MSeqDR Mitochondrial Disease Portal


 
*:HP: HPO terms, UMDF: 1= Disease, ND: NAMDC terms.
  Most Studied  CPEO, Complex I Deficiency, COXPD1, Leigh, LHON, MELAS, MERRF, Myopathy, SANDO
Disease Browser
Parent Node:
expand
Cerebellar Ataxia (D002524)
Parent Node:
expand
Spinocerebellar Degenerations (D013132)
..Starting node
..expand
Spinocerebellar Ataxias (D020754)

       Child Nodes:
........expandAnemia, sideroblastic spinocerebellar ataxia (C536358)
........expandAtaxia Telangiectasia (D001260) Child6
........expandChorioretinal Dystrophy, Spinocerebellar Ataxia, and Hypogonadotropic Hypogonadism (C565850)
........expandGemignani syndrome (C537678)
........expandMachado-Joseph Disease (D017827) Child1
........expandMITOCHONDRIAL DNA DEPLETION SYNDROME 7 (HEPATOCEREBRAL TYPE) (OMIM:271245)  LSDB  L: 00036;
........expandSpastic Ataxia (C564815)
........expandSpastic ataxia Charlevoix-Saguenay type (C536787)
........expandSpinocerebellar Ataxia 10 (C566874)
........expandSpinocerebellar Ataxia 11 (C565772)
........expandSpinocerebellar Ataxia 12 (C565790)
........expandSpinocerebellar ataxia 13 (C537195)
........expandSpinocerebellar ataxia 14 (C537196)
........expandSpinocerebellar Ataxia 15 (C564685)
........expandSpinocerebellar Ataxia 17 (C564616)
........expandSpinocerebellar ataxia 20 (C537199)
........expandSpinocerebellar ataxia 25 (C537202)
........expandSpinocerebellar ataxia 26 (C537203)
........expandSpinocerebellar ataxia 28 (C537205)  LSDB  L: 00498;
........expandSpinocerebellar ataxia 30 (C575214)
........expandSpinocerebellar Ataxia 31 (C566146)
........expandSpinocerebellar Ataxia And Plaque-Like Deposits (C566671)
........expandSpinocerebellar Ataxia with Dysmorphism (C564802)
........expandSpinocerebellar Ataxia with Epilepsy (C564395)
........expandSpinocerebellar Ataxia With Rigidity And Peripheral Neuropathy (C566669)
........expandSpinocerebellar ataxia, autosomal recessive 1 (C537308)
........expandSpinocerebellar Ataxia, Autosomal Recessive 7 (C563753)
........expandSpinocerebellar Ataxia, Autosomal Recessive 8 (C565188)
........expandSpinocerebellar Ataxia, Autosomal Recessive 9 (C567436)
........expandSpinocerebellar Ataxia, X-Linked 1 (C563134)
........expandSpinocerebellar Ataxia, X-Linked 5 (C567478)



 Sister Nodes: 
..expandCorneal cerebellar syndrome (C535472)
..expandFriedreich Ataxia (D005621) Child6  LSDB C:1
..expandGrowth Failure, Microcephaly, Mental Retardation, Cataracts, Large Joint Contractures, Osteoporosis, Cortical Dysplasia, and Cerebellar Atrophy (C564264)
..expandHereditary spinal ataxia (C531684)
..expandInfantile onset spinocerebellar ataxia (C535523) Child1  LSDB C:1
..expandLICHTENSTEIN-KNORR SYNDROME (OMIM:616291)
..expandMousa Al din Al Nassar syndrome (C536989)
..expandMyoclonic Cerebellar Dyssynergia (D002527) Child1
..expandOlivopontocerebellar Atrophies (D009849) Child15  LSDB C:1
..expandPosterior column ataxia (C536342)
..expandSensorimotor neuropathy with ataxia, autosomal dominant (C537197)
..expandSpinocerebellar ataxia 19 (C537198)
..expandSpinocerebellar ataxia 21 (C537200)
..expandSpinocerebellar ataxia 22 (C542540)
..expandSpinocerebellar ataxia 23 (C537201)
..expandSpinocerebellar ataxia 27 (C537204)
..expandSpinocerebellar Ataxia 29 (C537206)
..expandSpinocerebellar ataxia 8 (C537307)
..expandSpinocerebellar Ataxia, Autosomal Recessive 2 (C565865)
..expandSpinocerebellar ataxia, autosomal recessive 3 (C537309)
..expandSpinocerebellar ataxia, autosomal recessive 4 (C537310)
..expandSpinocerebellar ataxia, autosomal recessive 5 (C537311)
..expandSpinocerebellar ataxia, autosomal recessive 6 (C537312)
..expandSpinocerebellar ataxia, autosomal recessive, with axonal neuropathy (C537313)
..expandSpinocerebellar ataxia, X-linked, 2 (C537314)
..expandSpinocerebellar ataxia, X-linked, 4 (C537316)
..expandSpinocerebellar Ataxias (D020754) Child34  LSDB C:2
   

Human Disease MESH is developed by UMLS.
Further data from MedGen, OMIM,ClinVar, CTD
Term ID:11571
Name:Spinocerebellar Ataxias
Definition:A group of dominantly inherited, predominately late-onset, cerebellar ataxias which have been divided into multiple subtypes based on clinical features and genetic mapping. Progressive ataxia is a central feature of these conditions, and in certain subtypes POLYNEUROPATHY; DYSARTHRIA; visual loss; and other disorders may develop. (From Joynt, Clinical Neurology, 1997, Ch65, pp 12-17; J Neuropathol Exp Neurol 1998 Jun;57(6):531-43)
Alternative IDs:DO:DOID:1441|OMIM:164400|OMIM:164500|OMIM:183086|OMIM:183090|OMIM:600223|OMIM:600224|OMIM:612876|OMI
ParentIDs:MESH:D002524|MESH:D013132
TreeNumbers:C10.228.140.252.190.530 |C10.228.140.252.700.700 |C10.228.854.787.875 |C10.574.500.825.700 |C10.597.350.090.500.530 |C16.320.400.780.875
Synonyms:ADCA, TYPE II |ALS13, INCLUDED |Ataxia 1, Spinocerebellar |Ataxia 2, Spinocerebellar |Ataxia 2s, Spinocerebellar |Ataxia 4, Spinocerebellar |Ataxia 4s, Spinocerebellar |Ataxia 5, Spinocerebellar |Ataxia 5s, Spinocerebellar |Ataxia 6, Spinocerebellar |Ataxia 6s, Sp
Slim Mappings:Genetic disease (inborn)|Nervous system disease
Reference: MedGen: D020754
MeSH: D020754
OMIM: 164400;
MSeqDR LSDB:
MSeqDR has 2 matches in descendants: 00036; 00443;  
Genes: AF8T; ATXN1; ATXN2; ATXN7; CACNA1A; SPTBN2;
Phenotypes
1 HP:0000006Autosomal dominant inheritance
2 HP:0003581Adult onset
3 HP:0002071Abnormality of extrapyramidal motor function
4 HP:0001284Areflexia
5 HP:0003487Babinski sign
6 HP:0001283Bulbar palsy
7 HP:0002072Chorea
NAMDC:  Chorea
8 HP:0100543Cognitive impairment
NAMDC:  Cognitive delay
9 HP:0007078Decreased amplitude of sensory action potentialsHP:0040284
10 HP:0003431Decreased motor nerve conduction velocityHP:0040284
11 HP:0003448Decreased sensory nerve conduction velocityHP:0040284
12 HP:0002198Dilated fourth ventricle
13 HP:0003693Distal amyotrophy
14 HP:0007006Dorsal column degeneration
15 HP:0001260Dysarthria
NAMDC:  Dysarthria
16 HP:0002075Dysdiadochokinesis
17 HP:0001310Dysmetria
18 HP:0000641Dysmetric saccades
19 HP:0002015Dysphagia
NAMDC:  Dysphagia
20 HP:0000640Gaze-evoked nystagmus
21 HP:0001290Generalized hypotonia
22 HP:0003744Genetic anticipation with paternal anticipation bias
23 HP:0001347Hyperreflexia
NAMDC:  Hyperreactive reflexes (incl. Babinski sign, Hoffman sign)
24 HP:0001151Impaired horizontal smooth pursuit
25 HP:0002495Impaired vibratory sensation
26 HP:0002070Limb ataxia
27 HP:0001252Muscular hypotonia
NAMDC:  Hypotonia
28 HP:0000639Nystagmus
29 HP:0002542Olivopontocerebellar atrophy
30 HP:0000648Optic atrophy
31 HP:0000543Optic disc pallor
32 HP:0002073Progressive cerebellar ataxia
NAMDC:  Ataxia cerebellar
33 HP:0002168Scanning speech
34 HP:0003202Skeletal muscle atrophy
35 HP:0000514Slow saccadic eye movements
36 HP:0001257Spasticity
NAMDC:  Spasticity
37 HP:0007263Spinocerebellar atrophy
38 HP:0002503Spinocerebellar tract degeneration
39 HP:0000623Supranuclear ophthalmoplegia
40 HP:0002078Truncal ataxia
41 HP:0002839Urinary bladder sphincter dysfunction
Disease Causing ClinVar Variants
Variation_NameGeneIDGeneSymbolClinicalSignificancedbSNPRCVaccessionTestedInGTRPhenotypeIDsChromosomeStartStopHGVS_cHGVS_pHGVS_gOtherIDsDisease_ClinVar
NM_001128164.2(ATXN1):c.2150C>T (p.Ala717Val)6310ATXN1Likely benignrs41267702RCV000625149|RCV000736061; NMONDO:MONDO:0008119,MedGen:C0752120,OMIM:164400, Orphanet:98755|MedGen:CN16937461630685816306858GA6:g.16306858G>AClinGen:CA3645167C0752120 164400 Spinocerebellar ataxia 1;
NM_001128164.2(ATXN1):c.1804G>T (p.Ala602Ser)6310ATXN1Uncertain significancers1760808820RCV001199336; NMONDO:MONDO:0008119,MedGen:C0752120,OMIM:164400, Orphanet:9875561632673816326738CA6:g.16326738C>A-
NM_001128164.2(ATXN1):c.636GCA[16] (p.Gln224_Gln225dup)6310ATXN1Benignrs751421308RCV000625419|RCV001702529; NMONDO:MONDO:0008119,MedGen:C0752120,OMIM:164400, Orphanet:98755|MedGen:CN16937461632786416327865GGTGCTGC6:g.16327864_16327865insTGCTGCClinGen:CA3645517C0752120 164400 Spinocerebellar ataxia 1;
NM_001128164.2(ATXN1):c.588GCA[14] (p.Gln208dup)6310ATXN1Benign/Likely benignrs193922926RCV000202699|RCV000625420; NMedGen:CN169374|MONDO:MONDO:0008119,MedGen:C0752120,OMIM:164400, Orphanet:9875561632791516327916AATGC6:g.16327915_16327916insTGCClinGen:CA248896CN169374 not specified;
NM_000332.3(ATXN1):c.589_591CAG(36_38) (p.Gln208_His209insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln6310ATXN1Pathogenicrs193922926RCV000008537; NMONDO:MONDO:0008119,MedGen:C0752120,OMIM:164400, Orphanet:9875561632791816327920AATGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCOMIM:601556.0001C0752120 164400 Spinocerebellar ataxia 1;
NM_001128164.2(ATXN1):c.621G>T (p.Gln207His)6310ATXN1Conflicting interpretations of pathogenicityrs201030692RCV000193645|RCV001262838; NMedGen:CN169374|MONDO:MONDO:0008119,MedGen:C0752120,OMIM:164400, Orphanet:9875561632792116327921CA6:g.16327921C>AClinGen:CA207267CN169374 not specified;
NM_001128164.2(ATXN1):c.609G>T (p.Gln203His)6310ATXN1Likely benignrs199744696RCV001198089; NMONDO:MONDO:0008119,MedGen:C0752120,OMIM:164400, Orphanet:9875561632793316327933CA6:g.16327933C>A-
MSeqDR Portal