)80144FRAS1Uncertain significancers552881646RCV000344955; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247943003879430038GA4:g.79430038G>AClinGen:CA2978725
NM_025074.7(FRAS1):c.9759A>G (p.Pro3253=)80144FRAS1Benignrs61741742RCV000401830|RCV000870807; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247943013979430139AG4:g.79430139A>GClinGen:CA2978746
NM_025074.7(FRAS1):c.9806G>A (p.Arg3269Gln)80144FRAS1Benign/Likely benignrs61729366RCV000179644|RCV000315339|RCV000577951|RCV000872220; NMedGen:CN169374|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|Gene:1732,Human Phenotype Ontology:HP:0000776,Human Phenotype Ontology:HP:0006604,MeSH:D065630,MedGen:C0235833,OMIM:142340, Orphanet:2140|MedGen:CN51720247943245379432453GA4:g.79432453G>AClinGen:CA203377C0235833 142340 Congenital diaphragmatic hernia;
NM_025074.7(FRAS1):c.9808A>C (p.Arg3270=)80144FRAS1Benignrs3749488RCV000367732; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247943245579432455AC4:g.79432455A>CClinGen:CA2978770
NM_025074.7(FRAS1):c.9827T>C (p.Val3276Ala)80144FRAS1Uncertain significance-1RCV001155855; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247943247479432474TC4:g.79432474T>C-
NM_025074.7(FRAS1):c.9853C>T (p.His3285Tyr)80144FRAS1Benign/Likely benignrs182196851RCV000870931|RCV001155856; NMedGen:CN517202|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247943250079432500CT4:g.79432500C>T-
NM_025074.7(FRAS1):c.9955C>G (p.Gln3319Glu)80144FRAS1Benignrs78619145RCV000275489|RCV000870653; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247943260279432602CG4:g.79432602C>GClinGen:CA2978810
NM_025074.7(FRAS1):c.10002G>A (p.Glu3334=)80144FRAS1Benignrs80346282RCV000300153|RCV000865493; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247943264979432649GA4:g.79432649G>AClinGen:CA2978817
NM_025074.7(FRAS1):c.10008G>A (p.Pro3336=)80144FRAS1Benign/Likely benignrs76120498RCV000357479|RCV000873324; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247943265579432655GA4:g.79432655G>AClinGen:CA2978819
NM_025074.7(FRAS1):c.10014-14del80144FRAS1Uncertain significancers779194826RCV000260277; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247943453179434531GCG4:g.79434531_79434531delClinGen:CA2978840
NM_025074.7(FRAS1):c.10041C>G (p.His3347Gln)80144FRAS1Uncertain significance-1RCV001157554; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247943457379434573CG4:g.79434573C>G-
NM_025074.7(FRAS1):c.10077G>A (p.Pro3359=)80144FRAS1Benign/Likely benignrs183724131RCV000875622|RCV001157555; NMedGen:CN517202|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247943460979434609GA4:g.79434609G>A-
NM_025074.7(FRAS1):c.10091A>G (p.His3364Arg)80144FRAS1Uncertain significance-1RCV001157556; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247943462379434623AG4:g.79434623A>G-
NM_025074.7(FRAS1):c.10140T>A (p.Asn3380Lys)80144FRAS1Uncertain significance-1RCV001172437; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247943467279434672TA4:g.79434672T>A-
NM_025074.7(FRAS1):c.10153T>G (p.Tyr3385Asp)80144FRAS1Benignrs35933858RCV000253044|RCV000317853; NMedGen:CN169374|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247943468579434685TG4:g.79434685T>GClinGen:CA2978870
NM_025074.7(FRAS1):c.10160T>C (p.Leu3387Pro)80144FRAS1Benignrs137982616RCV000873268|RCV001157557; NMedGen:CN517202|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247943469279434692TC4:g.79434692T>C-
NM_025074.7(FRAS1):c.10166G>C (p.Gly3389Ala)80144FRAS1Uncertain significance-1RCV001157558; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247943469879434698GC4:g.79434698G>C-
NM_025074.7(FRAS1):c.10174+1G>A80144FRAS1Uncertain significancers1560420794RCV000778743; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247943470779434707GA4:g.79434707G>A-
NM_025074.7(FRAS1):c.10230C>T (p.Tyr3410=)80144FRAS1Benignrs34034599RCV000379498|RCV000870654; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247943700879437008CT4:g.79437008C>TClinGen:CA2978893
NM_025074.7(FRAS1):c.10249G>A (p.Asp3417Asn)80144FRAS1Uncertain significance-1RCV001157559; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247943702779437027GA4:g.79437027G>A-
NM_025074.7(FRAS1):c.10269G>T (p.Pro3423=)80144FRAS1Benignrs34806279RCV000268638|RCV000865361; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247943704779437047GT4:g.79437047G>TClinGen:CA2978910
NM_025074.7(FRAS1):c.10278C>T (p.Ile3426=)80144FRAS1Benignrs34678339RCV000321330|RCV000865362; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247943705679437056CT4:g.79437056C>TClinGen:CA2978914
NM_025074.7(FRAS1):c.10287del (p.Leu3428_Tyr3429insTer)80144FRAS1Pathogenicrs886037765RCV000257971; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247943706579437065ACA4:g.79437065_79437065delClinGen:CA10575842
NM_025074.7(FRAS1):c.10299C>A (p.Asn3433Lys)80144FRAS1Uncertain significance-1RCV001152097; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247943707779437077CA4:g.79437077C>A-
NM_025074.7(FRAS1):c.10377C>T (p.Thr3459=)80144FRAS1Benignrs3749487RCV000244857|RCV000378270; NMedGen:CN169374|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247943715579437155CT4:g.79437155C>TClinGen:CA2978931
NM_025074.7(FRAS1):c.10389+11C>T80144FRAS1Benignrs74632598RCV000248810|RCV000290835; NMedGen:CN169374|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247943717879437178CT4:g.79437178C>TClinGen:CA2978937
NM_025074.7(FRAS1):c.10390-6C>T80144FRAS1Uncertain significancers139412411RCV000329374; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247944047979440479CT4:g.79440479C>TClinGen:CA2978955
NM_025074.7(FRAS1):c.10390-5G>A80144FRAS1Uncertain significancers753366978RCV000381660; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247944048079440480GA4:g.79440480G>AClinGen:CA2978956
NM_025074.7(FRAS1):c.10425C>T (p.His3475=)80144FRAS1Benign/Likely benignrs376096303RCV000289608|RCV000955144; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247944052079440520CT4:g.79440520C>TClinGen:CA2978963
NM_025074.7(FRAS1):c.10442C>T (p.Ser3481Phe)80144FRAS1Uncertain significancers886059640RCV000351532; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247944053779440537CT4:g.79440537C>TClinGen:CA10618384
NM_025074.7(FRAS1):c.10494C>T (p.Thr3498=)80144FRAS1Benignrs149604281RCV000395253; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247944058979440589CT4:g.79440589C>TClinGen:CA2978978
NM_025074.7(FRAS1):c.10539A>G (p.Thr3513=)80144FRAS1Benign/Likely benignrs199921300RCV000293521|RCV000334777|RCV000885162; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN169374|MedGen:CN51720247944063479440634AG4:g.79440634A>GClinGen:CA2978984C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.10541-1G>A80144FRAS1Pathogenic-1RCV001172438; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247944267679442676GA4:g.79442676G>A-
NM_025074.7(FRAS1):c.10594A>G (p.Ile3532Val)80144FRAS1Benign/Likely benignrs144715071RCV000336848|RCV000406248|RCV000870808; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN169374|MedGen:CN51720247944273079442730AG4:g.79442730A>GClinGen:CA2979013C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.10598G>A (p.Arg3533Gln)80144FRAS1Benignrs115878217RCV000870848|RCV001153365; NMedGen:CN517202|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247944273479442734GA4:g.79442734G>A-
NM_025074.7(FRAS1):c.10609C>T (p.Arg3537Cys)80144FRAS1Uncertain significancers779521854RCV000400178|RCV000494230; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247944274579442745CT4:g.79442745C>TClinGen:CA2979020
NM_025074.7(FRAS1):c.10610G>A (p.Arg3537His)80144FRAS1Uncertain significance-1RCV001153366; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247944274679442746GA4:g.79442746G>A-
NM_025074.7(FRAS1):c.10648+13C>A80144FRAS1Uncertain significancers886059641RCV000297127; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247944279779442797CA4:g.79442797C>AClinGen:CA10621745
NM_025074.7(FRAS1):c.10648+24_10648+25del80144FRAS1Uncertain significancers397994139RCV000399918; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247944280079442801GTTG4:g.79442800_79442801delClinGen:CA2979030
NM_025074.7(FRAS1):c.10648+25del80144FRAS1Benignrs397994139RCV000354281; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247944280079442800GTG4:g.79442800_79442800delClinGen:CA2979029
NM_025074.7(FRAS1):c.10683A>T (p.Glu3561Asp)80144FRAS1Benignrs931605RCV000253563|RCV000305288; NMedGen:CN169374|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247944383779443837AT4:g.79443837A>TClinGen:CA2979047
NM_025074.7(FRAS1):c.10689A>T (p.Lys3563Asn)80144FRAS1Uncertain significancers886059643RCV000357873; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247944384379443843AT4:g.79443843A>TClinGen:CA10618402
NM_025074.7(FRAS1):c.10696G>A (p.Val3566Ile)80144FRAS1Benignrs931606RCV000245288|RCV000265442; NMedGen:CN169374|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247944385079443850GA4:g.79443850G>AClinGen:CA2979050
NM_025074.7(FRAS1):c.10724T>C (p.Ile3575Thr)80144FRAS1Uncertain significance-1RCV001155971; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247944387879443878TC4:g.79443878T>C-
NM_025074.7(FRAS1):c.10743A>G (p.Leu3581=)80144FRAS1Uncertain significancers886059644RCV000327684; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247944389779443897AG4:g.79443897A>GClinGen:CA10619320
NM_025074.7(FRAS1):c.10753G>A (p.Ala3585Thr)80144FRAS1Uncertain significance-1RCV001155972; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247944390779443907GA4:g.79443907G>A-
NM_025074.7(FRAS1):c.10809-12G>T80144FRAS1Uncertain significancers886059645RCV000365952; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247944768379447683GT4:g.79447683G>TClinGen:CA10621746
NM_025074.7(FRAS1):c.10809-11C>T80144FRAS1Uncertain significance-1RCV001155973; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247944768479447684CT4:g.79447684C>T-
NM_025074.7(FRAS1):c.10820C>G (p.Ser3607Ter)80144FRAS1Pathogenicrs1006839535RCV000782142; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247944770679447706CG4:g.79447706C>G-
NM_025074.7(FRAS1):c.10852A>G (p.Thr3618Ala)80144FRAS1Likely benignrs192225415RCV000269085; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247944773879447738AG4:g.79447738A>GClinGen:CA2979089
NM_025074.7(FRAS1):c.10869G>A (p.Gln3623=)80144FRAS1Uncertain significancers778772211RCV000326546; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247944775579447755GA4:g.79447755G>AClinGen:CA2979091C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.10877T>C (p.Val3626Ala)80144FRAS1Benignrs34670941RCV000250854|RCV000388114; NMedGen:CN169374|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247944776379447763TC4:g.79447763T>CClinGen:CA2979092
NM_025074.7(FRAS1):c.10999C>T (p.Gln3667Ter)80144FRAS1Pathogenic-1RCV001172439; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247945567679455676CT4:g.79455676C>T-
NM_025074.7(FRAS1):c.11037C>G (p.Pro3679=)80144FRAS1Benignrs4975070RCV000245809|RCV000292730; NMedGen:CN169374|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247945571479455714CG4:g.79455714C>GClinGen:CA2979122
NM_025074.7(FRAS1):c.11056C>T (p.Leu3686=)80144FRAS1Benignrs4975139RCV000250559|RCV000333665; NMedGen:CN169374|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247945573379455733CT4:g.79455733C>TClinGen:CA2979124
NM_025074.7(FRAS1):c.11111G>A (p.Arg3704Gln)80144FRAS1Uncertain significancers141843124RCV000388115; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247945816779458167GA4:g.79458167G>AClinGen:CA2979152C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.11158C>T (p.Gln3720Ter)80144FRAS1Pathogenic-1RCV001172410; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247945821479458214CT4:g.79458214C>T-
NM_025074.7(FRAS1):c.11220G>A (p.Thr3740=)80144FRAS1Conflicting interpretations of pathogenicityrs182887871RCV000279659|RCV000911142; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247945827679458276GA4:g.79458276G>AClinGen:CA2979166C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.11237A>C (p.Glu3746Ala)80144FRAS1Uncertain significance-1RCV001152203; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247945829379458293AC4:g.79458293A>C-
NM_025074.7(FRAS1):c.11252G>A (p.Gly3751Glu)80144FRAS1Uncertain significance-1RCV001152204; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247945830879458308GA4:g.79458308G>A-
NM_025074.7(FRAS1):c.11264C>T (p.Pro3755Leu)80144FRAS1Uncertain significancers199510509RCV000334766|RCV000388584; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247945832079458320CT4:g.79458320C>TClinGen:CA2979180C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.11266_11269AACA[1] (p.Lys3757fs)80144FRAS1Pathogenicrs1578380159RCV000768557; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247945832079458323CCAAAC4:g.79458320_79458323del-
NM_025074.7(FRAS1):c.11298+1G>A80144FRAS1Pathogenic-1RCV001172420; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247945835579458355GA4:g.79458355G>A-
NM_025074.7(FRAS1):c.11299-8A>C80144FRAS1Uncertain significancers368551584RCV000394486; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946044079460440AC4:g.79460440A>CClinGen:CA2979199C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.11302C>T (p.Arg3768Cys)80144FRAS1Uncertain significancers750736066RCV000280709; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946045179460451CT4:g.79460451C>TClinGen:CA2979201C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.11306A>G (p.Asn3769Ser)80144FRAS1Uncertain significancers112039037RCV000403674|RCV000764553; NMedGen:CN517202|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946045579460455AG4:g.79460455A>GClinGen:CA2979202CN169374 not specified;
NM_025074.7(FRAS1):c.11445+5_11445+11delinsC80144FRAS1Likely pathogenic-1RCV001172440; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946059979460605GTTTGGTC4:g.79460600_79460605del-
NM_025074.7(FRAS1):c.11445+68_11445+69del80144FRAS1Benignrs3062747RCV000987453; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946064879460649GAAG4:g.79460648_79460649del-
NM_025074.7(FRAS1):c.11473C>T (p.Gln3825Ter)80144FRAS1Pathogenic-1RCV001172425; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946171279461712CT4:g.79461712C>T-
NM_025074.7(FRAS1):c.11475G>C (p.Gln3825His)80144FRAS1Uncertain significance-1RCV001152205; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946171479461714GC4:g.79461714G>C-
NM_025074.7(FRAS1):c.11510G>C (p.Gly3837Ala)80144FRAS1Uncertain significance-1RCV001152206; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946174979461749GC4:g.79461749G>C-
NM_025074.7(FRAS1):c.11559G>A (p.Arg3853=)80144FRAS1Uncertain significance-1RCV001153490; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946179879461798GA4:g.79461798G>A-
NM_025074.7(FRAS1):c.11589C>T (p.Ile3863=)80144FRAS1Uncertain significancers763508870RCV000340486; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946182879461828CT4:g.79461828C>TClinGen:CA2979261C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.11605A>G (p.Ile3869Val)80144FRAS1Benign/Likely benignrs145035489RCV000283373|RCV000394472|RCV000870810; NMedGen:CN169374|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247946184479461844AG4:g.79461844A>GClinGen:CA2979264C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.11637T>C (p.Asn3879=)80144FRAS1Uncertain significance-1RCV001153491; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946187679461876TC4:g.79461876T>C-
NM_025074.7(FRAS1):c.11681C>T (p.Ala3894Val)80144FRAS1Uncertain significancers772941624RCV000305214; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946192079461920CT4:g.79461920C>TClinGen:CA2979274C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.11682G>A (p.Ala3894=)80144FRAS1Conflicting interpretations of pathogenicityrs376389151RCV000902787|RCV001153492; NMedGen:CN517202|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946192179461921GA4:g.79461921G>A-
NM_025074.7(FRAS1):c.11690C>T (p.Ala3897Val)80144FRAS1Uncertain significancers373595232RCV000360016; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946192979461929CT4:g.79461929C>TClinGen:CA2979277C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.11695C>T (p.Leu3899=)80144FRAS1Likely benign-1RCV001153493; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946193479461934CT4:g.79461934C>T-
NM_025074.7(FRAS1):c.11717T>C (p.Ile3906Thr)80144FRAS1Conflicting interpretations of pathogenicityrs61748814RCV000660411; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946195679461956TC4:g.79461956T>C-C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.11718T>C (p.Ile3906=)80144FRAS1Benign/Likely benignrs142389362RCV000343079|RCV000399146|RCV000870811; NMedGen:CN169374|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247946195779461957TC4:g.79461957T>CClinGen:CA2979287C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.11720G>T (p.Gly3907Val)80144FRAS1Benignrs61748815RCV000864695|RCV001156090; NMedGen:CN517202|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946195979461959GT4:g.79461959G>T-
NM_025074.7(FRAS1):c.11724T>C (p.Ser3908=)80144FRAS1Benign/Likely benignrs151307846RCV000279868|RCV000306234|RCV000870812; NMedGen:CN169374|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247946196379461963TC4:g.79461963T>CClinGen:CA2979289C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.11726C>T (p.Ala3909Val)80144FRAS1Uncertain significance-1RCV001156091; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946196579461965CT4:g.79461965C>T-
NM_025074.7(FRAS1):c.11811G>A (p.Lys3937=)80144FRAS1Conflicting interpretations of pathogenicityrs373149321RCV000886339|RCV001156092; NMedGen:CN517202|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946205079462050GA4:g.79462050G>A-
NM_025074.7(FRAS1):c.11815G>A (p.Ala3939Thr)80144FRAS1Uncertain significance-1RCV001156093; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946205479462054GA4:g.79462054G>A-
NM_025074.7(FRAS1):c.11882G>A (p.Arg3961Gln)80144FRAS1Uncertain significancers370319615RCV000365847; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946212179462121GA4:g.79462121G>AClinGen:CA2979321C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.11895C>T (p.Asn3965=)80144FRAS1Conflicting interpretations of pathogenicityrs372802938RCV000271265|RCV000915001; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN51720247946213479462134CT4:g.79462134C>TClinGen:CA2979325C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.11897dup (p.Asn3967fs)80144FRAS1Pathogenicrs1560433104RCV000782358; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946213579462136GGT4:g.79462135_79462136insT-
NM_025074.7(FRAS1):c.11902A>G (p.Arg3968Gly)80144FRAS1Uncertain significancers550166836RCV000330920; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946214179462141AG4:g.79462141A>GClinGen:CA2979328C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.11907C>G (p.His3969Gln)80144FRAS1Benign/Likely benignrs140492803RCV000366948|RCV000405453|RCV000870813; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN169374|MedGen:CN51720247946214679462146CG4:g.79462146C>GClinGen:CA2979329C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.11920C>T (p.Arg3974Trp)80144FRAS1Uncertain significancers759074187RCV000276616; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946215979462159CT4:g.79462159C>TClinGen:CA2979333C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.11925C>T (p.Asn3975=)80144FRAS1Uncertain significancers368578398RCV000317661; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946216479462164CT4:g.79462164C>TClinGen:CA2979335C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.*5G>A80144FRAS1Uncertain significance-1RCV001157784; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946228379462283GA4:g.79462283G>A-
NM_025074.7(FRAS1):c.*33T>A80144FRAS1Benignrs72659058RCV000372407; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946231179462311TA4:g.79462311T>AClinGen:CA2979360C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.*78G>T80144FRAS1Benignrs77632937RCV000263749; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946235679462356GT4:g.79462356G>TClinGen:CA10619327C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.*84A>G80144FRAS1Uncertain significancers886059646RCV000318966; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946236279462362AG4:g.79462362A>GClinGen:CA10618432
NM_025074.7(FRAS1):c.*117C>T80144FRAS1Uncertain significancers886059647RCV000378301; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946239579462395CT4:g.79462395C>TClinGen:CA10621750
NM_025074.7(FRAS1):c.*122C>T80144FRAS1Uncertain significancers886059648RCV000283349; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946240079462400CT4:g.79462400C>TClinGen:CA10619328
NM_025074.7(FRAS1):c.*219T>C80144FRAS1Uncertain significance-1RCV001152305; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946249779462497TC4:g.79462497T>C-
NM_025074.7(FRAS1):c.*221G>A80144FRAS1Uncertain significance-1RCV001152306; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946249979462499GA4:g.79462499G>A-
NM_025074.7(FRAS1):c.*258G>A80144FRAS1Benign-1RCV001152307; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946253679462536GA4:g.79462536G>A-
NM_025074.7(FRAS1):c.*282A>T80144FRAS1Benignrs3749485RCV000342970; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946256079462560AT4:g.79462560A>TClinGen:CA10621753
NM_025074.7(FRAS1):c.*319A>G80144FRAS1Uncertain significance-1RCV001152308; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946259779462597AG4:g.79462597A>G-
NM_025074.7(FRAS1):c.*374C>T80144FRAS1Uncertain significancers560026397RCV000379512; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946265279462652CT4:g.79462652C>TClinGen:CA10618434
NM_025074.7(FRAS1):c.*388C>G80144FRAS1Benignrs75970105RCV000289772; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946266679462666CG4:g.79462666C>GClinGen:CA10621749
NM_025074.7(FRAS1):c.*391C>T80144FRAS1Likely benign-1RCV001153591; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946266979462669CT4:g.79462669C>T-
NM_025074.7(FRAS1):c.*415A>G80144FRAS1Uncertain significance-1RCV001153592; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946269379462693AG4:g.79462693A>G-
NM_025074.7(FRAS1):c.*455C>T80144FRAS1Uncertain significance-1RCV001153593; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946273379462733CT4:g.79462733C>T-
NM_025074.7(FRAS1):c.*460A>G80144FRAS1Uncertain significancers760216437RCV000344629; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946273879462738AG4:g.79462738A>GClinGen:CA10619329
NM_025074.7(FRAS1):c.*503T>C80144FRAS1Benignrs3749484RCV000399062; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946278179462781TC4:g.79462781T>CClinGen:CA10621762
NM_025074.7(FRAS1):c.*518dup80144FRAS1Benignrs397752464RCV000309498; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946279379462794AAT4:g.79462793_79462794insTClinGen:CA10618438
NM_025074.7(FRAS1):c.*530G>A80144FRAS1Uncertain significancers544866402RCV000350325; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946280879462808GA4:g.79462808G>AClinGen:CA10621767
NM_025074.7(FRAS1):c.*708C>A80144FRAS1Benignrs111636328RCV000401953; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946298679462986CA4:g.79462986C>AClinGen:CA10621763
NM_025074.7(FRAS1):c.*709G>A80144FRAS1Benignrs115458096RCV000315379; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946298779462987GA4:g.79462987G>AClinGen:CA10618441
NM_025074.7(FRAS1):c.*731C>G80144FRAS1Benignrs116483248RCV000369247; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946300979463009CG4:g.79463009C>GClinGen:CA10618445
NM_025074.7(FRAS1):c.*751T>G80144FRAS1Benignrs6832584RCV000260448; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946302979463029TG4:g.79463029T>GClinGen:CA10619330
NM_025074.7(FRAS1):c.*761A>G80144FRAS1Uncertain significance-1RCV001156207; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946303979463039AG4:g.79463039A>G-
NM_025074.7(FRAS1):c.*808C>T80144FRAS1Benignrs59820455RCV000296870; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946308679463086CT4:g.79463086C>TClinGen:CA10621768
NM_025074.7(FRAS1):c.*824T>G80144FRAS1Uncertain significance-1RCV001156208; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946310279463102TG4:g.79463102T>G-
NM_025074.7(FRAS1):c.*880C>A80144FRAS1Uncertain significancers886059649RCV000356377; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946315879463158CA4:g.79463158C>AClinGen:CA10621775
NM_025074.7(FRAS1):c.*893C>G80144FRAS1Uncertain significancers563929109RCV000261787; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946317179463171CG4:g.79463171C>GClinGen:CA10621786
NM_025074.7(FRAS1):c.*897T>G80144FRAS1Uncertain significance-1RCV001157882; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946317579463175TG4:g.79463175T>G-
NM_025074.7(FRAS1):c.*926C>T80144FRAS1Uncertain significance-1RCV001157883; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946320479463204CT4:g.79463204C>T-
NM_025074.7(FRAS1):c.*938A>G80144FRAS1Uncertain significancers559819253RCV000321662; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946321679463216AG4:g.79463216A>GClinGen:CA10618447
NM_025074.7(FRAS1):c.*957G>C80144FRAS1Uncertain significancers886059650RCV000376194; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946323579463235GC4:g.79463235G>CClinGen:CA10621787
NM_025074.7(FRAS1):c.*985G>A80144FRAS1Uncertain significance-1RCV001157884; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946326379463263GA4:g.79463263G>A-
NM_025074.7(FRAS1):c.*1085C>T80144FRAS1Likely benignrs570309641RCV000267707; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946336379463363CT4:g.79463363C>TClinGen:CA10621796
NM_025074.7(FRAS1):c.*1210G>A80144FRAS1Uncertain significancers886059651RCV000322909; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946348879463488GA4:g.79463488G>AClinGen:CA10618450
NM_025074.7(FRAS1):c.*1289G>A80144FRAS1Benignrs113324102RCV000382128; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946356779463567GA4:g.79463567G>AClinGen:CA10619334
NM_025074.7(FRAS1):c.*1301G>A80144FRAS1Benignrs3210826RCV000287806; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946357979463579GA4:g.79463579G>AClinGen:CA10621797
NM_025074.7(FRAS1):c.*1303G>A80144FRAS1Uncertain significance-1RCV001152410; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946358179463581GA4:g.79463581G>A-
NM_025074.7(FRAS1):c.*1345C>T80144FRAS1Uncertain significancers886059652RCV000347474; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946362379463623CT4:g.79463623C>TClinGen:CA10621798
NM_025074.7(FRAS1):c.*1384C>T80144FRAS1Uncertain significancers771590846RCV000383430; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946366279463662CT4:g.79463662C>TClinGen:CA10618452
NM_025074.7(FRAS1):c.*1444T>C80144FRAS1Uncertain significance-1RCV001152411; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946372279463722TC4:g.79463722T>C-
NM_025074.7(FRAS1):c.*1547C>G80144FRAS1Uncertain significance-1RCV001152412; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946382579463825CG4:g.79463825C>G-
NM_025074.7(FRAS1):c.*1578T>C80144FRAS1Uncertain significance-1RCV001152413; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946385679463856TC4:g.79463856T>C-
NM_025074.7(FRAS1):c.*1613C>T80144FRAS1Uncertain significance-1RCV001153682; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946389179463891CT4:g.79463891C>T-
NM_025074.7(FRAS1):c.*1616C>T80144FRAS1Uncertain significance-1RCV001153683; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946389479463894CT4:g.79463894C>T-
NM_025074.7(FRAS1):c.*1666G>A80144FRAS1Uncertain significance-1RCV001153684; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946394479463944GA4:g.79463944G>A-
NM_025074.7(FRAS1):c.*1669A>C80144FRAS1Uncertain significancers886059653RCV000293971; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946394779463947AC4:g.79463947A>CClinGen:CA10618453
NM_025074.7(FRAS1):c.*1698G>C80144FRAS1Uncertain significance-1RCV001153685; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946397679463976GC4:g.79463976G>C-
NM_025074.7(FRAS1):c.*1741T>G80144FRAS1Uncertain significance-1RCV001153686; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946401979464019TG4:g.79464019T>G-
NM_025074.7(FRAS1):c.*1752T>C80144FRAS1Uncertain significance-1RCV001153687; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946403079464030TC4:g.79464030T>C-
NM_025074.7(FRAS1):c.*1787G>A80144FRAS1Uncertain significancers549532188RCV000348876; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946406579464065GA4:g.79464065G>AClinGen:CA10621800
NM_025074.7(FRAS1):c.*1810C>T80144FRAS1Uncertain significance-1RCV001153688; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946408879464088CT4:g.79464088C>T-
NM_025074.7(FRAS1):c.*1814G>A80144FRAS1Benignrs17003321RCV000395423; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946409279464092GA4:g.79464092G>AClinGen:CA10621769
NM_025074.7(FRAS1):c.*1995G>T80144FRAS1Benignrs72873318RCV000298548; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946427379464273GT4:g.79464273G>TClinGen:CA10621783
NM_025074.7(FRAS1):c.*2028C>G80144FRAS1Uncertain significance-1RCV001156293; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946430679464306CG4:g.79464306C>G-
NM_025074.7(FRAS1):c.*2091T>C80144FRAS1Uncertain significancers764203320RCV000334852; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946436979464369TC4:g.79464369T>CClinGen:CA10621808
NM_025074.7(FRAS1):c.*2154C>T80144FRAS1Benignrs3811747RCV000395453; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946443279464432CT4:g.79464432C>TClinGen:CA10621784C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.*2223G>A80144FRAS1Uncertain significance-1RCV001156294; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946450179464501GA4:g.79464501G>A-
NM_025074.7(FRAS1):c.*2261C>T80144FRAS1Uncertain significancers886059654RCV000299732; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946453979464539CT4:g.79464539C>TClinGen:CA10618454C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.*2294G>A80144FRAS1Uncertain significance-1RCV001157965; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946457279464572GA4:g.79464572G>A-
NM_025074.7(FRAS1):c.*2324G>A80144FRAS1Likely benignrs186095111RCV000358998; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946460279464602GA4:g.79464602G>AClinGen:CA10621792C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.*2350C>T80144FRAS1Uncertain significancers886059655RCV000264265; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946462879464628CT4:g.79464628C>TClinGen:CA10618462C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.*2369C>T80144FRAS1Uncertain significance-1RCV001157966; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946464779464647CT4:g.79464647C>T-
NM_025074.7(FRAS1):c.*2370G>A80144FRAS1Benignrs116617672RCV000305480; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946464879464648GA4:g.79464648G>AClinGen:CA10618466C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.*2489T>C80144FRAS1Benignrs11098227RCV000360200; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946476779464767TC4:g.79464767T>CClinGen:CA10619345C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.*2490G>A80144FRAS1Uncertain significance-1RCV001157967; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946476879464768GA4:g.79464768G>A-
NM_025074.7(FRAS1):c.*2512C>T80144FRAS1Uncertain significancers886059656RCV000269947; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946479079464790CT4:g.79464790C>TClinGen:CA10621794C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.*2672A>G80144FRAS1Likely benignrs144020017RCV000324993; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946495079464950AG4:g.79464950A>GClinGen:CA10621799C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.*2700G>A80144FRAS1Benignrs11098228RCV000365626; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946497879464978GA4:g.79464978G>AClinGen:CA10621802C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.*2811T>A80144FRAS1Benignrs114574352RCV000271036; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946508979465089TA4:g.79465089T>AClinGen:CA10618467C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.*2824_*2825insTTTT80144FRAS1Benignrs397724155RCV000331007; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946510079465101AATTTT4:g.79465100_79465101insTTTTClinGen:CA10621805C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.*2931del80144FRAS1Likely benignrs139811866RCV000385536; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946520979465209TAT4:g.79465209_79465209delClinGen:CA10621810C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.*2941A>T80144FRAS1Uncertain significance-1RCV001152508; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946521979465219AT4:g.79465219A>T-
NM_025074.7(FRAS1):c.*2951A>T80144FRAS1Uncertain significance-1RCV001152509; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946522979465229AT4:g.79465229A>T-
NM_025074.7(FRAS1):c.*2957T>A80144FRAS1Uncertain significancers553394027RCV000295922; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946523579465235TA4:g.79465235T>AClinGen:CA10619346C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.*3092A>G80144FRAS1Benignrs17003335RCV000332139; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946537079465370AG4:g.79465370A>GClinGen:CA10621811C0265233 219000 Cryptophthalmos syndrome;
NM_025074.7(FRAS1):c.*3142G>T80144FRAS1Likely benignrs183140136RCV000373476; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946542079465420GT4:g.79465420G>TClinGen:CA10618468C0265233 219000 Cryptophthalmos syndrome;
NM_025074.6(FRAS1):c.*3146_*3149delTTTG80144FRAS1Likely benignrs148508826RCV000297090; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:205247946542479465427TTTTGT4:g.79465424_79465427delClinGen:CA10654674C0265233 219000 Cryptophthalmos syndrome;
NM_207361.5(FREM2):c.-285C>G341640FREM2Uncertain significancers573143355RCV000309662; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052133926119739261197CG13:g.39261197C>GClinGen:CA10644372
NM_207361.6(FREM2):c.135G>T (p.Pro45=)341640FREM2Uncertain significancers886050186RCV000335661; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052133926161639261616GT13:g.39261616G>TClinGen:CA10644390C0265233 219000 Cryptophthalmos syndrome;
NM_207361.6(FREM2):c.576G>A (p.Glu192=)341640FREM2Benignrs1868464RCV000250281|RCV000347448|RCV001094138; NMedGen:CN169374|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MONDO:MONDO:0054738,MedGen:C4540036,OMIM:617666133926205739262057GA13:g.39262057G>AClinGen:CA6954237C0265233 219000 Cryptophthalmos syndrome;
NM_207361.6(FREM2):c.2233= (p.Pro745=)341640FREM2Benignrs2496423RCV000173610|RCV000357309|RCV001094162; NMedGen:CN169374|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MONDO:MONDO:0054738,MedGen:C4540036,OMIM:617666133926371439263714TC13:g.39263714T>CClinGen:CA200643C0265233 219000 Cryptophthalmos syndrome;
NM_207361.6(FREM2):c.2250C>T (p.Asp750=)341640FREM2Benignrs41292755RCV000173611|RCV000405344|RCV001094163; NMedGen:CN169374|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MONDO:MONDO:0054738,MedGen:C4540036,OMIM:617666133926373139263731CT13:g.39263731C>TClinGen:CA200645C0265233 219000 Cryptophthalmos syndrome;
NM_207361.6(FREM2):c.3209T>C (p.Phe1070Ser)341640FREM2Benignrs2496425RCV000173599|RCV000380412|RCV001094147; NMedGen:CN169374|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MONDO:MONDO:0054738,MedGen:C4540036,OMIM:617666133926469039264690TC13:g.39264690T>CClinGen:CA200635C0265233 219000 Cryptophthalmos syndrome;
NM_207361.6(FREM2):c.5503G>A (p.Ala1835Thr)341640FREM2Uncertain significancers767743882RCV000662065|RCV000662066; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MONDO:MONDO:0054738,MedGen:C4540036,OMIM:617666133934380739343807GA13:g.39343807G>A-C0265233 219000 Cryptophthalmos syndrome;
NM_207361.6(FREM2):c.6348_6349CA[1] (p.Thr2117fs)341640FREM2Likely pathogenicrs752032044RCV000826108; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052133942277639422777CCAC13:g.39422776_39422777del-
NM_207361.6(FREM2):c.6977C>T (p.Thr2326Ile)341640FREM2Benignrs9548509RCV000241670|RCV000369162|RCV001094086; NMedGen:CN169374|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MONDO:MONDO:0054738,MedGen:C4540036,OMIM:617666133943031439430314CT13:g.39430314C>TClinGen:CA6955734
NM_207361.6(FREM2):c.7520-5del341640FREM2Likely benignrs36084034RCV000289348; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052133943555339435553CTC13:g.39435553_39435553delClinGen:CA6955897
NM_207361.6(FREM2):c.8902G>A (p.Val2968Ile)341640FREM2Benign/Likely benignrs116099212RCV000176440|RCV000224494|RCV000989101|RCV001110834; NMedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MONDO:MONDO:0054738,MedGen:C4540036,OMIM:617666133945301039453010GA13:g.39453010G>AClinGen:CA201942CN517202 not provided;
NM_207361.6(FREM2):c.*1666_*1667del341640FREM2Uncertain significancers534520921RCV000386617; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052133945659039456591CTGC13:g.39456590_39456591delClinGen:CA10643435
NM_207361.6(FREM2):c.*1897_*1901CCTTT[3]341640FREM2Uncertain significancers886050201RCV000390064; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052133945682039456821CCCCTTT13:g.39456820_39456821insCCTTTClinGen:CA10639512C0265233 219000 Cryptophthalmos syndrome;
NM_207361.6(FREM2):c.*2390_*2392del341640FREM2Likely benignrs149897768RCV000312459; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052133945731439457316CAGAC13:g.39457314_39457316delClinGen:CA10644453C0265233 219000 Cryptophthalmos syndrome;
NM_207361.6(FREM2):c.*2458G>C341640FREM2Uncertain significancers886050203RCV000277222; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052133945738239457382GC13:g.39457382G>CClinGen:CA10634319C0265233 219000 Cryptophthalmos syndrome;
NM_207361.6(FREM2):c.*3718A>G341640FREM2Uncertain significancers886050208RCV000335797; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052133945864239458642AG13:g.39458642A>GClinGen:CA10644458
NM_207361.6(FREM2):c.*5530_*5532TTG[1]341640FREM2Uncertain significancers886050212RCV000374822; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052133946045339460455AGTTA13:g.39460453_39460455delClinGen:CA10639531
NM_207361.6(FREM2):c.*5552_*5553CA[6]341640FREM2Uncertain significancers886050213RCV000348299; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052133946047539460476TACT13:g.39460475_39460476delClinGen:CA10634354
NM_207361.6(FREM2):c.*5552C>T341640FREM2Uncertain significancers886050214RCV000401610; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052133946047639460476CT13:g.39460476C>TClinGen:CA10644469
NM_207361.6(FREM2):c.*5590_*5591TA[6]341640FREM2Uncertain significancers34936389RCV000345748; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052133946051239460513CCAT13:g.39460512_39460513insATClinGen:CA10644478
NM_207361.6(FREM2):c.*5600_*5601GA[7]341640FREM2Uncertain significancers5802960RCV000267139; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052133946052239460523TTAG13:g.39460522_39460523insAGClinGen:CA10639534C0265233 219000 Cryptophthalmos syndrome;
NM_207361.6(FREM2):c.*5615_*5616insG341640FREM2Uncertain significancers886050216RCV000296053; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052133946053939460540AAG13:g.39460539_39460540insGClinGen:CA10644481
NM_207361.6(FREM2):c.*5627del341640FREM2Benignrs5802961RCV000385673; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052133946054039460540ATA13:g.39460540_39460540delClinGen:CA10644483C0265233 219000 Cryptophthalmos syndrome;
NM_207361.6(FREM2):c.*5870del341640FREM2Uncertain significancers886050220RCV000347531; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052133946079239460792TCT13:g.39460792_39460792delClinGen:CA10643460C0265233 219000 Cryptophthalmos syndrome;
NM_207361.6(FREM2):c.*6148_*6151del341640FREM2Uncertain significancers886050221RCV000401046; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052133946107239461075ACATTA13:g.39461072_39461075delClinGen:CA10634355C0265233 219000 Cryptophthalmos syndrome;
NM_021150.4(GRIP1):c.*1559dup23426GRIP1Uncertain significancers886049786RCV000292149; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052126674123966741240TTA12:g.66741239_66741240insAClinGen:CA10638413
NM_021150.4(GRIP1):c.*1548_*1551dup23426GRIP1Uncertain significancers886049787RCV000349520; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052126674124766741248CCTGTT12:g.66741247_66741248insTGTTClinGen:CA10633491
NM_021150.4(GRIP1):c.*1524_*1527del23426GRIP1Likely benignrs148261691RCV000373835; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052126674127266741275TTTTAT12:g.66741272_66741275delClinGen:CA10638414
NM_021150.4(GRIP1):c.*1495_*1497dup23426GRIP1Uncertain significancers553937765RCV000281731; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052126674130166741302AAATT12:g.66741301_66741302insATTClinGen:CA10633492
NM_021150.4(GRIP1):c.*1422_*1426del23426GRIP1Uncertain significancers886049788RCV000334443; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052126674137366741377ATACTTA12:g.66741373_66741377delClinGen:CA10642355
NM_021150.4(GRIP1):c.*1388_*1390dup23426GRIP1Uncertain significancers886049789RCV000390700; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052126674140866741409AAAAT12:g.66741408_66741409insAATClinGen:CA10643223
NM_021150.4(GRIP1):c.*1299_*1301dup23426GRIP1Likely benignrs200995788RCV000397406; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052126674149766741498GGTGA12:g.66741497_66741498insTGAClinGen:CA10638416
NM_021150.4(GRIP1):c.*1261dup23426GRIP1Conflicting interpretations of pathogenicityrs35499444RCV000366384; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052126674153766741538AAT12:g.66741537_66741538insTClinGen:CA10638425
NM_021150.4(GRIP1):c.*1261del23426GRIP1Benignrs35499444RCV000308024; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052126674153866741538ATA12:g.66741538_66741538delClinGen:CA10638424
NM_021150.4(GRIP1):c.*752_*754TAT[3]23426GRIP1Uncertain significancers148302164RCV000262519; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052126674204166742042GGATA12:g.66742041_66742042insATAClinGen:CA10643229
NM_021150.4(GRIP1):c.*753_*757del23426GRIP1Uncertain significancers886049793RCV000319962; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052126674204266742046GATAATG12:g.66742042_66742046delClinGen:CA10638435
NM_021150.4(GRIP1):c.*735_*738dup23426GRIP1Uncertain significancers551666983RCV000372545; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052126674206066742061AATGTT12:g.66742060_66742061insTGTTClinGen:CA10633494
NM_021150.4(GRIP1):c.*723_*725dup23426GRIP1Uncertain significancers886049794RCV000280372; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052126674207366742074AACTC12:g.66742073_66742074insCTCClinGen:CA10642362
NM_021150.4(GRIP1):c.*695_*697dup23426GRIP1Likely benignrs201977256RCV000380569; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052126674210166742102CCTAT12:g.66742101_66742102insTATClinGen:CA10643233
NM_021150.4(GRIP1):c.*679dup23426GRIP1Uncertain significancers367709432RCV000282787; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052126674211966742120TTA12:g.66742119_66742120insAClinGen:CA10633495
NM_021150.4(GRIP1):c.*655_*657dup23426GRIP1Likely benignrs138816960RCV000340093; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052126674214166742142AACAT12:g.66742141_66742142insCATClinGen:CA10642363
NM_021150.4(GRIP1):c.*647_*650dup23426GRIP1Likely benignrs200677568RCV000404098; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052126674214866742149CCTGTT12:g.66742148_66742149insTGTTClinGen:CA10638437
NM_021150.4(GRIP1):c.*85_*87dup23426GRIP1Uncertain significancers553542220RCV000355925; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052126674271166742712TTATC12:g.66742711_66742712insATCClinGen:CA10643237C0265233 219000 Cryptophthalmos syndrome;
NM_001366722.1(GRIP1):c.2464+15T>C23426GRIP1Benignrs7970076RCV000252195|RCV000290142|RCV001094207; NMedGen:CN169374|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MONDO:MONDO:0054739,MedGen:C4540040,OMIM:617667126678607366786073AG12:g.66786073A>GClinGen:CA6674124C0265233 219000 Cryptophthalmos syndrome;
NM_001366722.1(GRIP1):c.2461C>G (p.Gln821Glu)23426GRIP1Benignrs13277RCV000247437|RCV000328734|RCV001094208; NMedGen:CN169374|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MONDO:MONDO:0054739,MedGen:C4540040,OMIM:617667126678609166786091GC12:g.66786091G>CClinGen:CA6674128C0265233 219000 Cryptophthalmos syndrome;
NM_021150.4(GRIP1):c.2205G>A (p.Lys735=)23426GRIP1Uncertain significancers886049797RCV000380986; NMONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052126678619166786191CT12:g.66786191C>TClinGen:CA10633500C0265233 219000 Cryptophthalmos syndrome;
NM_001366722.1(GRIP1):c.1838+13G>T23426GRIP1Benignrs7397862RCV000244279|RCV000351116|RCV001094088; NMedGen:CN169374|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MONDO:MONDO:0054739,MedGen:C4540040,OMIM:617667126681448766814487CA12:g.66814487C>AClinGen:CA6674274C0265233 219000 Cryptophthalmos syndrome;
NM_001366722.1(GRIP1):c.1355-10_1355-8del23426GRIP1Benign/Likely benignrs148083271RCV000174157|RCV000334394|RCV000965245; NMedGen:CN169374|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MedGen:CN517202126683929666839298GAACG12:g.66839296_66839298delClinGen:CA200851C0265233 219000 Cryptophthalmos syndrome;
NM_001366722.1(GRIP1):c.724+10G>A23426GRIP1Benignrs12316942RCV000249539|RCV000264282|RCV001094175; NMedGen:CN169374|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MONDO:MONDO:0054739,MedGen:C4540040,OMIM:617667126690938966909389CT12:g.66909389C>TClinGen:CA6674563C0265233 219000 Cryptophthalmos syndrome;
NM_001366722.1(GRIP1):c.503-15C>A23426GRIP1Benignrs11838180RCV000244788|RCV000273033|RCV001094212; NMedGen:CN169374|MONDO:MONDO:0054737,MedGen:C4551480,OMIM:219000, Orphanet:2052|MONDO:MONDO:0054739,MedGen:C4540040,OMIM:617667126691177166911771GT12:g.66911771G>TClinGen:CA6674612C0265233 219000 Cryptophthalmos syndrome;
MSeqDR Portal