MSeqDR Mitochondrial Disease Portal


 
*:HP: HPO terms, UMDF: 1= Disease, ND: NAMDC terms.
  Most Studied  CPEO, Complex I Deficiency, COXPD1, Leigh, LHON, MELAS, MERRF, Myopathy, SANDO
Disease Browser
Parent Node:
expand
22q11 Deletion Syndrome (D058165)
..Starting node
..expand
DiGeorge Syndrome (D004062)

       Child Nodes:
........expandChromosome 22q11.2 Deletion Syndrome, Distal (C567511)
........expandChromosome 22q11.2 Microduplication Syndrome (C567224)
........expandDigeorge Syndrome-Velocardiofacial Syndrome Complex 2 (C563337)
........expandTakao VCF Syndrome (C566051)



 Sister Nodes: 
..expandDiGeorge Syndrome (D004062) Child4
   

Human Disease MESH is developed by UMLS.
Further data from MedGen, OMIM,ClinVar, CTD
Term ID:3720
Name:DiGeorge Syndrome
Definition:Congenital syndrome characterized by a wide spectrum of characteristics including the absence of the THYMUS and PARATHYROID GLANDS resulting in T-cell immunodeficiency, HYPOCALCEMIA, defects in the outflow tract of the heart, and craniofacial anomalies.
Alternative IDs:DO:DOID:11198|DO:DOID:12583|OMIM:188400|OMIM:192430
ParentIDs:MESH:D058165
TreeNumbers:C05.660.207.103.500 |C14.240.400.021.500 |C14.280.400.044.500 |C15.604.451.249.500 |C16.131.077.019.500 |C16.131.240.400.021.500 |C16.131.260.019.500 |C16.131.482.249.500 |C16.131.621.207.103.500 |C16.320.180.019.500 |C19.642.482.500.500
Synonyms:22q11.2 Deletion Syndrome |22q11.2DS |Autosomal Dominant Opitz G Bbb Syndrome |Autosomal Dominant Opitz G-Bbb Syndrome |Catch22 |CATCH22, INCLUDED |CHROMOSOME 22q11.2 DELETION SYNDROME |Conotruncal Anomaly Face Syndrome |Conotruncal Anomaly Face Syndrome (CTAF) |
Slim Mappings:Cardiovascular disease|Congenital abnormality|Endocrine system disease|Genetic disease (inborn)|Lymphatic disease|Musculoskeletal disease
Reference: MedGen: D004062
MeSH: D004062
OMIM: 188400;
MSeqDR LSDB:  
Genes: TBX1;
Phenotypes
1 HP:0000006Autosomal dominant inheritance
2 HP:0000370Abnormality of the middle ear
3 HP:0000777Abnormality of the thymus
4 HP:0001061AcneHP:0040284
5 HP:0000646Amblyopia
6 HP:0007018Attention deficit hyperactivity disorder
7 HP:0000193Bifid uvula
8 HP:0007302Bipolar affective disorder
NAMDC:  Bipolar disorder
9 HP:0000581Blepharophimosis
10 HP:0001081Cholelithiasis
11 HP:0000175Cleft palate
12 HP:0000750Delayed speech and language development
NAMDC:  Delayed language
13 HP:0025312Esophoria
14 HP:0000565Esotropia
15 HP:0000577Exotropia
16 HP:0100541Femoral hernia
17 HP:0001263Global developmental delay
NAMDC:  Mental retardation
18 HP:0001263Global developmental delay
NAMDC:  Delayed development (evidence of at least one of A through F)
19 HP:0000218High palate
20 HP:0002705High, narrow palate
21 HP:0000126Hydronephrosis
22 HP:0000316Hypertelorism
23 HP:0002901Hypocalcemia
24 HP:0000821Hypothyroidism
NAMDC:  Hypothyroidism
25 HP:0005435Impaired T cell function
26 HP:0000023Inguinal hernia
27 HP:0011611Interrupted aortic arch
28 HP:0000369Low-set ears
29 HP:0000347Micrognathia
30 HP:0001611Nasal speech
31 HP:0001513Obesity
32 HP:0008211Parathyroid agenesis
33 HP:0000860Parathyroid hypoplasia
34 HP:0001643Patent ductus arteriosus
35 HP:0000627Posterior embryotoxon
36 HP:0002719Recurrent infections
37 HP:0000110Renal dysplasia
38 HP:0002627Right aortic arch with mirror image branching
39 HP:0100753SchizophreniaHP:0040284
40 HP:0000647Sclerocornea
41 HP:0002650Scoliosis
42 HP:0001051Seborrheic dermatitis
43 HP:0001250Seizures
NAMDC:  Seizures
44 HP:0012745Short palpebral fissure
45 HP:0000322Short philtrum
46 HP:0004322Short stature
NAMDC:  Short stature (patient¡¯s height is below the 3rd percentile)
47 HP:0001328Specific learning disability
48 HP:0001281Tetany
49 HP:0001636Tetralogy of Fallot
50 HP:0001660Truncus arteriosus
51 HP:0001537Umbilical hernia
52 HP:0000122Unilateral renal agenesis
53 HP:0001629Ventricular septal defect
Disease Causing ClinVar Variants
Variation_NameGeneIDGeneSymbolClinicalSignificancedbSNPRCVaccessionTestedInGTRPhenotypeIDsChromosomeStartStopHGVS_cHGVS_pHGVS_gOtherIDsDisease_ClinVar
Single allele2812GP1BBPathogenic-1RCV001003853; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221847538523764120nana-C1968689 243700 Hyperimmunoglobulin E recurrent infection syndrome, autosomal recessive;
GRCh37/hg19 22q11.21(chr22:18918741-20311922)-1subset of 28 genes: TBX1Pathogenic-1RCV000767628; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221891874120311922nana-
NC_000022.10:g.(?_18900688)_(21351637_?)del-1subset of 43 genes: CRKL:TBX1Pathogenic-1RCV001383366|RCV001871994; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567|MedGen:CN517202221890068821351637nana-1-
GRCh37/hg19 22q11.21(chr22:18901004-21408430)-1subset of 46 genes: CRKL:TBX1Pathogenic-1RCV000767594; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221890100421408430nana-
GRCh37/hg19 22q11.21(chr22:18912231-21465672)x1-1subset of 46 genes: CRKL:TBX1Pathogenic-1RCV000788056; NMONDO:MONDO:0008644,MedGen:C0220704,OMIM:192430, Orphanet:567; MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221891223121465672nana-
GRCh37/hg19 22q11.21(chr22:18912403-21431174)-1subset of 46 genes: CRKL:TBX1Pathogenic-1RCV000767629; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221891240321431174nana-
GRCh37/hg19 22q11.21(chr22:18912403-21431174)-1subset of 46 genes: CRKL:TBX1Pathogenic-1RCV001195119; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221891240321431174nana-
GRCh37/hg19 22q11.21(chr22:18912870-21431174)-1subset of 46 genes: CRKL:TBX1Pathogenic-1RCV000767633; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221891287021431174nana-
GRCh37/hg19 22q11.21(chr22:18922151-21449911)x1-1subset of 46 genes: CRKL:TBX1Pathogenic-1RCV000788058; NMONDO:MONDO:0008644,MedGen:C0220704,OMIM:192430, Orphanet:567; MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221892215121449911nana-
GRCh37/hg19 22q11.21(chr22:18661724-21505417)x1-1subset of 47 genes: CRKL:TBX1Pathogenic-1RCV000856641; NMONDO:MONDO:0008644,MedGen:C0220704,OMIM:192430, Orphanet:567; MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221866172421505417nana-
GRCh37/hg19 22q11.21(chr22:18892575-21460220)-1subset of 47 genes: CRKL:TBX1Pathogenic-1RCV000767687; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221889257521460220nana-
GRCh37/hg19 22q11.21(chr22:18892575-21460220)-1subset of 47 genes: CRKL:TBX1Pathogenic-1RCV000767692; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221889257521460220nana-
Single allele-1subset of 48 genes: CRKL:TBX1Pathogenic-1RCV001391675; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221889388221563420nana-C1968689 243700 Hyperimmunoglobulin E recurrent infection syndrome, autosomal recessive;
Single allele-1subset of 48 genes: CRKL:TBX1Pathogenic-1RCV001391672; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221889388221571027nana-C1968689 243700 Hyperimmunoglobulin E recurrent infection syndrome, autosomal recessive;
GRCh37/hg19 22q11.21(chr22:18900755-21800277)-1subset of 49 genes: CRKL:TBX1Pathogenic-1RCV000767747; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221890075521800277nana-
GRCh37/hg19 22q11.21(chr22:18919477-21800471)x1-1subset of 49 genes: CRKL:TBX1Pathogenic-1RCV000788060; NMONDO:MONDO:0008644,MedGen:C0220704,OMIM:192430, Orphanet:567; MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221891947721800471nana-
GRCh37/hg19 22q11.21(chr22:18631364-21800471)x1-1subset of 51 genes: CRKL:TBX1Pathogenic-1RCV000788057; NMONDO:MONDO:0008644,MedGen:C0220704,OMIM:192430, Orphanet:567; MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221863136421800471nana-
GRCh37/hg19 22q11.21(chr22:18636749-21800471)x1-1subset of 51 genes: CRKL:TBX1Pathogenic-1RCV000788059; NMONDO:MONDO:0008644,MedGen:C0220704,OMIM:192430, Orphanet:567; MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221863674921800471nana-
NC_000022.10:g.(?_18900668)_(19770565_?)del6899TBX1Pathogenic-1RCV000531380; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221890066819770565nana-C0012236 188400 DiGeorge sequence;
NC_000022.10:g.(?_18900668)_(19770565_?)dup6899TBX1Uncertain significance-1RCV001032842; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221890066819770565nana-1-
NC_000022.10:g.(?_18900668)_(19747220_?)del6899TBX1Pathogenic-1RCV001953537; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221890066819747220nana-1-
NC_000022.10:g.(?_18900688)_(21351637_?)dup6899TBX1Uncertain significance-1RCV001952526; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221890068821351637nana-1-
NC_000022.10:g.(?_18910310)_(19770565_?)del6899TBX1Pathogenic-1RCV000630488; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221891031019770565nana-C0012236 188400 DiGeorge sequence;
NC_000022.10:g.(?_18910310)_(19770565_?)dup6899TBX1Uncertain significance-1RCV001031037; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221891031019770565nana-1-
NC_000022.10:g.(?_19163623)_(19770565_?)del6899TBX1Pathogenic-1RCV001032188; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221916362319770565nana-1-
NC_000022.11:g.(?_19722428)_(19975757_?)del6899TBX1Pathogenic-1RCV000708350; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221970995119963280nana-C0012236 188400 DiGeorge sequence;
NC_000022.10:g.(?_19743226)_(19755855_?)dup6899TBX1Uncertain significance-1RCV001346809; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974322619755855nana-1-
NC_000022.10:g.(?_19743226)_(19755855_?)del6899TBX1Pathogenic-1RCV001383367; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974322619755855nana-1-
NC_000022.11:g.(?_19755901)_(19783042_?)del6899TBX1Pathogenic-1RCV000707894; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974342419770565nana-C0012236 188400 DiGeorge sequence;
NC_000022.11:g.(?_19755901)_(19766877_?)del6899TBX1Pathogenic-1RCV000817287; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974342419754400nana-
NC_000022.11:g.(?_19755901)_(19759687_?)del6899TBX1Pathogenic-1RCV001032464; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974342419747210nana-1-
NC_000022.10:g.19743424C>T6899TBX1Benign-1RCV001518487; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974342419743424CT19743424-
NM_080647.1(TBX1):c.-882C>T6899TBX1Benignrs41298629RCV000550229|RCV001512398; NMedGen:CN517202|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974347319743473CT22:g.19743473C>TClinGen:CA322046410C0012236 188400 DiGeorge sequence;
NC_000022.11:g.(?_19755950)_(19759697_?)del6899TBX1Pathogenic-1RCV000793486; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974347319747220nana-
NM_080647.1(TBX1):c.-39C>T6899TBX1Benign/Likely benignrs72646950RCV000423971|RCV000860848|RCV001702464; NMedGen:CN169374|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567|MedGen:CN517202221974712819747128CT22:g.19747128C>TClinGen:CA10102356CN169374 not specified;
NC_000022.10:g.(?_19747167)_(19754390_?)del6899TBX1Pathogenic-1RCV001383368; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974716719754390nana-1-
NM_080647.1(TBX1):c.15C>A (p.Thr5=)6899TBX1Conflicting interpretations of pathogenicityrs764497467RCV000594806|RCV001418836; NMedGen:CN517202|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974718119747181CA22:g.19747181C>AClinGen:CA10102371CN169374 not specified;
NM_080647.1(TBX1):c.15C>T (p.Thr5=)6899TBX1Likely benignrs764497467RCV000876999; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974718119747181CT22:g.19747181C>T-
NM_080647.1(TBX1):c.28A>G (p.Met10Val)6899TBX1Uncertain significancers1936578247RCV001319556; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974719419747194AG19747194-
NM_080647.1(TBX1):c.34+6C>T6899TBX1Uncertain significancers1263773731RCV001318014; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974720619747206CT19747206-
NM_001379200.1(TBX1):c.51C>T (p.Cys17=)6899TBX1Likely benign-1RCV002171500; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974841719748417CT19748417-
NM_001379200.1(TBX1):c.69G>C (p.Thr23=)6899TBX1Likely benign-1RCV002192520; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974843519748435GC19748435-
NM_001379200.1(TBX1):c.70G>A (p.Ala24Thr)6899TBX1Uncertain significance-1RCV001888268; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974843619748436GA19748436-
NM_001379200.1(TBX1):c.89_284del (p.Leu30fs)6899TBX1Pathogenicrs1936634853RCV001247640; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974845119748646CAGCCTGGGGGCCGCGGGGGGCTTCCCGGGCGCCGCGTCGCCCGGCGCCGACCCGTACGGCCCGCGCGAGCCCCCGCCGCCGCCGCCGCGCTACGACCCGTGCGCCGCCGC22:g.19748451_19748549del-
NM_001379200.1(TBX1):c.90G>T (p.Leu30=)6899TBX1Benign/Likely benignrs770754649RCV000877988|RCV001593118; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567|MedGen:CN517202221974845619748456GT22:g.19748456G>T-
NM_001379200.1(TBX1):c.95C>T (p.Ala32Val)6899TBX1Uncertain significancers1415687525RCV001232891; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974846119748461CT22:g.19748461C>T-
NM_001379200.1(TBX1):c.96C>T (p.Ala32=)6899TBX1Likely benignrs931429492RCV000949201|RCV001410362; NMedGen:CN517202|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974846219748462CT22:g.19748462C>T-
NM_001379200.1(TBX1):c.97G>T (p.Ala33Ser)6899TBX1Uncertain significancers1359119941RCV001323967; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974846319748463GT19748463-
NM_001379200.1(TBX1):c.101G>C (p.Gly34Ala)6899TBX1Uncertain significancers1335862067RCV001312405; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974846719748467GC19748467-
NM_001379200.1(TBX1):c.102G>T (p.Gly34=)6899TBX1Benignrs72646952RCV000620113|RCV001513286|RCV001597187; NMedGen:CN230736|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567|MedGen:CN517202221974846819748468GT22:g.19748468G>TClinGen:CA10102384CN230736 Cardiovascular phenotype;
NM_001379200.1(TBX1):c.108C>T (p.Phe36=)6899TBX1Likely benign-1RCV002095357; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974847419748474CT19748474-
NM_001379200.1(TBX1):c.109C>A (p.Pro37Thr)6899TBX1Uncertain significance-1RCV002001232; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974847519748475CA19748475-
NM_001379200.1(TBX1):c.119C>T (p.Ala40Val)6899TBX1Uncertain significance-1RCV001938758; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974848519748485CT19748485-
NM_001379200.1(TBX1):c.124C>T (p.Pro42Ser)6899TBX1Uncertain significance-1RCV001366937; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974849019748490CT19748490-
NM_001379200.1(TBX1):c.127G>T (p.Gly43Cys)6899TBX1Uncertain significancers1936637392RCV001066867; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974849319748493GT22:g.19748493G>T-
NM_001379200.1(TBX1):c.127G>A (p.Gly43Ser)6899TBX1Uncertain significance-1RCV001928154; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974849319748493GA19748493-
NM_001379200.1(TBX1):c.137C>T (p.Pro46Leu)6899TBX1Uncertain significance-1RCV001988946; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974850319748503CT19748503-
NM_001379200.1(TBX1):c.152_232del (p.Glu51_His77del)6899TBX1Uncertain significancers1601282938RCV000788911|RCV001349436; NMedGen:CN517202|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974851619748596GCGAGCCCCCGCCGCCGCCGCCGCGCTACGACCCGTGCGCCGCCGCCGCCCCCGGCGCCCCGGGCCCGCCGCCGCCGCCGCAG22:g.19748516_19748596del-
NM_001379200.1(TBX1):c.158CGC[6] (p.Pro57dup)6899TBX1Conflicting interpretations of pathogenicityrs886038791RCV000242757|RCV000813176; NMedGen:CN230736|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974852219748523CCCCGNC_000022.10:g.19748524CGC[6]ClinGen:CA10587955CN230736 Cardiovascular phenotype;
NM_001379200.1(TBX1):c.173_229del (p.Arg58_Pro76del)6899TBX1Uncertain significancers1569018211RCV001313053; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974852219748578CCCCGCCGCCGCCGCCGCGCTACGACCCGTGCGCCGCCGCCGCCCCCGGCGCCCCGGGC19748521-
NM_001379200.1(TBX1):c.158CGC[3] (p.Pro56_Pro57del)6899TBX1Uncertain significancers886038791RCV000630485; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974852319748528CCCGCCGCNC_000022.10:g.19748524CGC[3]ClinGen:CA322051980C0012236 188400 DiGeorge sequence;
NM_001379200.1(TBX1):c.157C>T (p.Pro53Ser)6899TBX1Uncertain significancers1936638931RCV001048354; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974852319748523CT22:g.19748523C>T-
NM_001379200.1(TBX1):c.167_229del (p.Pro56_Pro76del)6899TBX1Uncertain significance-1RCV002040115; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974852319748585CCCGCCGCCGCCGCCGCGCTACGACCCGTGCGCCGCCGCCGCCCCCGGCGCCCCGGGCCCGCCGC19748522-
NM_001379200.1(TBX1):c.158C>T (p.Pro53Leu)6899TBX1Uncertain significancers1403071771RCV001065771; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974852419748524CT22:g.19748524C>T-
NM_001379200.1(TBX1):c.164C>T (p.Pro55Leu)6899TBX1Uncertain significancers1464455403RCV001223042; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974853019748530CT22:g.19748530C>T-
NM_001379200.1(TBX1):c.182C>T (p.Pro61Leu)6899TBX1Uncertain significance-1RCV001904518; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974854819748548CT19748548-
NM_001379200.1(TBX1):c.183G>T (p.Pro61=)6899TBX1Likely benign-1RCV002134159; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974854919748549GT19748549-
NM_001379200.1(TBX1):c.187GCC[6] (p.Ala65_Ala66dup)6899TBX1Uncertain significancers1032291296RCV001209988; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974855119748552GGCGCCGC22:g.19748551_19748552insCGCCGC-
NM_001379200.1(TBX1):c.187GCC[7] (p.Ala64_Ala66dup)6899TBX1Uncertain significance-1RCV001864251; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974855119748552GGCGCCGCCGC19748551-
NM_001379200.1(TBX1):c.187GCC[5] (p.Ala66dup)6899TBX1Uncertain significance-1RCV001914750; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974855119748552GGCGC19748551-
NM_001379200.1(TBX1):c.195_229del (p.Ala66fs)6899TBX1Pathogenic-1RCV001866498; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974855219748586GCGCCGCCGCCGCCCCCGGCGCCCCGGGCCCGCCGCG19748551-
NM_001379200.1(TBX1):c.186C>A (p.Cys62Ter)6899TBX1Pathogenic-1RCV001880954; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974855219748552CA19748552-
NM_001379200.1(TBX1):c.199_224del (p.Pro67fs)6899TBX1Pathogenicrs1936640897RCV001220575; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974855419748579GCCGCCGCCGCCCCCGGCGCCCCGGGCG22:g.19748554_19748579del-
NM_001379200.1(TBX1):c.194_202del (p.Ala65_Pro67del)6899TBX1Uncertain significancers1601283061RCV000824048; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974855719748565GCCGCCGCCCG22:g.19748557_19748565del-
NM_001379200.1(TBX1):c.197C>T (p.Ala66Val)6899TBX1Uncertain significancers1383914204RCV001289312|RCV001316190; NMedGen:CN517202|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974856319748563CT19748563-
NM_001379200.1(TBX1):c.198C>T (p.Ala66=)6899TBX1Likely benign-1RCV001506664; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974856419748564CT19748564-
NM_001379200.1(TBX1):c.200C>T (p.Pro67Leu)6899TBX1Uncertain significance-1RCV002039410; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974856619748566CT19748566-
NM_001379200.1(TBX1):c.201C>G (p.Pro67=)6899TBX1Likely benignrs1310802135RCV000951831|RCV001417013; NMedGen:CN517202|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974856719748567CG22:g.19748567C>G-
NM_001379200.1(TBX1):c.215CGC[7] (p.Pro75_Pro76dup)6899TBX1Uncertain significancers1009463279RCV000814765; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974857919748580CCCCGCCG22:g.19748579_19748580insCCGCCG-
NM_001379200.1(TBX1):c.215CGC[6] (p.Pro76dup)6899TBX1Benign/Likely benignrs1009463279RCV000874706|RCV001550009; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567|MedGen:CN517202221974857919748580CCCCG22:g.19748579_19748580insCCG-
NM_001379200.1(TBX1):c.218C>T (p.Pro73Leu)6899TBX1Uncertain significancers1936642852RCV001337937; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974858419748584CT19748584-
NM_001379200.1(TBX1):c.220C>T (p.Pro74Ser)6899TBX1Uncertain significancers1936642931RCV001228816; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974858619748586CT22:g.19748586C>T-
NM_001379200.1(TBX1):c.226C>A (p.Pro76Thr)6899TBX1Uncertain significancers1936643083RCV001210426; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974859219748592CA22:g.19748592C>A-
NM_001379200.1(TBX1):c.232G>A (p.Ala78Thr)6899TBX1Conflicting interpretations of pathogenicityrs1028072654RCV000602621|RCV001307830; NMedGen:CN169374|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974859819748598GA22:g.19748598G>AClinGen:CA322052007CN169374 not specified;
NM_001379200.1(TBX1):c.238C>G (p.Pro80Ala)6899TBX1Likely benignrs952890575RCV000618793|RCV001474595|RCV001562331; NMedGen:CN230736|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567|MedGen:CN517202221974860419748604CG22:g.19748604C>GClinGen:CA322052012CN230736 Cardiovascular phenotype;
NM_001379200.1(TBX1):c.239C>G (p.Pro80Arg)6899TBX1Uncertain significancers984681986RCV001053851; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974860519748605CG22:g.19748605C>G-
NM_001379200.1(TBX1):c.246G>T (p.Ala82=)6899TBX1Likely benign-1RCV002081263; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974861219748612GT19748612-
NM_001379200.1(TBX1):c.253G>A (p.Ala85Thr)6899TBX1Uncertain significancers769629385RCV001297510; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974861919748619GA19748619-
NM_001379200.1(TBX1):c.270C>A (p.Ser90Arg)6899TBX1Uncertain significancers1478778776RCV000686904; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974863619748636CA22:g.19748636C>A-C0012236 188400 DiGeorge sequence;
NM_001379200.1(TBX1):c.273C>T (p.Ala91=)6899TBX1Likely benign-1RCV001500765; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974863919748639CT19748639-
NM_001379200.1(TBX1):c.279C>T (p.Ala93=)6899TBX1Likely benign-1RCV002215128; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974864519748645CT19748645-
NM_001379200.1(TBX1):c.284C>G (p.Pro95Arg)6899TBX1Uncertain significancers775295536RCV001060552; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974865019748650CG22:g.19748650C>G-
NM_001379200.1(TBX1):c.284C>T (p.Pro95Leu)6899TBX1Uncertain significancers775295536RCV001056014; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974865019748650CT22:g.19748650C>T-
NM_001379200.1(TBX1):c.286G>C (p.Glu96Gln)6899TBX1Uncertain significancers762629442RCV001315970; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974865219748652GC19748652-
NM_001379200.1(TBX1):c.303C>G (p.Ser101Arg)6899TBX1Uncertain significancers774556411RCV001309763|RCV001751593; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567|MedGen:CN517202221974866919748669CG19748669-
NM_001379200.1(TBX1):c.310G>A (p.Ala104Thr)6899TBX1Uncertain significancers1936647003RCV001227514; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974867619748676GA22:g.19748676G>A-
NM_001379200.1(TBX1):c.318C>G (p.Ala106=)6899TBX1Conflicting interpretations of pathogenicity-1RCV001467116|RCV001762689; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567|MedGen:CN517202221974868419748684CG19748684-
NM_001379200.1(TBX1):c.319A>T (p.Lys107Ter)6899TBX1Pathogenicrs1555895466RCV000630482; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974868519748685AT22:g.19748685A>TClinGen:CA410681602C0012236 188400 DiGeorge sequence;
NM_001379200.1(TBX1):c.324G>A (p.Ala108=)6899TBX1Benignrs72646953RCV000249903|RCV000536853|RCV000993260|RCV001699418; NMedGen:CN230736|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567|MedGen:CN517202|MedGen:CN169374221974869019748690GA22:g.19748690G>AClinGen:CA10102395CN230736 Cardiovascular phenotype;
NM_001379200.1(TBX1):c.326C>T (p.Pro109Leu)6899TBX1Uncertain significance-1RCV002027011; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974869219748692CT19748692-
NM_001379200.1(TBX1):c.328G>T (p.Val110Leu)6899TBX1Uncertain significancers1221938042RCV001349844; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974869419748694GT19748694-
NM_001379200.1(TBX1):c.330GAA[2] (p.Lys112del)6899TBX1Benignrs369050575RCV000547053|RCV001573413; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567|MedGen:CN517202221974869619748698TGAATNC_000022.10:g.19748696GAA[2]ClinGen:CA10102398C0012236 188400 DiGeorge sequence;
NM_001379200.1(TBX1):c.348G>A (p.Val116=)6899TBX1Benignrs148928907RCV000861588|RCV001672965; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567|MedGen:CN517202221974871419748714GA22:g.19748714G>A-
NM_001379200.1(TBX1):c.369A>G (p.Leu123=)6899TBX1Likely benignrs541899328RCV000952221|RCV001450194; NMedGen:CN517202|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974873519748735AG22:g.19748735A>G-
NM_001379200.1(TBX1):c.380C>T (p.Ala127Val)6899TBX1Uncertain significancers1601283489RCV000816743; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974874619748746CT22:g.19748746C>T-
NM_001379200.1(TBX1):c.390C>G (p.Asp130Glu)6899TBX1Uncertain significancers772419022RCV001238145; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974875619748756CG22:g.19748756C>G-
NM_001379200.1(TBX1):c.393G>A (p.Glu131=)6899TBX1Likely benign-1RCV002112202; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974875919748759GA19748759-
NM_001379200.1(TBX1):c.399C>T (p.Asn133=)6899TBX1Likely benign-1RCV001494092; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974876519748765CT19748765-
NM_001379200.1(TBX1):c.412G>A (p.Glu138Lys)6899TBX1Conflicting interpretations of pathogenicityrs1445910672RCV000578422|RCV000702287; NHuman Phenotype Ontology:HP:0001636,MONDO:MONDO:0008542,MedGen:C0039685,OMIM:187500, Orphanet:3303|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974877819748778GA22:g.19748778G>AClinGen:CA410681809C0012236 188400 DiGeorge sequence;
NM_001379200.1(TBX1):c.437+3C>T6899TBX1Uncertain significancers759797253RCV001339404; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974880619748806CT19748806-
NM_001379200.1(TBX1):c.437+3C>G6899TBX1Uncertain significance-1RCV001931217; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974880619748806CG19748806-
NM_001379200.1(TBX1):c.437+10C>T6899TBX1Likely benign-1RCV001393198; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974881319748813CT19748813-
NM_001379200.1(TBX1):c.437+11C>T6899TBX1Benign/Likely benignrs751433208RCV000430622|RCV002063650; NMedGen:CN169374|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221974881419748814CT22:g.19748814C>TClinGen:CA10102417CN169374 not specified;
NM_001379200.1(TBX1):c.438-7C>A6899TBX1Uncertain significancers199903273RCV001246361; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975075719750757CA22:g.19750757C>A-
NM_001379200.1(TBX1):c.438-5C>G6899TBX1Uncertain significancers972035685RCV001063660|RCV001536877; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567|MedGen:CN517202221975075919750759CG22:g.19750759C>G-
NM_001379200.1(TBX1):c.438-5C>A6899TBX1Uncertain significancers972035685RCV001316299; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975075919750759CA19750759-
NM_001379200.1(TBX1):c.438G>A (p.Arg146=)6899TBX1Uncertain significance-1RCV001874272; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975076419750764GA19750764-
NM_001379200.1(TBX1):c.447T>C (p.Phe149=)6899TBX1Benignrs41298814RCV000254087|RCV000597969|RCV000713779|RCV001520748; NMedGen:CN230736|MedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975077319750773TC22:g.19750773T>CClinGen:CA10102441CN230736 Cardiovascular phenotype;
NM_001379200.1(TBX1):c.447T>G (p.Phe149Leu)6899TBX1Uncertain significancers41298814RCV000815812; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975077319750773TG22:g.19750773T>G-
NM_001379200.1(TBX1):c.448C>T (p.Pro150Ser)6899TBX1Uncertain significancers1936725102RCV001066782; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975077419750774CT22:g.19750774C>T-
NM_001379200.1(TBX1):c.471C>T (p.Phe157=)6899TBX1Benign/Likely benignrs139776757RCV000557193|RCV000617164|RCV001644624; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567|MedGen:CN230736|MedGen:CN517202221975079719750797CT22:g.19750797C>TClinGen:CA10102443CN230736 Cardiovascular phenotype;
NM_001379200.1(TBX1):c.472G>A (p.Gly158Ser)6899TBX1Uncertain significance-1RCV001892765; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975079819750798GA19750798-
NM_001379200.1(TBX1):c.480T>A (p.Asp160Glu)6899TBX1Uncertain significance-1RCV001364717; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975080619750806TA19750806-
NM_001379200.1(TBX1):c.489C>T (p.Ala163=)6899TBX1Likely benignrs41298816RCV000861573; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975081519750815CT22:g.19750815C>T-
NM_001379200.1(TBX1):c.503T>C (p.Leu168Pro)6899TBX1Likely pathogenicrs1936727304RCV001249619; NHuman Phenotype Ontology:HP:0001636,MONDO:MONDO:0008542,MedGen:C0039685,OMIM:187500, Orphanet:3303; MONDO:MONDO:0008644,MedGen:C0220704,OMIM:192430, Orphanet:567; MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975082919750829TC22:g.19750829T>C-
NM_001379200.1(TBX1):c.511T>A (p.Phe171Ile)6899TBX1Uncertain significance-1RCV002029764; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975083719750837TA19750837-
NM_001379200.1(TBX1):c.518C>A (p.Pro173Gln)6899TBX1Uncertain significance-1RCV002012799; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975084419750844CA19750844-
NM_001379200.1(TBX1):c.519G>A (p.Pro173=)6899TBX1Benign/Likely benignrs111754814RCV000620254|RCV000713780|RCV001088596; NMedGen:CN230736|MedGen:CN517202|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975084519750845GA22:g.19750845G>AClinGen:CA10102459CN230736 Cardiovascular phenotype;
NM_001379200.1(TBX1):c.523G>A (p.Asp175Asn)6899TBX1Uncertain significancers371125236RCV001316376; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975084919750849GA19750849-
NM_001379200.1(TBX1):c.525C>T (p.Asp175=)6899TBX1Likely benignrs538317719RCV000952398|RCV001452007; NMedGen:CN517202|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975085119750851CT22:g.19750851C>T-
NM_001379200.1(TBX1):c.538C>A (p.Arg180=)6899TBX1Uncertain significancers746384751RCV001352432; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975086419750864CA19750864-
NM_001379200.1(TBX1):c.539+7G>A6899TBX1Likely benign-1RCV001459524; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975087219750872GA19750872-
NM_001379200.1(TBX1):c.539+8_539+10dup6899TBX1Likely benign-1RCV001477073; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975087219750873GGAGT19750872-
NM_001379200.1(TBX1):c.539+7G>C6899TBX1Likely benign-1RCV002195980; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975087219750872GC19750872-
NM_001379200.1(TBX1):c.540-17A>C6899TBX1Benign-1RCV002206629; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975166119751661AC19751661-
NM_001379200.1(TBX1):c.540-16C>T6899TBX1Benign-1RCV001513165; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975166219751662CT19751662-
NM_001379200.1(TBX1):c.540-15C>G6899TBX1Likely benign-1RCV001503145; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975166319751663CG19751663-
NM_001379200.1(TBX1):c.540-13C>T6899TBX1Likely benign-1RCV002145623; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975166519751665CT19751665-
NM_001379200.1(TBX1):c.540-12G>A6899TBX1Likely benign-1RCV002094340; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975166619751666GA19751666-
NM_001379200.1(TBX1):c.540-8C>T6899TBX1Benign/Likely benignrs72646960RCV000860941|RCV001619843; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567|MedGen:CN517202221975167019751670CT22:g.19751670C>T-
NM_001379200.1(TBX1):c.540-7G>A6899TBX1Benign-1RCV001511017; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975167119751671GA19751671-
NM_001379200.1(TBX1):c.543C>T (p.Tyr181=)6899TBX1Likely benign-1RCV001475457; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975168119751681CT19751681-
NM_001379200.1(TBX1):c.544G>A (p.Ala182Thr)6899TBX1Uncertain significancers1342897153RCV001227997; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975168219751682GA22:g.19751682G>A-
NM_001379200.1(TBX1):c.546C>T (p.Ala182=)6899TBX1Likely benign-1RCV001491527; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975168419751684CT19751684-
NM_001379200.1(TBX1):c.549C>T (p.Phe183=)6899TBX1Likely benign-1RCV002088638; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975168719751687CT19751687-
NM_001379200.1(TBX1):c.570G>A (p.Val190=)6899TBX1Uncertain significance-1RCV001910376; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975170819751708GA19751708-
NM_001379200.1(TBX1):c.582C>T (p.Ala194=)6899TBX1Likely benign-1RCV002121066; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975172019751720CT19751720-
NM_001379200.1(TBX1):c.591C>T (p.Ala197=)6899TBX1Likely benign-1RCV002173692; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975172919751729CT19751729-
NM_001379200.1(TBX1):c.594G>A (p.Thr198=)6899TBX1Benign/Likely benignrs138724943RCV000617995|RCV001087768|RCV000878552; NMedGen:CN230736|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567|MedGen:CN517202221975173219751732GA22:g.19751732G>AClinGen:CA10102498CN230736 Cardiovascular phenotype;
NM_001379200.1(TBX1):c.603C>T (p.Arg201=)6899TBX1Likely benignrs761495882RCV000878380; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975174119751741CT22:g.19751741C>T-
NM_001379200.1(TBX1):c.618G>A (p.Pro206=)6899TBX1Uncertain significancers1177792242RCV001234323; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975175619751756GA22:g.19751756G>A-
NM_001379200.1(TBX1):c.624G>A (p.Ser208=)6899TBX1Likely benignrs754390970RCV000913776|RCV001494807; NMedGen:CN517202|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975176219751762GA22:g.19751762G>A-
NM_001379200.1(TBX1):c.632A>G (p.Lys211Arg)6899TBX1Uncertain significance-1RCV001944947; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975177019751770AG19751770-
NM_001379200.1(TBX1):c.636C>T (p.Gly212=)6899TBX1Uncertain significancers779173153RCV000820840; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975177419751774CT22:g.19751774C>T-
NM_001379200.1(TBX1):c.637G>A (p.Ala213Thr)6899TBX1Uncertain significancers748232668RCV001317076; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975177519751775GA19751775-
NM_001379200.1(TBX1):c.646A>G (p.Met216Val)6899TBX1Uncertain significancers1224140312RCV001221091; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975178419751784AG22:g.19751784A>G-
NM_001379200.1(TBX1):c.654A>G (p.Gln218=)6899TBX1Likely benign-1RCV001462437; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975179219751792AG19751792-
NM_001379200.1(TBX1):c.657C>T (p.Ile219=)6899TBX1Likely benignrs141186024RCV000620346|RCV000877858|RCV001476384; NMedGen:CN230736|MedGen:CN517202|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975179519751795CT22:g.19751795C>TClinGen:CA10102513CN230736 Cardiovascular phenotype;
NM_001379200.1(TBX1):c.658G>A (p.Val220Met)6899TBX1Uncertain significance-1RCV001932866; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975179619751796GA19751796-
NM_001379200.1(TBX1):c.663C>T (p.Ser221=)6899TBX1Likely benign-1RCV001407628; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975180119751801CT19751801-
NM_001379200.1(TBX1):c.666C>T (p.Phe222=)6899TBX1Likely benign-1RCV002154642; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975180419751804CT19751804-
NM_001379200.1(TBX1):c.691C>T (p.Leu231=)6899TBX1Benignrs2301558RCV000251932|RCV000454719|RCV000713781|RCV001520749; NMedGen:CN230736|MedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975182919751829CT22:g.19751829C>TClinGen:CA10102521CN230736 Cardiovascular phenotype;
NM_001379200.1(TBX1):c.699C>T (p.Asp233=)6899TBX1Likely benign-1RCV001452946; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975183719751837CT19751837-
NM_001379200.1(TBX1):c.700G>A (p.Asp234Asn)6899TBX1Uncertain significancers765827737RCV001202423; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975183819751838GA22:g.19751838G>A-
NM_001379200.1(TBX1):c.702C>T (p.Asp234=)6899TBX1Likely benign-1RCV002126359; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975184019751840CT19751840-
NM_001379200.1(TBX1):c.705C>T (p.Asn235=)6899TBX1Benign/Likely benignrs149453540RCV000861074|RCV001712798; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567|MedGen:CN517202221975184319751843CT22:g.19751843C>T-
NM_001379200.1(TBX1):c.706G>A (p.Gly236Ser)6899TBX1Uncertain significance-1RCV001993014; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975184419751844GA19751844-
NM_001379200.1(TBX1):c.711C>T (p.His237=)6899TBX1Uncertain significancers200021644RCV000618363|RCV001062273; NMedGen:CN230736|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975184919751849CTNC_000022.10:g.19751849C>TClinGen:CA10102527CN230736 Cardiovascular phenotype;
NM_001379200.1(TBX1):c.711+1G>A6899TBX1Likely pathogenic-1RCV002000474; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975185019751850GA19751850-
NM_001379200.1(TBX1):c.711+3G>A6899TBX1Uncertain significance-1RCV001930671; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975185219751852GA19751852-
NM_001379200.1(TBX1):c.711+7G>A6899TBX1Likely benign-1RCV001495325; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975185619751856GA19751856-
NM_001379200.1(TBX1):c.740A>G (p.Gln247Arg)6899TBX1Uncertain significance-1RCV001890596; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975250919752509AG19752509-
NM_001379200.1(TBX1):c.768C>T (p.Asp256=)6899TBX1Likely benign-1RCV002092393; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975253719752537CT19752537-
NM_001379200.1(TBX1):c.780T>C (p.Asp260=)6899TBX1Likely benign-1RCV002194481; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975254919752549TC19752549-
NM_001379200.1(TBX1):c.784G>C (p.Glu262Gln)6899TBX1Uncertain significancers553807294RCV001313205; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975255319752553GC19752553-
NM_001379200.1(TBX1):c.794_798dup (p.Glu267fs)6899TBX1Pathogenic-1RCV001908785; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975256119752562TTGCCGA19752561-
NM_001379200.1(TBX1):c.813C>T (p.Thr271=)6899TBX1Likely benign-1RCV002159767; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975258219752582CT19752582-
NM_001379200.1(TBX1):c.822C>T (p.Phe274=)6899TBX1Likely benign-1RCV002188429; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975259119752591CT19752591-
NM_001379200.1(TBX1):c.823G>A (p.Glu275Lys)6899TBX1Conflicting interpretations of pathogenicityrs144848597RCV001202887|RCV001570784|RCV002069302; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567|MedGen:CN517202|Human Phenotype Ontology:HP:0001636,MONDO:MONDO:0008542,MedGen:C0039685,OMIM:187500, Orphanet:3303; MONDO:MONDO:0016581,MedGen:C1857586,OMIM:217095, Orphanet:2445, Orphanet:3384,Or221975259219752592GA22:g.19752592G>A-
NM_001379200.1(TBX1):c.831A>T (p.Thr277=)6899TBX1Likely benign-1RCV001488370; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975260019752600AT19752600-
NM_001379200.1(TBX1):c.840C>T (p.Thr280=)6899TBX1Benign/Likely benignrs61730282RCV000535518|RCV001080365; NMedGen:CN517202|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975260919752609CT22:g.19752609C>TClinGen:CA10102567C0012236 188400 DiGeorge sequence;
NM_001379200.1(TBX1):c.848C>G (p.Thr283Ser)6899TBX1Uncertain significance-1RCV002039341; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975261719752617CG19752617-
NM_001379200.1(TBX1):c.867+11G>A6899TBX1Likely benign-1RCV002193504; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975264719752647GA19752647-
NM_001379200.1(TBX1):c.868-20T>G6899TBX1Likely benign-1RCV002207753; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975326119753261TG19753261-
NM_001379200.1(TBX1):c.868-19C>T6899TBX1Likely benign-1RCV002148417; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975326219753262CT19753262-
NM_001379200.1(TBX1):c.868-11C>T6899TBX1Likely benign-1RCV002136298; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975327019753270CT19753270-
NM_001379200.1(TBX1):c.881del (p.Lys294fs)6899TBX1Pathogenic-1RCV001944034; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975329319753293CAC19753292-
NM_001379200.1(TBX1):c.913C>A (p.Arg305=)6899TBX1Conflicting interpretations of pathogenicityrs751339103RCV000515043|RCV002060206; NMedGen:CN517202|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975332619753326CA22:g.19753326C>AClinGen:CA10102609CN517202 not provided;
NM_001379200.1(TBX1):c.915G>C (p.Arg305=)6899TBX1Likely benign-1RCV001445723; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975332819753328GC19753328-
NM_001379200.1(TBX1):c.922G>C (p.Asp308His)6899TBX1Uncertain significancers750330152RCV001227081; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975333519753335GC22:g.19753335G>C-
NM_001379200.1(TBX1):c.925C>A (p.Pro309Thr)6899TBX1Uncertain significancers1936813859RCV001326134; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975333819753338CA19753338-
NM_001379200.1(TBX1):c.930G>A (p.Glu310=)6899TBX1Uncertain significance-1RCV001967419; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975334319753343GA19753343-
NM_001379200.1(TBX1):c.935+13C>T6899TBX1Likely benign-1RCV002103633; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975336119753361CT19753361-
NM_001379200.1(TBX1):c.935+16C>A6899TBX1Uncertain significance-1RCV001879098; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975336419753364CA19753364-
NM_001379200.1(TBX1):c.935+17GA[2]6899TBX1Uncertain significance-1RCV002027258; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975336519753366CGAC19753364-
NM_001379200.1(TBX1):c.936-11C>A6899TBX1Likely benign-1RCV001596491|RCV002070471; NMedGen:CN517202|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975341419753414CA19753414-
NM_001379200.1(TBX1):c.936-9del6899TBX1Benign-1RCV002084682; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975341419753414TCT19753413-
NM_001379200.1(TBX1):c.936-8G>T6899TBX1Likely benignrs753380966RCV000875355; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975341719753417GT22:g.19753417G>T-
NM_001379200.1(TBX1):c.936-8G>A6899TBX1Likely benign-1RCV002089724; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975341719753417GA19753417-
NM_001379200.1(TBX1):c.941G>A (p.Arg314Gln)6899TBX1Likely benign-1RCV001442626; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975343019753430GA19753430-
NM_001379200.1(TBX1):c.954C>T (p.Pro318=)6899TBX1Benign/Likely benignrs201607803RCV000618199|RCV000877082|RCV001551812; NMedGen:CN230736|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567|MedGen:CN517202221975344319753443CTNC_000022.10:g.19753443C>TClinGen:CA10102639CN230736 Cardiovascular phenotype;
NM_001379200.1(TBX1):c.955G>A (p.Gly319Ser)6899TBX1Benignrs41298838RCV000008000|RCV000618981|RCV000828677; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567|MedGen:CN230736|MedGen:CN517202221975344419753444GA22:g.19753444G>AClinGen:CA254215,UniProtKB:O43435#VAR_034545,OMIM:602054.0002CN230736 Cardiovascular phenotype;
NM_001379200.1(TBX1):c.955G>T (p.Gly319Cys)6899TBX1Uncertain significancers41298838RCV000534155; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975344419753444GT22:g.19753444G>TClinGen:CA410683778C0012236 188400 DiGeorge sequence;
NM_001379200.1(TBX1):c.960A>G (p.Ala320=)6899TBX1Benignrs41298840RCV000248275|RCV000593555|RCV000713782|RCV001520750; NMedGen:CN230736|MedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975344919753449AG22:g.19753449A>GClinGen:CA10102642CN230736 Cardiovascular phenotype;
NM_001379200.1(TBX1):c.961C>T (p.Leu321=)6899TBX1Likely benignrs745951558RCV000946118|RCV001395749; NMedGen:CN517202|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975345019753450CT22:g.19753450C>T-
NM_001379200.1(TBX1):c.974G>C (p.Ser325Thr)6899TBX1Uncertain significance-1RCV002035872; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975346319753463GC19753463-
NM_001379200.1(TBX1):c.978C>T (p.Ala326=)6899TBX1Likely benign-1RCV002113569; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975346719753467CT19753467-
NM_001379200.1(TBX1):c.985C>T (p.Arg329Cys)6899TBX1Uncertain significance-1RCV002019264; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975347419753474CT19753474-
NM_001379200.1(TBX1):c.986G>C (p.Arg329Pro)6899TBX1Uncertain significance-1RCV001904031; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975347519753475GC19753475-
NM_001379200.1(TBX1):c.1003G>T (p.Ala335Ser)6899TBX1Uncertain significance-1RCV002021642; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975349219753492GT19753492-
NM_001379200.1(TBX1):c.1008C>G (p.Ser336=)6899TBX1Likely benign-1RCV001459952; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975349719753497CG19753497-
NM_001379200.1(TBX1):c.1010C>T (p.Pro337Leu)6899TBX1Uncertain significance-1RCV001362215; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975349919753499CT19753499-
NM_001379200.1(TBX1):c.1023C>T (p.Ser341=)6899TBX1Likely benign-1RCV001423990; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975351219753512CT19753512-
NM_001379200.1(TBX1):c.1024G>T (p.Gly342Cys)6899TBX1Uncertain significancers1294861011RCV001237604; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975351319753513GT22:g.19753513G>T-
NM_001379200.1(TBX1):c.1025G>A (p.Gly342Asp)6899TBX1Uncertain significance-1RCV002022846; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975351419753514GA19753514-
NM_001379200.1(TBX1):c.1026C>A (p.Gly342=)6899TBX1Likely benign-1RCV001391862; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975351519753515CA19753515-
NM_001379200.1(TBX1):c.1036+4G>T6899TBX1Uncertain significance-1RCV001988590; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975352919753529GT19753529-
NM_001379200.1(TBX1):c.1036+17G>A6899TBX1Likely benign-1RCV002103817; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975354219753542GA19753542-
NM_001379200.1(TBX1):c.1036+18G>C6899TBX1Likely benign-1RCV002130221; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975354319753543GC19753543-
NM_001379200.1(TBX1):c.1037-18C>T6899TBX1Likely benign-1RCV001939615; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975389419753894CT19753894-
NM_001379200.1(TBX1):c.1037-15C>T6899TBX1Likely benign-1RCV001552199|RCV002072050; NMedGen:CN517202|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975389719753897CT19753897-
NM_001379200.1(TBX1):c.1037-7_1037-6del6899TBX1Uncertain significancers1037168604RCV000993258|RCV001210492; NMedGen:CN517202|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975390219753903CCTC22:g.19753902_19753903del-
NM_001379200.1(TBX1):c.1037-10C>T6899TBX1Likely benign-1RCV001493897; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975390219753902CT19753902-
NM_001379200.1(TBX1):c.1037-1G>A6899TBX1Uncertain significancers1936844527RCV001210656; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975391119753911GA22:g.19753911G>A-
NM_001379200.1(TBX1):c.1041G>T (p.Ala347=)6899TBX1Likely benign-1RCV002168023; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975391619753916GT19753916-
NM_001379200.1(TBX1):c.1046A>T (p.Glu349Val)6899TBX1Uncertain significancers751917634RCV000693822; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975392119753921AT22:g.19753921A>T-C0012236 188400 DiGeorge sequence;
NM_001379200.1(TBX1):c.1052G>A (p.Arg351Gln)6899TBX1Benign/Likely benignrs549715785RCV000619076|RCV001514355|RCV001558761; NMedGen:CN230736|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567|MedGen:CN517202221975392719753927GA22:g.19753927G>AClinGen:CA10102659CN230736 Cardiovascular phenotype;
NM_001379200.1(TBX1):c.1063C>T (p.Gln355Ter)6899TBX1Pathogenic-1RCV001992593; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975393819753938CT19753938-
NM_001379200.1(TBX1):c.1066C>A (p.Arg356Ser)6899TBX1Uncertain significancers1046395605RCV001229638; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975394119753941CA22:g.19753941C>A-
NM_001379200.1(TBX1):c.1069G>T (p.Asp357Tyr)6899TBX1Uncertain significancers1407996016RCV001309123; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975394419753944GT19753944-
NM_001379200.1(TBX1):c.1073C>G (p.Ala358Gly)6899TBX1Uncertain significancers1452987245RCV001281027; NMONDO:MONDO:0016581,MedGen:C1857586,OMIM:217095, Orphanet:2445, Orphanet:3384, Orphanet:3426; MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567; MONDO:MONDO:0008644,MedGen:C0220704,OMIM:192430, Orphanet:567; Human Phenotype Ontology:HP:0001636,MONDO221975394819753948CG22:g.19753948C>G-
NM_001379200.1(TBX1):c.1076G>T (p.Gly359Val)6899TBX1Uncertain significance-1RCV002016260; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975395119753951GT19753951-
NM_001379200.1(TBX1):c.1077C>T (p.Gly359=)6899TBX1Uncertain significancers1443686047RCV001217085; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975395219753952CT22:g.19753952C>T-
NM_001379200.1(TBX1):c.1082C>T (p.Pro361Leu)6899TBX1Uncertain significancers1001921296RCV000695042|RCV001756199; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567|MedGen:CN517202221975395719753957CTNC_000022.10:g.19753957C>T-C0012236 188400 DiGeorge sequence;
NM_001379200.1(TBX1):c.1085C>T (p.Ala362Val)6899TBX1Uncertain significancers569581176RCV001054550; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975396019753960CT22:g.19753960C>T-
NM_001379200.1(TBX1):c.1085C>G (p.Ala362Gly)6899TBX1Uncertain significance-1RCV001948725; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975396019753960CG19753960-
NM_001379200.1(TBX1):c.1086A>G (p.Ala362=)6899TBX1Benignrs13054377RCV000249855|RCV001515129|RCV001618491|RCV001700022; NMedGen:CN230736|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567|MedGen:CN517202|MedGen:CN169374221975396119753961AGNC_000022.10:g.19753961A>GClinGen:CA10102661CN230736 Cardiovascular phenotype;
NM_001379200.1(TBX1):c.1090C>T (p.Leu364Phe)6899TBX1Uncertain significance-1RCV002023353; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975396519753965CT19753965-
NM_001379200.1(TBX1):c.1096del (p.Asp366fs)6899TBX1Pathogenic-1RCV001386759; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975396819753968CGC19753967-
NM_001379200.1(TBX1):c.1099C>G (p.Pro367Ala)6899TBX1Uncertain significance-1RCV001976700; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975397419753974CG19753974-
NM_001379200.1(TBX1):c.1101G>A (p.Pro367=)6899TBX1Likely benign-1RCV001413486; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975397619753976GA19753976-
NM_001379200.1(TBX1):c.1103C>A (p.Ala368Glu)6899TBX1Uncertain significancers1157536437RCV000794255; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975397819753978CA22:g.19753978C>A-
NM_001379200.1(TBX1):c.1105C>T (p.His369Tyr)6899TBX1Uncertain significancers1936848458RCV001297187; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975398019753980CT19753980-
NM_001379200.1(TBX1):c.1117del (p.Leu373fs)6899TBX1Pathogenic-1RCV001383639; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975399219753992GCG19753991-
NM_001379200.1(TBX1):c.1125C>T (p.Ala375=)6899TBX1Likely benign-1RCV002113744; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975400019754000CT19754000-
NM_001379200.1(TBX1):c.1127G>A (p.Arg376Gln)6899TBX1Uncertain significance-1RCV001362817; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975400219754002GA19754002-
NM_001379200.1(TBX1):c.1135A>G (p.Ser379Gly)6899TBX1Uncertain significance-1RCV001367053; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975401019754010AG19754010-
NM_001379200.1(TBX1):c.1138C>T (p.Pro380Ser)6899TBX1Uncertain significance-1RCV002019282; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975401319754013CT19754013-
NM_001379200.1(TBX1):c.1142C>T (p.Ser381Leu)6899TBX1Uncertain significancers1936850184RCV001235789; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975401719754017CT22:g.19754017C>T-
NM_001379200.1(TBX1):c.1145T>C (p.Leu382Pro)6899TBX1Uncertain significance-1RCV002034308; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975402019754020TC19754020-
NM_001379200.1(TBX1):c.1149_1150insAGGGCCGGC (p.Gly384_Ala385insArgAlaGly)6899TBX1Uncertain significancers1192078635RCV001064912; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975402319754024CCCAGGGCCGG22:g.19754023_19754024insCAGGGCCGG-
NM_001379200.1(TBX1):c.1148C>A (p.Pro383His)6899TBX1Uncertain significance-1RCV001962276; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975402319754023CA19754023-
NM_001379200.1(TBX1):c.1150_1152delinsAGGGCCGGCGGC (p.Gly384_Ala385insArgAlaGly)6899TBX1Uncertain significancers1555896709RCV000621456|RCV000798611; NMedGen:CN230736|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975402519754027GGGAGGGCCGGCGGCNC_000022.10:g.19754025_19754027delinsAGGGCCGGCGGCClinGen:CA658799489CN230736 Cardiovascular phenotype;
NM_001379200.1(TBX1):c.1153GCCGGCGGC[3] (p.385AGG[3])6899TBX1Likely benignrs1288296547RCV000878950; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975402719754028GGGCCGGCGGC22:g.19754027_19754028insGCCGGCGGC-
NM_001379200.1(TBX1):c.1152G>C (p.Gly384=)6899TBX1Likely benign-1RCV001484200; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975402719754027GC19754027-
NM_001379200.1(TBX1):c.1153GCCGGCGGC[1] (p.385AGG[1])6899TBX1Uncertain significance-1RCV001370493; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975402819754036GGCCGGCGGCG19754027-
NM_001379200.1(TBX1):c.1159G>A (p.Gly387Ser)6899TBX1Conflicting interpretations of pathogenicityrs565927787RCV000621315|RCV000877083|RCV001584433; NMedGen:CN230736|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567|MedGen:CN517202221975403419754034GA22:g.19754034G>AClinGen:CA10102662CN230736 Cardiovascular phenotype;
NM_001379200.1(TBX1):c.1160G>A (p.Gly387Asp)6899TBX1Uncertain significance-1RCV002021186; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975403519754035GA19754035-
NM_001379200.1(TBX1):c.1161C>T (p.Gly387=)6899TBX1Likely benignrs941116789RCV000630484; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975403619754036CT22:g.19754036C>TClinGen:CA322058189C0012236 188400 DiGeorge sequence;
NM_001379200.1(TBX1):c.1167C>A (p.Gly389=)6899TBX1Likely benign-1RCV002202438; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975404219754042CA19754042-
NM_001379200.1(TBX1):c.1168G>C (p.Gly390Arg)6899TBX1Uncertain significancers1408610906RCV001314054; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975404319754043GC19754043-
NM_001379200.1(TBX1):c.1170C>T (p.Gly390=)6899TBX1Likely benign-1RCV002112303; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975404519754045CT19754045-
NM_001379200.1(TBX1):c.1177C>T (p.Pro393Ser)6899TBX1Uncertain significancers1936852709RCV001217144; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975405219754052CT22:g.19754052C>T-
NM_001379200.1(TBX1):c.1178C>A (p.Pro393Gln)6899TBX1Likely benignrs918788695RCV000983966; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975405319754053CA22:g.19754053C>A-
NM_001379200.1(TBX1):c.1179_1180insAG (p.Leu394fs)6899TBX1Pathogenicrs1936852915RCV001332793; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975405319754054CCGA19754053-
NM_001379200.1(TBX1):c.1186G>C (p.Gly396Arg)6899TBX1Uncertain significance-1RCV001976372; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975406119754061GC19754061-
NM_001379200.1(TBX1):c.1188C>T (p.Gly396=)6899TBX1Uncertain significance-1RCV002050564; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975406319754063CT19754063-
NM_001379200.1(TBX1):c.1189G>A (p.Ala397Thr)6899TBX1Uncertain significance-1RCV001874860; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975406419754064GA19754064-
NM_001379200.1(TBX1):c.1195G>A (p.Gly399Arg)6899TBX1Uncertain significancers1196576937RCV001045103; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975407019754070GA22:g.19754070G>A-
NM_001379200.1(TBX1):c.1196G>A (p.Gly399Glu)6899TBX1Uncertain significancers1274082696RCV000685242; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975407119754071GA22:g.19754071G>A-C0012236 188400 DiGeorge sequence;
NM_001379200.1(TBX1):c.1196G>C (p.Gly399Ala)6899TBX1Uncertain significance-1RCV002041981; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975407119754071GC19754071-
NM_001379200.1(TBX1):c.1198G>C (p.Gly400Arg)6899TBX1Uncertain significance-1RCV001890122; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975407319754073GC19754073-
NM_001379200.1(TBX1):c.1199G>C (p.Gly400Ala)6899TBX1Uncertain significance-1RCV001372947; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975407419754074GC19754074-
NM_001379200.1(TBX1):c.1202G>A (p.Arg401Gln)6899TBX1Uncertain significance-1RCV001988416; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975407719754077GA19754077-
NM_001379200.1(TBX1):c.1204C>T (p.Pro402Ser)6899TBX1Uncertain significance-1RCV001937316; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975407919754079CT19754079-
NM_001379200.1(TBX1):c.1205C>G (p.Pro402Arg)6899TBX1Uncertain significancers1936854828RCV001226054; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975408019754080CG22:g.19754080C>G-
NM_001379200.1(TBX1):c.1208G>A (p.Ser403Asn)6899TBX1Uncertain significance-1RCV002048126; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975408319754083GA19754083-
NM_001379200.1(TBX1):c.1212C>T (p.Pro404=)6899TBX1Likely benign-1RCV002118483; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975408719754087CT19754087-
NM_001379200.1(TBX1):c.1214C>T (p.Pro405Leu)6899TBX1Uncertain significancers746812421RCV000990374|RCV001819695; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567|MedGen:CN169374221975408919754089CT22:g.19754089C>T-
NM_001379200.1(TBX1):c.1214C>A (p.Pro405Gln)6899TBX1Likely benign-1RCV001409472; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975408919754089CA19754089-
NM_001379200.1(TBX1):c.1216A>C (p.Asn406His)6899TBX1Benignrs72646967RCV000245695|RCV000598010|RCV000713776|RCV001520751; NMedGen:CN230736|MedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975409119754091ACNC_000022.10:g.19754091A>CClinGen:CA10102670CN230736 Cardiovascular phenotype;
NM_001379200.1(TBX1):c.1217A>G (p.Asn406Ser)6899TBX1Uncertain significancers1936855908RCV001346410; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975409219754092AG19754092-
NM_001379200.1(TBX1):c.1221C>T (p.Pro407=)6899TBX1Likely benignrs1305509653RCV000875923; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975409619754096CT22:g.19754096C>T-
NM_001379200.1(TBX1):c.1221C>A (p.Pro407=)6899TBX1Uncertain significance-1RCV001361055; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975409619754096CA19754096-
NM_001379200.1(TBX1):c.1231C>T (p.Leu411=)6899TBX1Likely benign-1RCV002109503; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975410619754106CT19754106-
NM_001379200.1(TBX1):c.1238C>G (p.Ala413Gly)6899TBX1Benign/Likely benignrs557935727RCV000874653|RCV001557378; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567|MedGen:CN517202221975411319754113CG22:g.19754113C>G-
NM_001379200.1(TBX1):c.1239G>A (p.Ala413=)6899TBX1Likely benign-1RCV002123130; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975411419754114GA19754114-
NM_001379200.1(TBX1):c.1240C>T (p.Pro414Ser)6899TBX1Conflicting interpretations of pathogenicityrs757648761RCV000900570|RCV001487091; NMedGen:CN517202|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975411519754115CT22:g.19754115C>T-
NM_001379200.1(TBX1):c.1242C>T (p.Pro414=)6899TBX1Benignrs200135498RCV000860983; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975411719754117CT22:g.19754117C>T-
NM_001379200.1(TBX1):c.1242C>G (p.Pro414=)6899TBX1Likely benign-1RCV001479529; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975411719754117CG19754117-
NM_001379200.1(TBX1):c.1244G>A (p.Gly415Asp)6899TBX1Benign/Likely benignrs756543718RCV000543847|RCV001445700|RCV001662533; NMedGen:CN517202|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567|MedGen:CN169374221975411919754119GA22:g.19754119G>AClinGen:CA10102679C0012236 188400 DiGeorge sequence;
NM_001379200.1(TBX1):c.1245C>T (p.Gly415=)6899TBX1Likely benignrs780344405RCV000558528|RCV001432298; NMedGen:CN517202|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975412019754120CT22:g.19754120C>TClinGen:CA10102680C0012236 188400 DiGeorge sequence;
NM_001379200.1(TBX1):c.1248A>G (p.Ala416=)6899TBX1Likely benign-1RCV001441792; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975412319754123AG19754123-
NM_001379200.1(TBX1):c.1250C>T (p.Ser417Leu)6899TBX1Uncertain significance-1RCV001973634; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975412519754125CT19754125-
NM_001379200.1(TBX1):c.1251G>A (p.Ser417=)6899TBX1Likely benign-1RCV001481845; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975412619754126GA19754126-
NM_001379200.1(TBX1):c.1251G>C (p.Ser417=)6899TBX1Likely benign-1RCV002164616; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975412619754126GC19754126-
NM_001379200.1(TBX1):c.1252G>C (p.Glu418Gln)6899TBX1Uncertain significancers776268518RCV001057736; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975412719754127GC22:g.19754127G>C-
NM_001379200.1(TBX1):c.1253A>G (p.Glu418Gly)6899TBX1Conflicting interpretations of pathogenicityrs745858331RCV000983828|RCV001400138; NMedGen:CN517202|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975412819754128AG22:g.19754128A>G-
NM_001379200.1(TBX1):c.1261C>A (p.His421Asn)6899TBX1Uncertain significancers985907694RCV000700934; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975413619754136CA22:g.19754136C>A-C0012236 188400 DiGeorge sequence;
NM_001379200.1(TBX1):c.1269C>T (p.His423=)6899TBX1Likely benign-1RCV001478139; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975414419754144CT19754144-
NM_001379200.1(TBX1):c.1271C>G (p.Pro424Arg)6899TBX1Uncertain significancers767961877RCV001343750; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975414619754146CG19754146-
NM_001379200.1(TBX1):c.1273T>C (p.Tyr425His)6899TBX1Uncertain significancers1243986502RCV001346718; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975414819754148TC19754148-
NM_001379200.1(TBX1):c.1275C>T (p.Tyr425=)6899TBX1Likely benign-1RCV001422643; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975415019754150CT19754150-
NM_001379200.1(TBX1):c.1280A>T (p.Tyr427Phe)6899TBX1Uncertain significancers1601294456RCV000815029; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975415519754155AT22:g.19754155A>T-
NM_001379200.1(TBX1):c.1286C>T (p.Ala429Val)6899TBX1Uncertain significance-1RCV002043829; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975416119754161CT19754161-
NM_001379200.1(TBX1):c.1295A>G (p.Tyr432Cys)6899TBX1Uncertain significancers1163307521RCV001220294; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975417019754170AG22:g.19754170A>G-
NM_001379200.1(TBX1):c.1297G>A (p.Asp433Asn)6899TBX1Uncertain significancers758517884RCV001301760; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975417219754172GA19754172-
NM_001379200.1(TBX1):c.1297G>T (p.Asp433Tyr)6899TBX1Uncertain significancers758517884RCV001302949; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975417219754172GT19754172-
NM_001379200.1(TBX1):c.1302_1304del (p.Tyr435del)6899TBX1Uncertain significancers1936861633RCV001044339; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975417619754178CACTC22:g.19754176_19754178del-
NM_001379200.1(TBX1):c.1304A>G (p.Tyr435Cys)6899TBX1Uncertain significancers1386894564RCV001347685; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975417919754179AG19754179-
NM_001379200.1(TBX1):c.1314C>T (p.Ala438=)6899TBX1Benignrs574947516RCV000877210|RCV001638013; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567|MedGen:CN517202221975418919754189CT22:g.19754189C>T-
NM_001379200.1(TBX1):c.1320C>G (p.Ser440Arg)6899TBX1Uncertain significance-1RCV001985110; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975419519754195CG19754195-
NM_001379200.1(TBX1):c.1323G>A (p.Arg441=)6899TBX1Likely benignrs1228904807RCV000960211; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975419819754198GA22:g.19754198G>A-
NM_001379200.1(TBX1):c.1329G>A (p.Ala443=)6899TBX1Likely benignrs772860144RCV000876353|RCV001503130; NMedGen:CN517202|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975420419754204GA22:g.19754204G>A-
NM_001379200.1(TBX1):c.1336C>T (p.Pro446Ser)6899TBX1Conflicting interpretations of pathogenicityrs201993443RCV000993259|RCV001058764|RCV001281435; NMedGen:CN517202|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567|Human Phenotype Ontology:HP:0001250,Human Phenotype Ontology:HP:0001275,Human Phenotype Ontology:HP:0001303,Human Phenotype Ontology:HP:0002125,Human Phenotype Ontology:HP:0002221975421119754211CT22:g.19754211C>T-
NM_001379200.1(TBX1):c.1345G>A (p.Gly449Ser)6899TBX1Uncertain significancers777873225RCV001337281; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975422019754220GA19754220-
NM_001379200.1(TBX1):c.1345G>C (p.Gly449Arg)6899TBX1Uncertain significance-1RCV001872696; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975422019754220GC19754220-
NM_001379200.1(TBX1):c.1346G>A (p.Gly449Asp)6899TBX1Uncertain significance-1RCV001938641; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975422119754221GA19754221-
NM_001379200.1(TBX1):c.1348C>G (p.Leu450Val)6899TBX1Uncertain significance-1RCV001373582; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975422319754223CG19754223-
NM_001379200.1(TBX1):c.1352G>C (p.Arg451Pro)6899TBX1Conflicting interpretations of pathogenicityrs755937050RCV000620652|RCV000876591|RCV001821753; NMedGen:CN230736|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567|MedGen:CN169374221975422719754227GC22:g.19754227G>CClinGen:CA10102722CN230736 Cardiovascular phenotype;
NM_001379200.1(TBX1):c.1359C>T (p.His453=)6899TBX1Likely benign-1RCV001468016; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975423419754234CT19754234-
NM_001379200.1(TBX1):c.1368_1379dup (p.Ala459_His462dup)6899TBX1Conflicting interpretations of pathogenicityrs774578030RCV000861446|RCV001786419; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567|MedGen:CN517202221975424019754241CCCACCCGCACGCG22:g.19754240_19754241insCACCCGCACGCG-
NM_001379200.1(TBX1):c.1368C>A (p.His456Gln)6899TBX1Uncertain significancers1601294758RCV000795550; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975424319754243CA22:g.19754243C>A-
NM_001379200.1(TBX1):c.1371G>A (p.Pro457=)6899TBX1Likely benign-1RCV002194617; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975424619754246GA19754246-
NM_001379200.1(TBX1):c.1374C>G (p.His458Gln)6899TBX1Uncertain significancers747623105RCV001315139; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975424919754249CG19754249-
NM_001379200.1(TBX1):c.1376C>T (p.Ala459Val)6899TBX1Uncertain significance-1RCV002008145; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975425119754251CT19754251-
NM_001379200.1(TBX1):c.1377G>C (p.Ala459=)6899TBX1Likely benignrs771540171RCV000920355|RCV001463999; NMedGen:CN517202|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975425219754252GC22:g.19754252G>C-
NM_001379200.1(TBX1):c.1377G>T (p.Ala459=)6899TBX1Likely benign-1RCV001483994; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975425219754252GT19754252-
NM_001379200.1(TBX1):c.1379A>T (p.His460Leu)6899TBX1Uncertain significance-1RCV001965107; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975425419754254AT19754254-
NM_001379200.1(TBX1):c.1380T>C (p.His460=)6899TBX1Benign/Likely benignrs367711718RCV000618894|RCV000713777|RCV001080661; NMedGen:CN230736|MedGen:CN517202|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975425519754255TCNC_000022.10:g.19754255T>CClinGen:CA10102730CN230736 Cardiovascular phenotype;
NM_001379200.1(TBX1):c.1380T>G (p.His460Gln)6899TBX1Uncertain significancers367711718RCV001228940; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975425519754255TG22:g.19754255T>G-
NM_001379200.1(TBX1):c.1382C>T (p.Pro461Leu)6899TBX1Uncertain significance-1RCV001369876; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975425719754257CT19754257-
NM_001379200.1(TBX1):c.1385ACC[4] (p.His466del)6899TBX1Uncertain significance-1RCV001369334; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975425919754261GCACG19754258-
NM_001379200.1(TBX1):c.1385ACC[3] (p.His465_His466del)6899TBX1Uncertain significance-1RCV002004035; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975425919754264GCACCACG19754258-
NM_001379200.1(TBX1):c.1386C>A (p.His462Gln)6899TBX1Uncertain significance-1RCV002031699; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975426119754261CA19754261-
NM_001379200.1(TBX1):c.1392C>T (p.His464=)6899TBX1Likely benign-1RCV001566859|RCV002072176; NMedGen:CN517202|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975426719754267CT19754267-
NM_001379200.1(TBX1):c.1393C>G (p.His465Asp)6899TBX1Uncertain significance-1RCV002008900; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975426819754268CG19754268-
NM_001379200.1(TBX1):c.1399C>A (p.Pro467Thr)6899TBX1Uncertain significance-1RCV002003608; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975427419754274CA19754274-
NM_001379200.1(TBX1):c.1400C>T (p.Pro467Leu)6899TBX1Uncertain significance-1RCV001925314; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975427519754275CT19754275-
NM_001379200.1(TBX1):c.1401C>T (p.Pro467=)6899TBX1Likely benign-1RCV001417801; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975427619754276CT19754276-
NM_001379200.1(TBX1):c.1402G>T (p.Val468Leu)6899TBX1Likely benignrs764197422RCV001034021; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975427719754277GT22:g.19754277G>T-
NM_001379200.1(TBX1):c.1402G>C (p.Val468Leu)6899TBX1Conflicting interpretations of pathogenicityrs764197422RCV001050953|RCV001836938; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567|MedGen:CN517202221975427719754277GC22:g.19754277G>C-
NM_001379200.1(TBX1):c.1408_1446del (p.Pro470_Ala482del)6899TBX1Uncertain significancers1238730283RCV001037137; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975428319754321TCCAGCCGCCGCGGCCGCCGCCGCCGCTGCCGCAGCTGCCT22:g.19754283_19754321del-
NM_001379200.1(TBX1):c.1410_1448del (p.Ala473_Ala485del)6899TBX1Conflicting interpretations of pathogenicityrs764911027RCV001034437|RCV001655667; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567|MedGen:CN517202221975428419754322CCAGCCGCCGCGGCCGCCGCCGCCGCTGCCGCAGCTGCCGC22:g.19754284_19754322del-
NM_001379200.1(TBX1):c.1413_1442del (p.Ala476_Ala485del)6899TBX1Benign/Likely benign-1RCV001520005|RCV001548645; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567|MedGen:CN517202221975428419754313CCAGCCGCCGCGGCCGCCGCCGCCGCTGCCGC19754283-
NM_001379200.1(TBX1):c.1419_1427del (p.Ala483_Ala485del)6899TBX1Likely benignrs777514486RCV000861483|RCV001545892; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567|MedGen:CN517202221975428619754294AGCCGCCGCGA22:g.19754286_19754294del-
NM_001379200.1(TBX1):c.1419_1430del (p.Ala482_Ala485del)6899TBX1Uncertain significancers751264690RCV001061023; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975428619754297AGCCGCCGCGGCCA22:g.19754286_19754297del-
NM_001379200.1(TBX1):c.1419_1433del (p.Ala481_Ala485del)6899TBX1Uncertain significancers780815537RCV001205234; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975428619754300AGCCGCCGCGGCCGCCA22:g.19754286_19754300del-
NM_001379200.1(TBX1):c.1419_1424dup (p.Ala484_Ala485dup)6899TBX1Uncertain significance-1RCV001935427; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975428819754289CCGCCGCG19754288-
NM_001379200.1(TBX1):c.1426_1455del (p.Ala476_Ala485del)6899TBX1Uncertain significancers746335599RCV000620329|RCV001215829; NMedGen:CN230736|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975428919754318CGCCGCGGCCGCCGCCGCCGCTGCCGCAGCTC22:g.19754289_19754318delClinGen:CA10102750CN230736 Cardiovascular phenotype;
NM_001379200.1(TBX1):c.1422CGC[5] (p.Ala485dup)6899TBX1Uncertain significance-1RCV002016516; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975429419754295GGGCC19754294-
NM_001379200.1(TBX1):c.1424C>T (p.Ala475Val)6899TBX1Benign/Likely benignrs753613632RCV000497785|RCV001084246; NMedGen:CN517202|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975429919754299CT22:g.19754299C>TClinGen:CA10102758C0012236 188400 DiGeorge sequence;
NM_001379200.1(TBX1):c.1425C>T (p.Ala475=)6899TBX1Likely benign-1RCV001488850; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975430019754300CT19754300-
NM_001379200.1(TBX1):c.1431_1439del (p.Ala483_Ala485del)6899TBX1Conflicting interpretations of pathogenicityrs774489872RCV000598582|RCV002062109; NMedGen:CN517202|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975430119754309CGCCGCCGCTCNC_000022.10:g.19754306_19754314delClinGen:CA10102759CN169374 not specified;
NM_001379200.1(TBX1):c.1440_1448dup (p.Ala483_Ala485dup)6899TBX1Uncertain significancers748434309RCV001219878; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975430619754307CCGCTGCCGCA22:g.19754306_19754307insGCTGCCGCA-
NM_001379200.1(TBX1):c.1440_1448del (p.Ala483_Ala485del)6899TBX1Likely benign-1RCV002099333; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975430719754315CGCTGCCGCAC19754306-
NM_001379200.1(TBX1):c.1433C>T (p.Ala478Val)6899TBX1Uncertain significancers757867291RCV000482540|RCV001350118; NMedGen:CN517202|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975430819754308CT22:g.19754308C>TClinGen:CA10102765CN169374 not specified;
NM_001379200.1(TBX1):c.1436_1474dup (p.Ala479_Ala491dup)6899TBX1Uncertain significance-1RCV001369825; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975430919754310TTGCCGCAGCTGCCGCGGCCGCCAACATGTACTCGTCGGCC19754309-
NM_001379200.1(TBX1):c.1437C>T (p.Ala479=)6899TBX1Likely benignrs1415301935RCV000917947; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975431219754312CT22:g.19754312C>T-
NM_001379200.1(TBX1):c.1440A>C (p.Ala480=)6899TBX1Likely benign-1RCV002130658; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975431519754315AC19754315-
NM_001379200.1(TBX1):c.1446C>G (p.Ala482=)6899TBX1Likely benign-1RCV001419386; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975432119754321CG19754321-
NM_001379200.1(TBX1):c.1446C>T (p.Ala482=)6899TBX1Likely benign-1RCV001443283; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975432119754321CT19754321-
NM_001379200.1(TBX1):c.1451C>T (p.Ala484Val)6899TBX1Uncertain significance-1RCV002034075; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975432619754326CT19754326-
NM_001379200.1(TBX1):c.1461G>A (p.Met487Ile)6899TBX1Uncertain significancers371506174RCV000816868; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975433619754336GA22:g.19754336G>A-
NM_001379200.1(TBX1):c.1462T>C (p.Tyr488His)6899TBX1Uncertain significancers746250147RCV001248155; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975433719754337TC22:g.19754337T>C-
NM_001379200.1(TBX1):c.1466C>T (p.Ser489Leu)6899TBX1Uncertain significance-1RCV001884157; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975434119754341CT19754341-
NM_001379200.1(TBX1):c.1469C>T (p.Ser490Leu)6899TBX1Uncertain significance-1RCV001906054; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975434419754344CT19754344-
NM_001379200.1(TBX1):c.1472C>T (p.Ala491Val)6899TBX1Uncertain significancers373987708RCV001341090; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975434719754347CT19754347-
NM_001379200.1(TBX1):c.1473C>T (p.Ala491=)6899TBX1Likely benign-1RCV002078027; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975434819754348CT19754348-
NM_001379200.1(TBX1):c.1474G>A (p.Gly492Arg)6899TBX1Uncertain significancers541198585RCV000678753|RCV001053392; NHuman Phenotype Ontology:HP:0004383,MONDO:MONDO:0004933,MedGen:C0152101,OMIM:PS241550, Orphanet:2248|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975434919754349GA22:g.19754349G>A-C0152101 Hypoplastic left heart syndrome;
NM_001379200.1(TBX1):c.1474G>T (p.Gly492Ter)6899TBX1Uncertain significancers541198585RCV001048973; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975434919754349GT22:g.19754349G>T-
NM_001379200.1(TBX1):c.1484C>A (p.Pro495Gln)6899TBX1Uncertain significancers762076391RCV000713778|RCV001248343; NMedGen:CN517202|MONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975435919754359CANC_000022.10:g.19754359C>A-
NM_001379200.1(TBX1):c.1485G>T (p.Pro495=)6899TBX1Likely benign-1RCV002212654; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975436019754360GT19754360-
NM_001379200.1(TBX1):c.1500C>G (p.Asp500Glu)6899TBX1Uncertain significance-1RCV001872225; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975437519754375CG19754375-
NM_001379200.1(TBX1):c.1508C>G (p.Pro503Arg)6899TBX1Uncertain significancers756769832RCV001223075; NMONDO:MONDO:0008564,MedGen:C0012236,OMIM:188400, Orphanet:567221975438319754383CG22:g.19754383C>G-
MSeqDR Portal