MSeqDR Mitochondrial Disease Portal


 
*:HP: HPO terms, UMDF: 1= Disease, ND: NAMDC terms.
  Most Studied  CPEO, Complex I Deficiency, COXPD1, Leigh, LHON, MELAS, MERRF, Myopathy, SANDO
Disease Browser
Parent Node:
expand
Craniosynostoses (D003398)
Parent Node:
expand
Ectodermal Dysplasia (D004476)
..Starting node
..expand
Cranioectodermal Dysplasia (C562966)

       Child Nodes:



 Sister Nodes: 
..expandAdams Oliver syndrome (C538225)
..expandAlves Castelo dos Santos syndrome (C536593)
..expandAnal sphincter dysplasia (C538254)
..expandAplasia cutis congenita intestinal lymphangiectasia (C537788)
..expandAplasia cutis congenita of limbs recessive (C536840)
..expandAplasia Cutis Congenita with Epibulbar Dermoids (C563969)
..expandAplasia Cutis Congenita, Congenital Heart Defect, And Frontonasal Cysts (C566997)
..expandAplasia Cutis Congenita, High Myopia, and Cone-Rod Dysfunction (C563394)
..expandAREDYLD Syndrome (C537427)
..expandArthrogryposis and ectodermal dysplasia (C537441)
..expandBasan syndrome (C537659)
..expandBrain Anomalies, Retardation, Ectodermal Dysplasia, Skeletal Malformations, Hirschsprung Disease, Ear-Eye Anomalies, Cleft Palate-Cryptorchidism, And (C564519)
..expandBrunoni syndrome (C537408)
..expandCardiofaciocutaneous syndrome (C535579)
..expandCerebellar ataxia ectodermal dysplasia (C535350)
..expandCleft Lip with or without Cleft Palate, Nonsyndromic, 8 (C565070)
..expandCongenital ectodermal dysplasia with hearing loss (C535757)
..expandCONGENITAL HEART DEFECTS AND ECTODERMAL DYSPLASIA (OMIM:617364)
..expandContractures ectodermal dysplasia cleft lip palate (C535465)
..expandCranioectodermal Dysplasia (C562966) Child1
..expandDeafness with Anhidrotic Ectodermal Dysplasia (C565119)
..expandDermatoosteolysis Kirghizian type (C535373)
..expandEctodermal Dysplasia 1, Anhidrotic (D053358) Child1
..expandECTODERMAL DYSPLASIA 11A, HYPOHIDROTIC/HAIR/TOOTH TYPE, AUTOSOMAL DOMINANT (OMIM:614940)
..expandECTODERMAL DYSPLASIA 12, HYPOHIDROTIC/HAIR/TOOTH/NAIL TYPE (OMIM:617337)
..expandECTODERMAL DYSPLASIA 13, HAIR/TOOTH TYPE (OMIM:617392)
..expandEctodermal Dysplasia 3, Anhidrotic (D053359)
..expandECTODERMAL DYSPLASIA 4, HAIR/NAIL TYPE (OMIM:602032)
..expandECTODERMAL DYSPLASIA 7, HAIR/NAIL TYPE (OMIM:614929)
..expandECTODERMAL DYSPLASIA 9, HAIR/NAIL TYPE (OMIM:614931)
..expandEctodermal dysplasia adrenal cyst (C538015)
..expandEctodermal dysplasia alopecia preaxial polydactyly (C538016)
..expandEctodermal Dysplasia and Neurosensory Deafness (C565606)
..expandEctodermal dysplasia mental retardation syndactyly (C538018)
..expandEctodermal Dysplasia Syndrome with Distinctive Facial Appearance and Preaxial Polydactyly of Feet (C565067)
..expandEctodermal Dysplasia with Natal Teeth, Turnpenny Type (C563347)
..expandEctodermal Dysplasia, Anhidrotic, with Immunodeficiency, Osteopetrosis, and Lymphedema (C564538)
..expandEctodermal Dysplasia, Anhidrotic, With T-Cell Immunodeficiency, Autosomal Dominant (C567411)
..expandEctodermal dysplasia, ectrodactyly, and macular dystrophy (C536190)
..expandEctodermal Dysplasia, Hidrotic, Autosomal Recessive (C566553)
..expandEctodermal dysplasia, hidrotic, Christianson-Fourie type (C536180)
..expandEctodermal Dysplasia, Hypohidrotic, Autosomal Recessive (D053360)
..expandEctodermal Dysplasia, Hypohidrotic, with Hypothyroidism and Agenesis of the Corpus Callosum (C565605)
..expandEctodermal Dysplasia, Hypohidrotic, with Hypothyroidism and Ciliary Dyskinesia (C565604)
..expandEctodermal dysplasia, hypohidrotic, with immune deficiency (C536181)
..expandEctodermal Dysplasia, Pure Hair-Nail Type (C566592)
..expandEctodermal dysplasia, sensorineural hearing loss, and distinctive facial features (C536182)
..expandEctodermal Dysplasia, Trichoodontoonychial Type (C565068)
..expandEctodermal Dysplasia-Skin Fragility Syndrome (C536183)
..expandECTODERMAL DYSPLASIA-SYNDACTYLY SYNDROME 1 (OMIM:613573)
..expandECTODERMAL DYSPLASIA-SYNDACTYLY SYNDROME 2 (OMIM:613576)
..expandECTODERMAL DYSPLASIA/SHORT STATURE SYNDROME (OMIM:616029)
..expandEctrodactyly and Ectodermal Dysplasia without Cleft Lip-Palate (C565065)
..expandEctrodactyly, Ectodermal Dysplasia, And Cleft Lip-Palate Syndrome 1 (C565062)
..expandEctrodactyly, Ectodermal Dysplasia, and Cleft Lip-Palate Syndrome 3 (C565799)
..expandEctrodactyly-cleft lip-palate syndrome (C536189)
..expandEllis-Van Creveld Syndrome (D004613) Child6
..expandEpidermolysis bullosa with pyloric atresia (C535377)
..expandEuhidrotic ectodermal dysplasia (C535763)
..expandFacial ectodermal dysplasia (C536385)
..expandFocal Dermal Hypoplasia (D005489) Child1
..expandFocal facial dermal dysplasia (C537068)
..expandFreire-Maia odontotrichomelic syndrome (C535637)
..expandHalal Setton Wang syndrome (C535621)
..expandHay Wells syndrome recessive type (C535846)
..expandHay-Wells syndrome (C535847)
..expandHyper-IgM Immunodeficiency, X-Linked, with Ectodermal Dysplasia, Hypohidrotic (C564542)
..expandJohanson Blizzard syndrome (C535880)
..expandJones Hersh Yusk syndrome (C535885)
..expandLadda Zonana Ramer syndrome (C538135)
..expandLelis Syndrome (C564261)
..expandLINEAR SKIN DEFECTS WITH MULTIPLE CONGENITAL ANOMALIES 2 (OMIM:300887)
..expandMadokoro Ohdo Sonoda syndrome (C537838)
..expandNaegeli syndrome (C538331)
..expandNEMO mutation with immunodeficiency (C538399)
..expandNeurocutaneous Syndromes (D020752) Child42  LSDB C:1
..expandOdontomicronychial dysplasia (C537741)
..expandOdontoonychodermal dysplasia (C537742)
..expandOdontotrichoungual-Digital-Palmar Syndrome (C566598)
..expandOrofacial Cleft 7 (C563464)
..expandPachyonychia Congenita (D053549) Child5
..expandPinheiro Freire-Maia Miranda syndrome (C537402)
..expandPropping Zerres syndrome (C538052)
..expandRapp-Hodgkin syndrome (C535289)
..expandRobinson Miller Bensimon syndrome (C535864)
..expandRosselli-Gulienetti Syndrome (C563117)
..expandSener syndrome (C537579)
..expandSeres-Santamaria Arimany Muniz syndrome (C537585)
..expandTaurodontia absent teeth sparse hair (C536945)
..expandTetra amelia with ectodermal dysplasia and lacrimal duct abnormalities (C536496)
..expandTrichodental syndrome (C536551)
..expandTrichoodontoonychial Dysplasia (C564760)
..expandTrichoscyphodysplasia (C536557)
..expandTRICHOTHIODYSTROPHY 1, PHOTOSENSITIVE (OMIM:601675)
..expandTrueb Burg Bottani syndrome (C536565)
..expandYunis Varon syndrome (C536719)
..expandZlotogora-Ogur syndrome (C536726)
   

Human Disease MESH is developed by UMLS.
Further data from MedGen, OMIM,ClinVar, CTD
Term ID:3121
Name:Cranioectodermal Dysplasia
Definition:
Alternative IDs:OMIM:218330|OMIM:613610|OMIM:614099|OMIM:614378
ParentIDs:MESH:D003398|MESH:D004476
TreeNumbers:C05.116.099.370.894.232/C562966 |C05.660.207.240/C562966 |C05.660.906.364/C562966 |C16.131.077.350/C562966 |C16.131.621.207.240/C562966 |C16.131.621.906.364/C562966 |C16.131.831.350/C562966 |C16.320.850.250/C562966 |C17.800.804.350/C562966 |C17.800.827.250/C56296
Synonyms:CED1 |CED2 |CED3 |CED4 |CRANIOECTODERMAL DYSPLASIA 1 |CRANIOECTODERMAL DYSPLASIA 2 |CRANIOECTODERMAL DYSPLASIA 3 |CRANIOECTODERMAL DYSPLASIA 4 |Levin Syndrome I |Sensenbrenner Syndrome
Slim Mappings:Congenital abnormality|Genetic disease (inborn)|Musculoskeletal disease|Skin disease
Reference: MedGen: C562966
MeSH: C562966
OMIM: 218330;
MSeqDR LSDB:  
Genes: IFT122; IFT43; WDR19; WDR35;
Phenotypes
1 HP:0000007Autosomal recessive inheritance
2 HP:0004298Abnormality of the abdominal wall
3 HP:0000674Anodontia
4 HP:0000463Anteverted nares
5 HP:0001647Bicuspid aortic valve
6 HP:0001156Brachydactyly
7 HP:0009880Broad distal phalanges of all fingers
8 HP:0001837Broad toe
9 HP:0012622Chronic kidney disease
10 HP:0030084Clinodactyly
11 HP:0000268Dolichocephaly
12 HP:0000968Ectodermal dysplasia
13 HP:0000286Epicanthus
14 HP:0000232Everted lower lip vermilion
15 HP:0003038Fibular hypoplasia
16 HP:0002213Fine hair
17 HP:0003071Flattened epiphysis
18 HP:0002007Frontal bossing
19 HP:0000293Full cheeks
20 HP:0001407Hepatic cysts
21 HP:0001399Hepatic failure
22 HP:0001395Hepatic fibrosis
23 HP:0002240Hepatomegaly
24 HP:0000218High palate
25 HP:0002705High, narrow palate
26 HP:0002901Hypocalcemia
27 HP:0000668Hypodontia
28 HP:0006297Hypoplasia of dental enamel
29 HP:0000601Hypotelorism
30 HP:0001388Joint laxity
31 HP:0006563Malformation of the hepatic ductal plate
32 HP:0000691Microdontia
33 HP:0000545Myopia
34 HP:0000774Narrow chest
35 HP:0000639Nystagmus
36 HP:0000939Osteoporosis
37 HP:0000767Pectus excavatum
38 HP:0001538Protuberant abdomen
39 HP:0009466Radial deviation of finger
40 HP:0005567Renal magnesium wasting
41 HP:0000556Retinal dystrophy
42 HP:0008905Rhizomelia
43 HP:0004442Sagittal craniosynostosis
44 HP:0030799Scaphocephaly
45 HP:0009882Short distal phalanx of finger
46 HP:0005792Short humerus
47 HP:0001799Short nail
48 HP:0000773Short ribs
49 HP:0001831Short toe
50 HP:0000954Single transverse palmar crease
51 HP:0002217Slow-growing hair
52 HP:0008070Sparse hair
53 HP:0000506Telecanthus
54 HP:0001816Thin nail
55 HP:0001970Tubulointerstitial nephritis
56 HP:0000431Wide nasal bridge
57 HP:0000687Widely spaced teeth
Disease Causing ClinVar Variants
Variation_NameGeneIDGeneSymbolClinicalSignificancedbSNPRCVaccessionTestedInGTRPhenotypeIDsChromosomeStartStopHGVS_cHGVS_pHGVS_gOtherIDsDisease_ClinVar
NC_000003.11:g.(?_129150344)_(129252561_?)dup55764IFT122Uncertain significance-1RCV001961718; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129150344129252561nana-1-
NM_001280545.1(IFT122):c.-811C>A55764IFT122Benign/Likely benignrs148987764RCV000380131|RCV001557240; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:1515|MedGen:CN5172023129158964129158964CA3:g.129158964C>AClinGen:CA10614833CN119432 Cranioectodermal dysplasia;
NM_001280545.1(IFT122):c.-807A>G55764IFT122Benignrs3138334RCV000278693|RCV001538843; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:1515|MedGen:CN5172023129158968129158968AGNC_000003.11:g.129158968A>GClinGen:CA10617191CN119432 Cranioectodermal dysplasia;
NM_001280545.1(IFT122):c.-746T>A55764IFT122Uncertain significancers923805618RCV001147118; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129159029129159029TA3:g.129159029T>A-
NM_052989.3(IFT122):c.-22C>A55764IFT122Uncertain significancers551140180RCV001148005; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129159152129159152CA3:g.129159152C>A-
NM_052989.3(IFT122):c.-3G>A55764IFT122Uncertain significancers367704478RCV000335929; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129159171129159171GANC_000003.11:g.129159171G>AClinGen:CA2605656CN119432 Cranioectodermal dysplasia;
NC_000003.11:g.(?_129159174)_(129214470_?)del55764IFT122Pathogenic-1RCV001947017; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129159174129214470nana-1-
NM_052989.3(IFT122):c.21G>C (p.Trp7Cys)55764IFT122Pathogenicrs267607193RCV000004901; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129159194129159194GC3:g.129159194G>CClinGen:CA340279,UniProtKB:Q9HBG6#VAR_063584,OMIM:606045.0004C0432235 218330 Cranioectodermal dysplasia 1;
NM_052989.3(IFT122):c.41+15G>T55764IFT122Conflicting interpretations of pathogenicityrs36222038RCV000339201|RCV001148006; NMedGen:CN517202|MONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129159229129159229GT3:g.129159229G>TClinGen:CA2605658CN169374 not specified;
NM_052989.3(IFT122):c.42-17C>G55764IFT122Likely benign-1RCV002199993; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129168697129168697CG129168697-
NM_052989.3(IFT122):c.42-6G>T55764IFT122Likely benign-1RCV002122298; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129168708129168708GT129168708-
NM_052989.3(IFT122):c.54C>T (p.Ile18=)55764IFT122Uncertain significancers139138308RCV001148007; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129168726129168726CT3:g.129168726C>T-
NM_052989.3(IFT122):c.93C>T (p.Ala31=)55764IFT122Likely benign-1RCV002104341; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129168765129168765CT129168765-
NM_052989.3(IFT122):c.108+4G>A55764IFT122Uncertain significance-1RCV001919991; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129168784129168784GA129168784-
NM_052989.3(IFT122):c.109-15T>C55764IFT122Benign/Likely benignrs114298924RCV000374177|RCV000609937|RCV002057832; NMONDO:MONDO:0009032,MedGen:C4551571,OMIM:PS218330, Orphanet:1515|MedGen:CN169374|MONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129170742129170742TCNC_000003.11:g.129170742T>CClinGen:CA2605705CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.109-10C>T55764IFT122Likely benign-1RCV002089348; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129170747129170747CT129170747-
NM_052989.3(IFT122):c.132C>G (p.Thr44=)55764IFT122Conflicting interpretations of pathogenicityrs371772807RCV000282096|RCV000964657; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:1515|MedGen:CN5172023129170780129170780CGNC_000003.11:g.129170780C>GClinGen:CA10614836CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.172T>C (p.Cys58Arg)55764IFT122Likely pathogenicrs2074912574RCV001261959; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129170820129170820TC3:g.129170820T>C-
NM_052989.3(IFT122):c.199C>A (p.Arg67Ser)55764IFT122Uncertain significancers181971625RCV000348801; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129177447129177447CANC_000003.11:g.129177447C>AClinGen:CA2605742CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.214T>G (p.Ser72Ala)55764IFT122Uncertain significancers144140226RCV000399027; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129177462129177462TGNC_000003.11:g.129177462T>GClinGen:CA2605748CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.227G>A (p.Ser76Asn)55764IFT122Uncertain significance-1RCV001889252; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129177475129177475GA129177475-
NM_052989.3(IFT122):c.228C>T (p.Ser76=)55764IFT122Conflicting interpretations of pathogenicityrs772835552RCV000313770; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129177476129177476CTNC_000003.11:g.129177476C>TClinGen:CA2605751CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.272+1G>A55764IFT122Likely pathogenic-1RCV001535931; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129177521129177521GA129177521-
NM_052989.3(IFT122):c.273-388T>A55764IFT122Likely benign-1RCV002174906; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129179683129179683TA129179683-
NM_052989.3(IFT122):c.273-346C>T55764IFT122Uncertain significance-1RCV001866892; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129179725129179725CT129179725-
NM_052989.3(IFT122):c.273-331C>A55764IFT122Benign-1RCV002186169; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129179740129179740CA129179740-
NM_052989.3(IFT122):c.273-281_273-271del55764IFT122Pathogenic-1RCV001783466; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129179790129179800AAGGCCAAGGTGA129179789OMIM:606045.0009
NM_052989.3(IFT122):c.273-268A>T55764IFT122Uncertain significance-1RCV001965201; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129179803129179803AT129179803-
NM_052989.3(IFT122):c.273-260T>C55764IFT122Uncertain significancers369997431RCV001149545; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129179811129179811TC3:g.129179811T>C-
NM_052989.3(IFT122):c.273-211dup55764IFT122Likely benign-1RCV002148400; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129179859129179860CCA129179859-
NM_052989.3(IFT122):c.291A>G (p.Gln97=)55764IFT122Uncertain significancers569507011RCV001296880; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129180089129180089AG129180089-
NM_052989.3(IFT122):c.321A>G (p.Gln107=)55764IFT122Conflicting interpretations of pathogenicityrs138793724RCV000352191|RCV000729626|RCV000951867|RCV001553266; NMONDO:MONDO:0009032,MedGen:C4551571,OMIM:PS218330, Orphanet:1515|MedGen:CN169374|MONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:1515|MedGen:CN5172023129180119129180119AGNC_000003.11:g.129180119A>GClinGen:CA2605834CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.349+1G>A55764IFT122Likely pathogenicrs1559869525RCV000705197; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129180148129180148GANC_000003.11:g.129180148G>A-C0432235 218330 Cranioectodermal dysplasia 1;
NM_052989.3(IFT122):c.349+4C>T55764IFT122Uncertain significance-1RCV001891963; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129180151129180151CT129180151-
NM_052989.3(IFT122):c.349+5G>A55764IFT122Uncertain significancers376595844RCV000004900; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129180152129180152GA3:g.129180152G>AClinGen:CA340278,OMIM:606045.0003C0432235 218330 Cranioectodermal dysplasia 1;
NM_052989.3(IFT122):c.394A>G (p.Ser132Gly)55764IFT122Uncertain significance-1RCV001875537; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129182447129182447AG129182447-
NM_052989.3(IFT122):c.410G>C (p.Cys137Ser)55764IFT122Uncertain significance-1RCV001914674; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129182463129182463GC129182463-
NM_052989.3(IFT122):c.410G>A (p.Cys137Tyr)55764IFT122Uncertain significance-1RCV001893499; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129182463129182463GA129182463-
NM_052989.3(IFT122):c.416+2T>G55764IFT122Likely pathogenic-1RCV002023959; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129182471129182471TG129182471-
NM_052989.3(IFT122):c.416+12T>C55764IFT122Benign-1RCV002159377; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129182481129182481TC129182481-
NM_052989.3(IFT122):c.416+17C>T55764IFT122Likely benign-1RCV002192620; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129182486129182486CT129182486-
NM_052989.3(IFT122):c.416+18G>A55764IFT122Likely benign-1RCV002083067; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129182487129182487GA129182487-
NM_052989.3(IFT122):c.416+19del55764IFT122Uncertain significance-1RCV002038409; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129182488129182488GAG129182487-
NM_052989.3(IFT122):c.417-16T>C55764IFT122Likely benign-1RCV002163453; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129183462129183462TC129183462-
NM_052989.3(IFT122):c.444G>A (p.Ala148=)55764IFT122Likely benign-1RCV002095996; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129183505129183505GA129183505-
NM_052989.3(IFT122):c.475C>T (p.Arg159Trp)55764IFT122Uncertain significancers140547512RCV000401067; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129183536129183536CTNC_000003.11:g.129183536C>TClinGen:CA2605884CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.477_479del (p.Asn160del)55764IFT122Uncertain significance-1RCV002011548; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129183538129183540GGAAG129183537-
NM_052989.3(IFT122):c.478A>G (p.Asn160Asp)55764IFT122Uncertain significance-1RCV001974261; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129183539129183539AG129183539-
NM_052989.3(IFT122):c.516G>T (p.Pro172=)55764IFT122Likely benignrs748272790RCV000945314|RCV001472025; NMedGen:CN517202|MONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129183577129183577GT3:g.129183577G>T-
NM_052989.3(IFT122):c.524C>T (p.Ser175Phe)55764IFT122Uncertain significance-1RCV002013175; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129183585129183585CT129183585-
NM_052989.3(IFT122):c.531G>A (p.Ser177=)55764IFT122Likely benignrs150496357RCV000951963; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129183592129183592GA3:g.129183592G>A-
NM_052989.3(IFT122):c.552del (p.Cys183_Trp184insTer)55764IFT122Uncertain significancers781766922RCV000778674; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129183612129183612TGTNC_000003.11:g.129183613del-
NM_052989.3(IFT122):c.556C>T (p.Pro186Ser)55764IFT122Uncertain significance-1RCV001898137; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129183617129183617CT129183617-
NM_052989.3(IFT122):c.563+7T>C55764IFT122Likely benignrs371311619RCV000952242; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129183631129183631TC3:g.129183631T>C-
NM_052989.3(IFT122):c.564-15A>G55764IFT122Likely benign-1RCV002135041; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129185718129185718AG129185718-
NM_052989.3(IFT122):c.565C>T (p.Arg189Ter)55764IFT122Conflicting interpretations of pathogenicityrs138329739RCV000705716; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129185734129185734CTNC_000003.11:g.129185734C>T-C0432235 218330 Cranioectodermal dysplasia 1;
NM_052989.3(IFT122):c.617T>C (p.Ile206Thr)55764IFT122Likely benignrs59912693RCV000399070|RCV000945510|RCV001582907; NMedGen:CN169374|MONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:1515|MedGen:CN5172023129185786129185786TC3:g.129185786T>CClinGen:CA2605932CN169374 not specified;
NM_052989.3(IFT122):c.618T>G (p.Ile206Met)55764IFT122Uncertain significancers1320096747RCV000808937; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129185787129185787TG3:g.129185787T>G-
NM_052989.3(IFT122):c.645T>C (p.Pro215=)55764IFT122Likely benign-1RCV002211633; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129185814129185814TC129185814-
NM_052989.3(IFT122):c.686A>C (p.Glu229Ala)55764IFT122Uncertain significance-1RCV001882169; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129185855129185855AC129185855-
NM_052989.3(IFT122):c.702_713dup (p.Pro235_Glu238dup)55764IFT122Uncertain significancers2076877349RCV001046490; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129185862129185863GGGAGGAAGAACCA3:g.129185862_129185863insGAGGAAGAACCA-
NM_052989.3(IFT122):c.732C>T (p.Asp244=)55764IFT122Likely benign-1RCV002110669; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129185901129185901CT129185901-
NM_052989.3(IFT122):c.740+15G>A55764IFT122Benignrs56379561RCV000248999|RCV000307477|RCV001701826; NMedGen:CN169374|MONDO:MONDO:0009032,MedGen:C4551571,OMIM:PS218330, Orphanet:1515|MONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129185924129185924GANC_000003.11:g.129185924G>AClinGen:CA2605965CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.748C>T (p.Arg250Cys)55764IFT122Uncertain significancers373212863RCV001326083; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129188192129188192CT129188192-
NM_052989.3(IFT122):c.752A>G (p.Asn251Ser)55764IFT122Uncertain significancers754782458RCV001145256; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129188196129188196AG3:g.129188196A>G-
NM_052989.3(IFT122):c.783G>A (p.Gln261=)55764IFT122Conflicting interpretations of pathogenicityrs144727222RCV000955119|RCV001145257; NMedGen:CN517202|MONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129188227129188227GA3:g.129188227G>A-
NM_052989.3(IFT122):c.795C>T (p.Phe265=)55764IFT122Likely benign-1RCV002106797; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129188239129188239CT129188239-
NM_052989.3(IFT122):c.806G>A (p.Ser269Asn)55764IFT122Uncertain significance-1RCV001917149; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129188250129188250GA129188250-
NM_052989.3(IFT122):c.816+12T>C55764IFT122Likely benign-1RCV002181365; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129188272129188272TC129188272-
NM_052989.3(IFT122):c.825G>T (p.Lys275Asn)55764IFT122Benign/Likely benignrs117517364RCV000254384|RCV000946250|RCV001618475; NMedGen:CN169374|MONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:1515|MedGen:CN5172023129195166129195166GT3:g.129195166G>TClinGen:CA2606008CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.829C>T (p.Arg277Trp)55764IFT122Uncertain significancers61744448RCV000272301; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129195170129195170CTNC_000003.11:g.129195170C>TClinGen:CA2606009CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.832G>A (p.Ala278Thr)55764IFT122Uncertain significance-1RCV001930725; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129195173129195173GA129195173-
NM_052989.3(IFT122):c.849C>T (p.Pro283=)55764IFT122Likely benign-1RCV002075045; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129195190129195190CT129195190-
NM_052989.3(IFT122):c.852C>G (p.Cys284Trp)55764IFT122Uncertain significance-1RCV001925894; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129195193129195193CG129195193-
NM_052989.3(IFT122):c.876C>T (p.Gly292=)55764IFT122Conflicting interpretations of pathogenicityrs768782991RCV001145258; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129195217129195217CT3:g.129195217C>T-
NM_052989.3(IFT122):c.877G>A (p.Glu293Lys)55764IFT122Uncertain significancers775510906RCV000792192; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129195218129195218GA3:g.129195218G>A-
NM_052989.3(IFT122):c.894G>A (p.Gly298=)55764IFT122Likely benign-1RCV002155232; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129195235129195235GA129195235-
NM_052989.3(IFT122):c.896G>A (p.Gly299Asp)55764IFT122Likely pathogenicrs2077955754RCV001281142; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129195237129195237GA129195237-
NM_052989.3(IFT122):c.937C>T (p.Arg313Trp)55764IFT122Uncertain significance-1RCV002044235; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129195278129195278CT129195278-
NM_052989.3(IFT122):c.938G>A (p.Arg313Gln)55764IFT122Uncertain significancers376018883RCV000301619; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129195279129195279GANC_000003.11:g.129195279G>AClinGen:CA2606029CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.955del (p.Glu319fs)55764IFT122Pathogenicrs397515567RCV000055971; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129195293129195293TGTNC_000003.11:g.129195296delOMIM:606045.0005,ClinGen:CA345066
NM_052989.3(IFT122):c.965C>T (p.Ser322Phe)55764IFT122Likely pathogenicrs267607192RCV000004899; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129195306129195306CT3:g.129195306C>TClinGen:CA340276,OMIM:606045.0002C0432235 218330 Cranioectodermal dysplasia 1;
NM_052989.3(IFT122):c.977C>T (p.Thr326Met)55764IFT122Uncertain significance-1RCV001960444; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129195318129195318CT129195318-
NM_052989.3(IFT122):c.978G>A (p.Thr326=)55764IFT122Conflicting interpretations of pathogenicityrs781409395RCV000303023|RCV002059123; NMedGen:CN517202|MONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129195319129195319GA3:g.129195319G>AClinGen:CA2606034CN169374 not specified;
NM_052989.3(IFT122):c.986C>T (p.Ala329Val)55764IFT122Uncertain significance-1RCV002048099; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129195327129195327CT129195327-
NM_052989.3(IFT122):c.1008+17T>G55764IFT122Likely benign-1RCV002128122; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129195366129195366TG129195366-
NM_052989.3(IFT122):c.1009-14C>T55764IFT122Conflicting interpretations of pathogenicityrs202155515RCV000358875; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129195492129195492CTNC_000003.11:g.129195492C>TClinGen:CA2606050CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.1009G>C (p.Val337Leu)55764IFT122Uncertain significance-1RCV001934577; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129195506129195506GC129195506-
NM_052989.3(IFT122):c.1024G>A (p.Asp342Asn)55764IFT122Uncertain significance-1RCV001998028; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129195521129195521GA129195521-
NM_052989.3(IFT122):c.1026C>T (p.Asp342=)55764IFT122Conflicting interpretations of pathogenicityrs79187669RCV000251326|RCV000725440|RCV001086371; NMedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129195523129195523CT3:g.129195523C>TClinGen:CA2606058CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.1067A>C (p.His356Pro)55764IFT122Uncertain significancers1064796598RCV000481881|RCV001219618; NMedGen:CN517202|MONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129195564129195564AC3:g.129195564A>CClinGen:CA16617825CN169374 not specified;
NM_052989.3(IFT122):c.1103G>A (p.Ser368Asn)55764IFT122Benign/Likely benignrs150550701RCV000174413|RCV000878672|RCV001376273|RCV001573983; NMedGen:CN169374|MONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:1515|Human Phenotype Ontology:HP:0000510,Human Phenotype Ontology:HP:0001127,Human Phenotype Ontology:HP:0007635,Human Phenotype Ontology:HP:0007645,Human Phenotype Ontology:HP:0003129195600129195600GA3:g.129195600G>AClinGen:CA200972CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.1113C>T (p.Asp371=)55764IFT122Benign/Likely benignrs139319087RCV000543337|RCV001553136; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:1515|MedGen:CN5172023129195610129195610CTNC_000003.11:g.129195610C>TClinGen:CA2606069C0432235 218330 Cranioectodermal dysplasia 1;
NM_052989.3(IFT122):c.1139A>G (p.Glu380Gly)55764IFT122Likely benignrs755060067RCV000932142|RCV001435452; NMedGen:CN517202|MONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129195636129195636AG3:g.129195636A>G-
NM_052989.3(IFT122):c.1147+19C>T55764IFT122Benignrs2301570RCV000243928|RCV001660356|RCV001701918; NMedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129195663129195663CT3:g.129195663C>TClinGen:CA2606081CN169374 not specified;
NM_052989.3(IFT122):c.1150C>T (p.Arg384Trp)55764IFT122Uncertain significancers139079256RCV000371676; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129196861129196861CTNC_000003.11:g.129196861C>TClinGen:CA2606098CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.1168C>T (p.Leu390Phe)55764IFT122Uncertain significance-1RCV001938393; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129196879129196879CT129196879-
NM_052989.3(IFT122):c.1170T>G (p.Leu390=)55764IFT122Likely benign-1RCV002075329; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129196881129196881TG129196881-
NM_052989.3(IFT122):c.1188C>T (p.Ile396=)55764IFT122Likely benign-1RCV002103799; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129196899129196899CT129196899-
NM_052989.3(IFT122):c.1190A>G (p.Tyr397Cys)55764IFT122Uncertain significance-1RCV001895481; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129196901129196901AG129196901-
NM_052989.3(IFT122):c.1199G>A (p.Arg400Gln)55764IFT122Uncertain significance-1RCV001955350; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129196910129196910GA129196910-
NM_052989.3(IFT122):c.1207A>C (p.Ile403Leu)55764IFT122Uncertain significancers149915993RCV001308212; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129196918129196918AC129196918-
NM_052989.3(IFT122):c.1239G>A (p.Glu413=)55764IFT122Benign/Likely benignrs111717774RCV000878457|RCV001731617; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:1515|MedGen:CN5172023129196950129196950GANC_000003.11:g.129196950G>AClinGen:CA2606111CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.1252G>A (p.Asp418Asn)55764IFT122Uncertain significancers148626512RCV000637014|RCV001756057; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:1515|MedGen:CN5172023129196963129196963GA3:g.129196963G>AClinGen:CA2606114C0432235 218330 Cranioectodermal dysplasia 1;
NM_052989.3(IFT122):c.1273C>T (p.Arg425Trp)55764IFT122Benign/Likely benignrs61744639RCV000317731|RCV000514719|RCV001079816; NMedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129196984129196984CT3:g.129196984C>TClinGen:CA2606118C0432235 218330 Cranioectodermal dysplasia 1;
NM_052989.3(IFT122):c.1275G>A (p.Arg425=)55764IFT122Likely benign-1RCV002105022; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129196986129196986GA129196986-
NM_052989.3(IFT122):c.1294A>G (p.Lys432Glu)55764IFT122Uncertain significancers781181264RCV000319859; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129197005129197005AGNC_000003.11:g.129197005A>GClinGen:CA2606121CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.1310A>G (p.Asn437Ser)55764IFT122Uncertain significance-1RCV001991401; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129197021129197021AG129197021-
NM_052989.3(IFT122):c.1367G>A (p.Cys456Tyr)55764IFT122Uncertain significance-1RCV001870767; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129198644129198644GA129198644-
NM_052989.3(IFT122):c.1367G>T (p.Cys456Phe)55764IFT122Uncertain significance-1RCV002027773; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129198644129198644GT129198644-
NM_052989.3(IFT122):c.1378A>T (p.Ser460Cys)55764IFT122Uncertain significancers1577642330RCV001218177; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129198655129198655AT3:g.129198655A>T-
NM_052989.3(IFT122):c.1380C>T (p.Ser460=)55764IFT122Likely benign-1RCV001540938|RCV002071957; NMedGen:CN517202|MONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129198657129198657CT129198657-
NM_052989.3(IFT122):c.1383A>G (p.Gly461=)55764IFT122Likely benign-1RCV002077919; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129198660129198660AG129198660-
NM_052989.3(IFT122):c.1432dup (p.Val478fs)55764IFT122Pathogenic-1RCV001972294; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129198707129198708AAG129198707-
NM_052989.3(IFT122):c.1430A>G (p.Lys477Arg)55764IFT122Uncertain significance-1RCV001878520; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129198707129198707AG129198707-
NM_052989.3(IFT122):c.1483G>A (p.Gly495Arg)55764IFT122Uncertain significancers397515568RCV000055972|RCV000754963; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:1515|MONDO:MONDO:0009032,MedGen:C4551571,OMIM:PS218330, Orphanet:15153129198760129198760GA3:g.129198760G>AClinGen:CA345067,OMIM:606045.0006C0432235 218330 Cranioectodermal dysplasia 1;
NM_052989.3(IFT122):c.1487A>G (p.Gln496Arg)55764IFT122Uncertain significance-1RCV001974493; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129198764129198764AG129198764-
NM_052989.3(IFT122):c.1488G>A (p.Gln496=)55764IFT122Uncertain significance-1RCV001895827; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129198765129198765GA129198765-
NM_052989.3(IFT122):c.1488+16C>A55764IFT122Likely benign-1RCV002177885; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129198781129198781CA129198781-
NM_052989.3(IFT122):c.1489-16G>A55764IFT122Likely benign-1RCV002216869; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129200357129200357GA129200357-
NM_052989.3(IFT122):c.1503C>T (p.Phe501=)55764IFT122Likely benignrs113871672RCV000637017; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129200387129200387CT3:g.129200387C>TClinGen:CA2606203C0432235 218330 Cranioectodermal dysplasia 1;
NM_052989.3(IFT122):c.1505T>G (p.Val502Gly)55764IFT122Pathogenicrs267607191RCV000004898; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129200389129200389TG3:g.129200389T>GClinGen:CA340274,OMIM:606045.0001C0432235 218330 Cranioectodermal dysplasia 1;
NM_052989.3(IFT122):c.1506G>C (p.Val502=)55764IFT122Likely benign-1RCV002125671; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129200390129200390GC129200390-
NM_052989.3(IFT122):c.1525G>A (p.Val509Ile)55764IFT122Likely benign-1RCV001501798; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129200409129200409GA129200409-
NM_052989.3(IFT122):c.1526T>C (p.Val509Ala)55764IFT122Conflicting interpretations of pathogenicityrs191420441RCV000731240|RCV001432301; NMedGen:CN517202|MONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129200410129200410TCNC_000003.11:g.129200410T>C-
NM_052989.3(IFT122):c.1532T>C (p.Leu511Pro)55764IFT122Likely pathogenicrs372355939RCV001281141; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129200416129200416TC129200416-
NM_052989.3(IFT122):c.1533G>A (p.Leu511=)55764IFT122Benign/Likely benignrs183614690RCV000613265|RCV000960808; NMedGen:CN169374|MONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129200417129200417GANC_000003.11:g.129200417G>AClinGen:CA2606215CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.1553G>A (p.Arg518His)55764IFT122Conflicting interpretations of pathogenicityrs138223055RCV000294078; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129200437129200437GANC_000003.11:g.129200437G>AClinGen:CA2606218CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.1570G>A (p.Ala524Thr)55764IFT122Uncertain significancers2078655875RCV001148107; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129200454129200454GA3:g.129200454G>A-
NM_052989.3(IFT122):c.1576C>T (p.Arg526Cys)55764IFT122Uncertain significancers149578956RCV001148108; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129200460129200460CT3:g.129200460C>T-
NM_052989.3(IFT122):c.1577G>A (p.Arg526His)55764IFT122Uncertain significance-1RCV001887722; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129200461129200461GA129200461-
NM_052989.3(IFT122):c.1590C>T (p.Ala530=)55764IFT122Likely benign-1RCV002184770; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129200474129200474CT129200474-
NM_052989.3(IFT122):c.1590C>A (p.Ala530=)55764IFT122Likely benign-1RCV002093376; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129200474129200474CA129200474-
NM_052989.3(IFT122):c.1644G>T (p.Leu548=)55764IFT122Likely benign-1RCV002217785; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129200528129200528GT129200528-
NM_052989.3(IFT122):c.1654-20C>G55764IFT122Likely benign-1RCV002180169; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129202308129202308CG129202308-
NM_052989.3(IFT122):c.1654-16T>C55764IFT122Likely benign-1RCV001889386; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129202312129202312TC129202312-
NM_052989.3(IFT122):c.1654-12C>T55764IFT122Benignrs112066509RCV000248710|RCV000351214|RCV001701978; NMedGen:CN169374|MONDO:MONDO:0009032,MedGen:C4551571,OMIM:PS218330, Orphanet:1515|MONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129202316129202316CT3:g.129202316C>TClinGen:CA2606257CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.1713G>T (p.Ser571=)55764IFT122Benign/Likely benignrs150174636RCV000389496|RCV000536035|RCV001672620; NMONDO:MONDO:0009032,MedGen:C4551571,OMIM:PS218330, Orphanet:1515|MONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:1515|MedGen:CN5172023129202387129202387GTNC_000003.11:g.129202387G>TClinGen:CA2606273CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.1758C>G (p.His586Gln)55764IFT122Conflicting interpretations of pathogenicityrs141889207RCV000288140; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129202432129202432CGNC_000003.11:g.129202432C>GClinGen:CA2606281CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.1759C>T (p.Arg587Trp)55764IFT122Uncertain significance-1RCV001965119; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129202433129202433CT129202433-
NM_052989.3(IFT122):c.1760G>A (p.Arg587Gln)55764IFT122Uncertain significance-1RCV001883999; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129202434129202434GA129202434-
NM_052989.3(IFT122):c.1795G>A (p.Gly599Ser)55764IFT122Uncertain significance-1RCV001901920; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129202469129202469GA129202469-
NM_052989.3(IFT122):c.1800C>T (p.Ser600=)55764IFT122Uncertain significancers886057965RCV000345424; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129202474129202474CTNC_000003.11:g.129202474C>TClinGen:CA10615271CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.1851+5C>T55764IFT122Uncertain significancers375595062RCV000812294; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129202530129202530CT3:g.129202530C>T-
NM_052989.3(IFT122):c.1854C>T (p.Ser618=)55764IFT122Benign/Likely benignrs146874343RCV000878430|RCV001573499|RCV001724185; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:1515|MedGen:CN517202|MedGen:CN1693743129207102129207102CT3:g.129207102C>T-
NM_052989.3(IFT122):c.1884A>T (p.Lys628Asn)55764IFT122Uncertain significancers777051654RCV000397097; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129207132129207132ATNC_000003.11:g.129207132A>TClinGen:CA10617200CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.1908T>C (p.Ile636=)55764IFT122Benign/Likely benignrs139722192RCV000192350|RCV000878458|RCV001731513; NMedGen:CN169374|MONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:1515|MedGen:CN5172023129207156129207156TC3:g.129207156T>CClinGen:CA205111CN169374 not specified;
NM_052989.3(IFT122):c.1910_1912del (p.Ala637_Cys638delinsGly)55764IFT122Uncertain significance-1RCV001982218; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129207158129207160GCTTG129207157-
NM_052989.3(IFT122):c.1940G>A (p.Arg647His)55764IFT122Uncertain significancers750301228RCV001149662; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129207188129207188GA3:g.129207188G>A-
NM_052989.3(IFT122):c.1943A>C (p.Glu648Ala)55764IFT122Benign/Likely benignrs144397126RCV000310801|RCV001723939|RCV001522318|RCV001572701; NMONDO:MONDO:0009032,MedGen:C4551571,OMIM:PS218330, Orphanet:1515|MedGen:CN169374|MONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:1515|MedGen:CN5172023129207191129207191ACNC_000003.11:g.129207191A>CClinGen:CA2606355CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.1992+7A>G55764IFT122Conflicting interpretations of pathogenicityrs757823317RCV000175241|RCV002056933; NMedGen:CN517202|MONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129207247129207247AG3:g.129207247A>GClinGen:CA240965CN169374 not specified;
NM_052989.3(IFT122):c.1993-8C>T55764IFT122Benign/Likely benignrs531091599RCV000193565|RCV000895989|RCV001731514; NMedGen:CN169374|MONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:1515|MedGen:CN5172023129210976129210976CT3:g.129210976C>TClinGen:CA207129CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.1993-8_1993-7delinsTC55764IFT122Likely benign-1RCV001442589; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129210976129210977CGTC129210976-
NM_052989.3(IFT122):c.1993-7G>C55764IFT122Benignrs2285354RCV000175375|RCV000399437|RCV000614068; NMedGen:CN169374|MONDO:MONDO:0009032,MedGen:C4551571,OMIM:PS218330, Orphanet:1515|MONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129210977129210977GC3:g.129210977G>CClinGen:CA201430CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.1993-7G>A55764IFT122Likely benignrs2285354RCV000879511; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129210977129210977GA3:g.129210977G>A-
NM_052989.3(IFT122):c.2018G>A (p.Arg673Gln)55764IFT122Uncertain significancers140911243RCV000305047; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129211009129211009GANC_000003.11:g.129211009G>AClinGen:CA2606379CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.2055G>T (p.Lys685Asn)55764IFT122Uncertain significancers779236550RCV000362017; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129214297129214297GTNC_000003.11:g.129214297G>TClinGen:CA2606400CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.2060G>A (p.Arg687Gln)55764IFT122Benign/Likely benignrs61740161RCV000249204|RCV000260238|RCV001512051|RCV001610744; NMedGen:CN169374|MONDO:MONDO:0009032,MedGen:C4551571,OMIM:PS218330, Orphanet:1515|MONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:1515|MedGen:CN5172023129214302129214302GA3:g.129214302G>AClinGen:CA2606402CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.2121T>C (p.His707=)55764IFT122Likely benign-1RCV002117222; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129214363129214363TC129214363-
NM_052989.3(IFT122):c.2138A>G (p.Tyr713Cys)55764IFT122Uncertain significancers1332128088RCV001147297; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129214380129214380AG3:g.129214380A>G-
NM_052989.3(IFT122):c.2148T>C (p.Ser716=)55764IFT122Likely benign-1RCV001450513; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129214390129214390TC129214390-
NM_052989.3(IFT122):c.2154C>T (p.His718=)55764IFT122Benign/Likely benignrs116819033RCV000637021|RCV001569596; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:1515|MedGen:CN5172023129214396129214396CTNC_000003.11:g.129214396C>TClinGen:CA2606417CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.2165C>T (p.Ala722Val)55764IFT122Uncertain significance-1RCV001942514; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129214407129214407CT129214407-
NM_052989.3(IFT122):c.2181C>T (p.Thr727=)55764IFT122Conflicting interpretations of pathogenicityrs545131069RCV000974010; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129214423129214423CTNC_000003.11:g.129214423C>TClinGen:CA2606430CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.2215C>T (p.Leu739Phe)55764IFT122Uncertain significance-1RCV001921345; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129218751129218751CT129218751-
NM_052989.3(IFT122):c.2219del (p.Gly740fs)55764IFT122Likely pathogenic-1RCV001782290; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129218754129218754TGT129218753-
NM_052989.3(IFT122):c.2223T>C (p.Ser741=)55764IFT122Likely benign-1RCV002180424; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129218759129218759TC129218759-
NM_052989.3(IFT122):c.2285del (p.Lys762fs)55764IFT122Pathogenic-1RCV001536093; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129218820129218820CAC129218819-
NM_052989.3(IFT122):c.2294A>C (p.Lys765Thr)55764IFT122Benign/Likely benignrs146026277RCV000238824|RCV000945879; NMedGen:CN169374|MONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129218830129218830AC3:g.129218830A>CClinGen:CA2606463CN169374 not specified;
NM_052989.3(IFT122):c.2298C>T (p.Ala766=)55764IFT122Likely benign-1RCV002110226; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129218834129218834CT129218834-
NM_052989.3(IFT122):c.2299G>A (p.Ala767Thr)55764IFT122Uncertain significance-1RCV002035654; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129218835129218835GA129218835-
NM_052989.3(IFT122):c.2301C>G (p.Ala767=)55764IFT122Likely benign-1RCV002199039; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129218837129218837CG129218837-
NM_052989.3(IFT122):c.2302G>A (p.Val768Met)55764IFT122Uncertain significancers561825107RCV000809477; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129218838129218838GA3:g.129218838G>A-
NM_052989.3(IFT122):c.2304G>A (p.Val768=)55764IFT122Uncertain significancers886057966RCV000262763; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129218840129218840GANC_000003.11:g.129218840G>AClinGen:CA10615272CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.2332G>T (p.Val778Phe)55764IFT122Uncertain significance-1RCV002016034; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129218868129218868GT129218868-
NM_052989.3(IFT122):c.2349C>A (p.Ile783=)55764IFT122Benign/Likely benignrs114357746RCV000878459|RCV001567184; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:1515|MedGen:CN5172023129218885129218885CA3:g.129218885C>A-
NM_052989.3(IFT122):c.2375+13C>T55764IFT122Benign-1RCV002097524; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129218924129218924CT129218924-
NM_052989.3(IFT122):c.2383G>A (p.Asp795Asn)55764IFT122Uncertain significancers76007598RCV001062757; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129221561129221561GA3:g.129221561G>A-
NM_052989.3(IFT122):c.2389G>A (p.Ala797Thr)55764IFT122Uncertain significancers376362722RCV001148212; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129221567129221567GA3:g.129221567G>A-
NM_052989.3(IFT122):c.2393G>A (p.Arg798His)55764IFT122Uncertain significancers755677495RCV001148213; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129221571129221571GA3:g.129221571G>A-
NM_052989.3(IFT122):c.2415C>T (p.Arg805=)55764IFT122Benign/Likely benignrs61744218RCV000637018|RCV001568782; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:1515|MedGen:CN5172023129221593129221593CTNC_000003.11:g.129221593C>TClinGen:CA2606513CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.2420C>T (p.Pro807Leu)55764IFT122Uncertain significance-1RCV001883998; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129221598129221598CT129221598-
NM_052989.3(IFT122):c.2433C>T (p.Cys811=)55764IFT122Benign/Likely benignrs141626835RCV000945404; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129221611129221611CTNC_000003.11:g.129221611C>TClinGen:CA2606519CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.2437A>G (p.Thr813Ala)55764IFT122Uncertain significance-1RCV001903678; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129221615129221615AG129221615-
NM_052989.3(IFT122):c.2458A>G (p.Ser820Gly)55764IFT122Uncertain significance-1RCV002040155; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129221636129221636AG129221636-
NM_052989.3(IFT122):c.2482T>C (p.Tyr828His)55764IFT122Uncertain significance-1RCV001903173; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129221660129221660TC129221660-
NM_052989.3(IFT122):c.2523C>T (p.His841=)55764IFT122Uncertain significancers780586191RCV001148214; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129221701129221701CT3:g.129221701C>T-
NM_052989.3(IFT122):c.2536C>T (p.Arg846Cys)55764IFT122Uncertain significance-1RCV001936538; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129221714129221714CT129221714-
NM_052989.3(IFT122):c.2537G>A (p.Arg846His)55764IFT122Uncertain significance-1RCV001996595; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129221715129221715GA129221715-
NM_052989.3(IFT122):c.2548-20T>A55764IFT122Likely benign-1RCV002149017; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129223142129223142TA129223142-
NM_052989.3(IFT122):c.2575G>C (p.Glu859Gln)55764IFT122Uncertain significancers2081966365RCV001148215; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129223189129223189GC3:g.129223189G>C-
NM_052989.3(IFT122):c.2577G>A (p.Glu859=)55764IFT122Conflicting interpretations of pathogenicityrs201077232RCV000275833|RCV000894182; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:1515|MedGen:CN5172023129223191129223191GANC_000003.11:g.129223191G>AClinGen:CA2606575CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.2599C>A (p.Pro867Thr)55764IFT122Uncertain significancers144831946RCV001205580; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129223213129223213CA3:g.129223213C>A-
NM_052989.3(IFT122):c.2600C>T (p.Pro867Leu)55764IFT122Uncertain significancers147499719RCV000333296; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129223214129223214CTNC_000003.11:g.129223214C>TClinGen:CA2606580CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.2625C>T (p.Asn875=)55764IFT122Benignrs76572254RCV000637020|RCV001520077; NMedGen:CN517202|MONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129223239129223239CT3:g.129223239C>TClinGen:CA2606587C0432235 218330 Cranioectodermal dysplasia 1;
NM_052989.3(IFT122):c.2628T>C (p.Asp876=)55764IFT122Likely benignrs750912015RCV000960136; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129223242129223242TC3:g.129223242T>C-
NM_052989.3(IFT122):c.2630G>A (p.Arg877His)55764IFT122Uncertain significance-1RCV001870550; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129223244129223244GA129223244-
NM_052989.3(IFT122):c.2643C>T (p.Ala881=)55764IFT122Uncertain significancers150055466RCV001149766; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129223257129223257CT3:g.129223257C>T-
NM_052989.3(IFT122):c.2650+12A>G55764IFT122Likely benign-1RCV002154953; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129223276129223276AG129223276-
NM_052989.3(IFT122):c.2650+20A>C55764IFT122Likely benign-1RCV002205446; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129223284129223284AC129223284-
NM_052989.3(IFT122):c.2652G>A (p.Ala884=)55764IFT122Likely benignrs201147770RCV000972002|RCV002066425; NMedGen:CN517202|MONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129225253129225253GA3:g.129225253G>A-
NM_052989.3(IFT122):c.2668C>T (p.Arg890Ter)55764IFT122Pathogenic-1RCV001867450; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129225269129225269CT129225269-
NM_052989.3(IFT122):c.2672A>G (p.Gln891Arg)55764IFT122Uncertain significance-1RCV002047750; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129225273129225273AG129225273-
NM_052989.3(IFT122):c.2681C>T (p.Ala894Val)55764IFT122Uncertain significancers376549217RCV000289480; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129225282129225282CTNC_000003.11:g.129225282C>TClinGen:CA2606619CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.2682G>A (p.Ala894=)55764IFT122Benign/Likely benignrs61741773RCV000637019|RCV001591421; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:1515|MedGen:CN5172023129225283129225283GA3:g.129225283G>AClinGen:CA2606620C0432235 218330 Cranioectodermal dysplasia 1;
NM_052989.3(IFT122):c.2715C>T (p.Ala905=)55764IFT122Likely benign-1RCV002175326; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129225316129225316CT129225316-
NM_052989.3(IFT122):c.2721G>A (p.Ala907=)55764IFT122Conflicting interpretations of pathogenicityrs371570973RCV000176430|RCV000328099; NMedGen:CN517202|MONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129225322129225322GA3:g.129225322G>AClinGen:CA242370CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.2730G>A (p.Arg910=)55764IFT122Likely benign-1RCV002200166; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129225331129225331GA129225331-
NM_052989.3(IFT122):c.2749T>G (p.Tyr917Asp)55764IFT122Conflicting interpretations of pathogenicityrs146818399RCV000194823|RCV000724440|RCV001086963; NMedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129225350129225350TG3:g.129225350T>GClinGen:CA209252CN169374 not specified;
NM_052989.3(IFT122):c.2760G>A (p.Met920Ile)55764IFT122Uncertain significance-1RCV002018014; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129225361129225361GA129225361-
NM_052989.3(IFT122):c.2783T>A (p.Ile928Lys)55764IFT122Uncertain significancers747428443RCV001035866; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129225384129225384TA3:g.129225384T>A-
NM_052989.3(IFT122):c.2798C>A (p.Ala933Asp)55764IFT122Uncertain significancers747843863RCV001149767; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129226517129226517CA3:g.129226517C>A-
NM_052989.3(IFT122):c.2840G>A (p.Arg947His)55764IFT122Uncertain significancers760810819RCV000384913; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129226559129226559GANC_000003.11:g.129226559G>AClinGen:CA2606675CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.2878C>T (p.Arg960Cys)55764IFT122Uncertain significance-1RCV002018920; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129226597129226597CT129226597-
NM_052989.3(IFT122):c.2881C>G (p.His961Asp)55764IFT122Uncertain significancers1178500227RCV001149768; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129226600129226600CG3:g.129226600C>G-
NM_052989.3(IFT122):c.2887-3C>T55764IFT122Uncertain significance-1RCV001921063; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129231152129231152CT129231152-
NM_052989.3(IFT122):c.2895G>A (p.Pro965=)55764IFT122Likely benignrs771092154RCV000950522|RCV002066263; NMedGen:CN517202|MONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129231163129231163GA3:g.129231163G>A-
NM_052989.3(IFT122):c.2904C>T (p.Val968=)55764IFT122Likely benign-1RCV002099552; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129231172129231172CT129231172-
NM_052989.3(IFT122):c.2908C>T (p.Arg970Cys)55764IFT122Uncertain significance-1RCV002005795; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129231176129231176CT129231176-
NM_052989.3(IFT122):c.2987+15A>G55764IFT122Likely benign-1RCV002078985; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129231270129231270AG129231270-
NM_052989.3(IFT122):c.2992A>G (p.Ile998Val)55764IFT122Uncertain significance-1RCV001925785; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129233236129233236AG129233236-
NM_052989.3(IFT122):c.3031G>C (p.Ala1011Pro)55764IFT122Uncertain significancers199622112RCV001219619; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129233275129233275GC3:g.129233275G>COMIM:606045.0007
NM_052989.3(IFT122):c.3047G>A (p.Arg1016Gln)55764IFT122Uncertain significance-1RCV001972141; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129233291129233291GA129233291-
NM_052989.3(IFT122):c.3049C>A (p.His1017Asn)55764IFT122Uncertain significancers900548596RCV001149769; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129233293129233293CA3:g.129233293C>A-
NM_052989.3(IFT122):c.3053C>G (p.Ala1018Gly)55764IFT122Uncertain significance-1RCV001878546; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129233297129233297CG129233297-
NM_052989.3(IFT122):c.3056A>G (p.Tyr1019Cys)55764IFT122Uncertain significancers553449191RCV001145443|RCV001586005; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:1515|MedGen:CN5172023129233300129233300AG3:g.129233300A>G-
NM_052989.3(IFT122):c.3068G>A (p.Arg1023His)55764IFT122Uncertain significancers753932809RCV001308475; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129233312129233312GA129233312-
NM_052989.3(IFT122):c.3076_3079delinsG (p.Tyr1026_Ile1027delinsVal)55764IFT122Pathogenicrs2083230922RCV001263242; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129233320129233323TACAG3:g.129233321_129233323delOMIM:606045.0008
NM_052989.3(IFT122):c.3087C>A (p.Ala1029=)55764IFT122Likely benign-1RCV002102432; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129233331129233331CA129233331-
NM_052989.3(IFT122):c.3114T>G (p.Gly1038=)55764IFT122Likely benign-1RCV002206610; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129233358129233358TG129233358-
NM_052989.3(IFT122):c.3127C>T (p.Arg1043Cys)55764IFT122Uncertain significancers555281580RCV001296884; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129233371129233371CT129233371-
NM_052989.3(IFT122):c.3128G>A (p.Arg1043His)55764IFT122Uncertain significancers576743578RCV000283458; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129233372129233372GANC_000003.11:g.129233372G>AClinGen:CA2606787CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.3129C>T (p.Arg1043=)55764IFT122Conflicting interpretations of pathogenicityrs76881473RCV000193036|RCV000878287|RCV001555254; NMedGen:CN169374|MONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:1515|MedGen:CN5172023129233373129233373CT3:g.129233373C>TClinGen:CA206264CN169374 not specified;
NM_052989.3(IFT122):c.3131C>T (p.Ala1044Val)55764IFT122Uncertain significancers147341636RCV000340857; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129233375129233375CTNC_000003.11:g.129233375C>TClinGen:CA2606791CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.3154-9G>A55764IFT122Uncertain significancers759975764RCV000394659; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129234322129234322GANC_000003.11:g.129234322G>AClinGen:CA2606825CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.3191A>G (p.Asn1064Ser)55764IFT122Uncertain significance-1RCV001893670; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129234368129234368AG129234368-
NM_052989.3(IFT122):c.3194C>T (p.Pro1065Leu)55764IFT122Uncertain significancers368574590RCV001145444; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129234371129234371CT3:g.129234371C>T-
NM_052989.3(IFT122):c.3217G>A (p.Val1073Ile)55764IFT122Uncertain significance-1RCV001895854; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129234394129234394GA129234394-
NM_052989.3(IFT122):c.3228C>T (p.Asn1076=)55764IFT122Likely benign-1RCV002159309; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129234405129234405CT129234405-
NM_052989.3(IFT122):c.3232C>T (p.Arg1078Cys)55764IFT122Uncertain significancers771499492RCV000778675; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129234409129234409CTNC_000003.11:g.129234409C>T-
NM_052989.3(IFT122):c.3233G>T (p.Arg1078Leu)55764IFT122Uncertain significance-1RCV001896041; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129234410129234410GT129234410-
NM_052989.3(IFT122):c.3234C>T (p.Arg1078=)55764IFT122Likely benign-1RCV002139534; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129234411129234411CT129234411-
NM_052989.3(IFT122):c.3244A>G (p.Ile1082Val)55764IFT122Benign/Likely benignrs143490747RCV000176772|RCV000983805|RCV001391779; NMedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129234421129234421AG3:g.129234421A>GClinGen:CA202112CN169374 not specified;
NM_052989.3(IFT122):c.3252C>T (p.Ser1084=)55764IFT122Uncertain significancers775568842RCV000286886; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129234429129234429CTNC_000003.11:g.129234429C>TClinGen:CA2606843CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.3263A>G (p.Tyr1088Cys)55764IFT122Uncertain significancers774343448RCV000334995; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129234440129234440AGNC_000003.11:g.129234440A>GClinGen:CA2606846CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.3265+7C>T55764IFT122Benign/Likely benignrs9836202RCV000637016|RCV001590999; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:1515|MedGen:CN5172023129234449129234449CTNC_000003.11:g.129234449C>TClinGen:CA2606850CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.3266-19C>T55764IFT122Likely benign-1RCV002125230; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129236293129236293CT129236293-
NM_052989.3(IFT122):c.3267C>T (p.Asp1089=)55764IFT122Likely benign-1RCV002107664; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129236313129236313CT129236313-
NM_052989.3(IFT122):c.3268G>A (p.Val1090Met)55764IFT122Uncertain significancers147517019RCV000300840|RCV001821036; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:1515|MedGen:CN1693743129236314129236314GANC_000003.11:g.129236314G>AClinGen:CA2606872CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.3303G>T (p.Gly1101=)55764IFT122Benign/Likely benignrs111668739RCV000550756|RCV001731618; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:1515|MedGen:CN5172023129236349129236349GTNC_000003.11:g.129236349G>TClinGen:CA2606876CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.3309T>G (p.Thr1103=)55764IFT122Likely benign-1RCV002100845; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129236355129236355TG129236355-
NM_052989.3(IFT122):c.3327C>A (p.Ser1109=)55764IFT122Likely benign-1RCV002105212; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129236373129236373CA129236373-
NM_052989.3(IFT122):c.3333C>T (p.Ile1111=)55764IFT122Likely benign-1RCV001431427; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129236379129236379CT129236379-
NM_052989.3(IFT122):c.3391+6C>T55764IFT122Uncertain significancers2084139065RCV001147388; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129236443129236443CT3:g.129236443C>T-
NM_052989.3(IFT122):c.3392-20C>T55764IFT122Benign-1RCV002136769; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129237930129237930CT129237930-
NM_052989.3(IFT122):c.3392-5T>G55764IFT122Likely benign-1RCV002175264; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129237945129237945TG129237945-
NM_052989.3(IFT122):c.3400A>G (p.Ile1134Val)55764IFT122Uncertain significance-1RCV001965564; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129237958129237958AG129237958-
NM_052989.3(IFT122):c.3404T>C (p.Leu1135Pro)55764IFT122Uncertain significancers1251905610RCV001147389; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129237962129237962TC3:g.129237962T>C-
NM_052989.3(IFT122):c.3426_3430del (p.Ser1143fs)55764IFT122Pathogenic-1RCV001783467; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129237983129237987GACTCCG129237982-
NM_052989.3(IFT122):c.3432C>T (p.Ile1144=)55764IFT122Benign/Likely benignrs149884307RCV000193866|RCV000878346|RCV001657980; NMedGen:CN169374|MONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:1515|MedGen:CN5172023129237990129237990CT3:g.129237990C>TClinGen:CA207630CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.3446C>T (p.Pro1149Leu)55764IFT122Uncertain significancers373326394RCV001147390; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129238004129238004CT3:g.129238004C>T-
NM_052989.3(IFT122):c.3462G>A (p.Leu1154=)55764IFT122Benignrs150692598RCV000637015; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129238020129238020GA3:g.129238020G>AClinGen:CA2606926C0432235 218330 Cranioectodermal dysplasia 1;
NM_052989.3(IFT122):c.3471+7_3471+34del55764IFT122Likely benign-1RCV002135826; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129238034129238061AGGGTGCCTCTCTGGGTGACCTGCAGGAGA129238033-
NM_052989.3(IFT122):c.3487T>A (p.Phe1163Ile)55764IFT122Uncertain significancers200606803RCV000294633|RCV000794465; NMedGen:CN517202|MONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129238426129238426TANC_000003.11:g.129238426T>AClinGen:CA2606945CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.3504G>C (p.Val1168=)55764IFT122Likely benign-1RCV001495971; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129238443129238443GC129238443-
NM_052989.3(IFT122):c.3521G>A (p.Arg1174His)55764IFT122Uncertain significance-1RCV002006719; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129238460129238460GA129238460-
NM_052989.3(IFT122):c.3533G>A (p.Arg1178His)55764IFT122Likely benignrs149029829RCV000878416|RCV001252861; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:1515|Human Phenotype Ontology:HP:0000252,Human Phenotype Ontology:HP:0001366,Human Phenotype Ontology:HP:0005485,Human Phenotype Ontology:HP:0005489,Human Phenotype Ontology:HP:0005497,MONDO:MONDO3129238472129238472GANC_000003.11:g.129238472G>AClinGen:CA2606960CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.3536G>A (p.Arg1179Gln)55764IFT122Uncertain significance-1RCV002006763; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129238475129238475GA129238475-
NM_052989.3(IFT122):c.3554G>A (p.Arg1185Gln)55764IFT122Uncertain significance-1RCV001920854; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129238493129238493GA129238493-
NM_052989.3(IFT122):c.3570G>T (p.Leu1190=)55764IFT122Uncertain significancers146778076RCV000269212; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129238509129238509GTNC_000003.11:g.129238509G>TClinGen:CA2606967CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.3586del (p.Arg1196fs)55764IFT122Uncertain significance-1RCV001998042; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129238524129238524TCT129238523-
NM_052989.3(IFT122):c.3586C>T (p.Arg1196Cys)55764IFT122Uncertain significance-1RCV001863461; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129238525129238525CT129238525-
NM_052989.3(IFT122):c.3594G>T (p.Leu1198=)55764IFT122Likely benignrs775936679RCV000878518|RCV002064915; NMedGen:CN517202|MONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129238533129238533GT3:g.129238533G>T-
NM_052989.3(IFT122):c.3603C>T (p.Asp1201=)55764IFT122Likely benignrs369729210RCV000886705|RCV002065509; NMedGen:CN517202|MONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129238542129238542CT3:g.129238542C>T-
NM_052989.3(IFT122):c.3636+3A>G55764IFT122Uncertain significancers753825998RCV000326518; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129238578129238578AGNC_000003.11:g.129238578A>GClinGen:CA2606980CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.3636+9C>T55764IFT122Likely benign-1RCV001458743; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129238584129238584CT129238584-
NM_052989.3(IFT122):c.3637-13T>C55764IFT122Likely benign-1RCV002141045; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129239006129239006TC129239006-
NM_052989.3(IFT122):c.3638T>C (p.Met1213Thr)55764IFT122Uncertain significance-1RCV002019446; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129239020129239020TC129239020-
NM_052989.3(IFT122):c.3642C>G (p.Phe1214Leu)55764IFT122Uncertain significance-1RCV001883227; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129239024129239024CG129239024-
NM_052989.3(IFT122):c.3677A>G (p.His1226Arg)55764IFT122Uncertain significancers750154715RCV001059395; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129239059129239059AG3:g.129239059A>G-
NM_052989.3(IFT122):c.3697C>T (p.Arg1233Cys)55764IFT122Uncertain significancers778449955RCV001211987; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129239079129239079CT3:g.129239079C>T-
NM_052989.3(IFT122):c.3698G>A (p.Arg1233His)55764IFT122Uncertain significancers201755623RCV001148315; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129239080129239080GA3:g.129239080G>A-
NM_052989.3(IFT122):c.3711T>C (p.Asp1237=)55764IFT122Uncertain significancers2084594582RCV001148316; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129239093129239093TC3:g.129239093T>C-
NM_052989.3(IFT122):c.3726A>G (p.Ter1242Trp)55764IFT122Pathogenic-1RCV001797987; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129239108129239108AG129239108OMIM:606045.0010
NM_052989.3(IFT122):c.*16C>T55764IFT122Uncertain significancers763993447RCV000364892; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129239124129239124CTNC_000003.11:g.129239124C>TClinGen:CA2607021CN119432 Cranioectodermal dysplasia;
NM_052989.3(IFT122):c.*121G>T55764IFT122Uncertain significancers536919948RCV001148317; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129239229129239229GT3:g.129239229G>T-
NM_052989.3(IFT122):c.*142C>G55764IFT122Uncertain significancers977256057RCV001148318; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129239250129239250CG3:g.129239250C>G-
NM_052989.3(IFT122):c.*241C>G55764IFT122Uncertain significancers2084614746RCV001149879; NMONDO:MONDO:0021093,MedGen:C0432235,OMIM:218330, Orphanet:15153129239349129239349CG3:g.129239349C>G-
MSeqDR Portal