MSeqDR Mitochondrial Disease Portal


 
*:HP: HPO terms, UMDF: 1= Disease, ND: NAMDC terms.
  Most Studied  CPEO, Complex I Deficiency, COXPD1, Leigh, LHON, MELAS, MERRF, Myopathy, SANDO
Disease Browser
Parent Node:
expand
Abnormalities, Multiple (D000015)
Parent Node:
expand
Chromosome Disorders (D025063)
Parent Node:
expand
Craniofacial Abnormalities (D019465)
Parent Node:
expand
Dysostoses (D004413)
Parent Node:
expand
Intellectual Disability (D008607)
..Starting node
..expand
Rubinstein-Taybi Syndrome (D012415)

       Child Nodes:
........expandChromosome 16p13.3 Deletion Syndrome (C566433)
........expandRubinstein Taybi like syndrome (C535877)



 Sister Nodes: 
..expand15q24 Microdeletion (C579849)
..expand16p11.2 Deletion Syndrome (C579850)
..expandAbsent Eyebrows and Eyelashes with Mental Retardation (C563111)
..expandAcrodysostosis (C538179)
..expandAgonadism, XY, with Mental Retardation, Short Stature, Retarded Bone Age, and Multiple Extragenital Malformations (C563429)
..expandAICAR Transformylase Inosine Monophosphate Cyclohydrolase Deficiency (C563876)
..expandAkesson syndrome (C535610)
..expandAl Gazali Aziz Salem syndrome (C535613)
..expandAL-RAQAD SYNDROME (OMIM:616459)
..expandALACRIMA, ACHALASIA, AND MENTAL RETARDATION SYNDROME (OMIM:615510)
..expandAlaninuria with Microcephaly, Dwarfism, Enamel Hypoplasia, and Diabetes Mellitus (C565968)
..expandALAZAMI SYNDROME (OMIM:615071)
..expandALAZAMI-YUAN SYNDROME (OMIM:617126)
..expandAlopecia contractures dwarfism mental retardation (C537051)
..expandAlopecia epilepsy oligophrenia syndrome of Moynahan (C537052)
..expandAlopecia, epilepsy, pyorrhea, mental subnormality (C537057)
..expandAlopecia, Neurologic Defects, and Endocrinopathy Syndrome (C567425)
..expandAlopecia-Mental Retardation Syndrome 1 (C565965)
..expandAlopecia-Mental Retardation Syndrome 2 (C563668)
..expandALOPECIA-MENTAL RETARDATION SYNDROME 3 (OMIM:613930)
..expandAlopecia-Mental Retardation Syndrome with Convulsions and Hypergonadotropic Hypogonadism (C563370)
..expandAlpha-Thalassemia Mental Retardation Syndrome, Deletion-Type (C563050)
..expandAlport Syndrome, Mental Retardation, Midface Hypoplasia, and Elliptocytosis (C564570)
..expandAmino Aciduria with Mental Deficiency, Dwarfism, Muscular Dystrophy, Osteoporosis, and Acidosis (C565960)
..expandAmyloidosis of Gingiva and Conjunctiva, with Mental Retardation (C565958)
..expandAmyotrophic Dystonic Paraplegia (C566292)
..expandAnemia, Congenital Hypoplastic, with Multiple Congenital Anomalies-Mental Retardation Syndrome (C565796)
..expandAniridia cerebellar ataxia mental deficiency (C536370)
..expandAnsell Bywaters Elderking syndrome (C537773)
..expandAortic arch anomaly with peculiar facies and mental retardation (C537785)
..expandAphalangia, Partial, with Syndactyly and Duplication of Metatarsal IV (C563942)
..expandArachnodactyly ataxia cataract aminoaciduria mental retardation (C537424)
..expandArginine:Glycine Amidinotransferase Deficiency (C567192)  LSDB  L: 00444;
..expandArthrogryposis, distal, with hypopituitarism, mental retardation, and facial anomalies (C535385)
..expandArthrogryposis, Distal, with Mental Retardation and Characteristic Facies (C565940)
..expandARTHROGRYPOSIS, MENTAL RETARDATION, AND SEIZURES (OMIM:615553)
..expandAU-KLINE SYNDROME (OMIM:616580)
..expandAughton syndrome (C538269)
..expandAural Atresia, Multiple Congenital Anomalies, and Mental Retardation (C565923)
..expandBaraitser Rodeck Garner syndrome (C537906)
..expandBASEL-VANAGAITE-SMIRIN-YOSEF SYNDROME (OMIM:616449)
..expandBattaglia Neri syndrome (C537662)
..expandBEAULIEU-BOYCOTT-INNES SYNDROME (OMIM:613680)
..expandBehr syndrome (C537669)
..expandBellini Chiumello Rimoldi syndrome (C535652)
..expandBiemond syndrome II (C565902)
..expandBirk-Barel Mental Retardation Dysmorphism Syndrome (C567357)
..expandBlepharophimosis syndrome Ohdo type (C536232)
..expandBlepharophimosis with Facial and Genital Anomalies and Mental Retardation (C565797)
..expandBohring syndrome (C537419)
..expandBOSCH-BOONSTRA-SCHAAF OPTIC ATROPHY SYNDROME (OMIM:615722)
..expandBoudhina Yedes Khiari syndrome (C537939)
..expandBrain Anomalies, Retardation, Ectodermal Dysplasia, Skeletal Malformations, Hirschsprung Disease, Ear-Eye Anomalies, Cleft Palate-Cryptorchidism, And (C564519)
..expandBRANCHED-CHAIN KETO ACID DEHYDROGENASE KINASE DEFICIENCY (OMIM:614923)
..expandBrunner Syndrome (C563156)
..expandBullous Dystrophy, Hereditary Macular Type (C563065)
..expandCAHMR syndrome (C537959)
..expandCamera Marugo Cohen syndrome (C537964)
..expandCantalamessa Baldini Ambrosi syndrome (C537981)
..expandCantu Sanchez-Corona Fragoso syndrome (C535571)
..expandCartwright Nelson Fryns syndrome (C535917)
..expandCataract, Congenital, with Mental Impairment and Dentate Gyrus Atrophy (C564353)
..expandCataracts, ataxia, short stature, and mental retardation (C535345)
..expandCataracts, Congenital, with Sensorineural Deafness, Down Syndrome-Like Facial Appearance, Short Stature, and Mental Retardation (C563390)
..expandCephalin Lipidosis (C565872)
..expandCerebellar Ataxia, Mental Retardation, And Dysequilibrium Syndrome 2 (C567656)
..expandCerebellar Ataxia, Mental Retardation, And Dysequilibrium Syndrome 3 (C567690)
..expandCEREBELLAR ATAXIA, NONPROGRESSIVE, WITH MENTAL RETARDATION (OMIM:614756)
..expandCEREBELLOFACIODENTAL SYNDROME (OMIM:616202)
..expandCerebral Cavernous Malformations 2 (C566394)
..expandCerebral Cavernous Malformations 3 (C566393)
..expandCerebrocostomandibular Syndrome (C562538)
..expandCerebrofaciothoracic Dysplasia (C565862)
..expandCerebrooculofacioskeletal Syndrome 2 (C565185)
..expandCerebrooculofacioskeletal Syndrome 4 (C565184)
..expandCerebrooculonasal Syndrome (C565313)
..expandChoroid plexus calcification with mental retardation (C535357)
..expandCHROMOSOME 13q14 DELETION SYNDROME (OMIM:613884)
..expandChromosome 15q13.3 Microdeletion Syndrome (C567439)
..expandChromosome 15q26-Qter Deletion Syndrome (C567232)
..expandCHROMOSOME 17p13.1 DELETION SYNDROME (OMIM:613776)
..expandChromosome 17q21.31 Deletion Syndrome (C566476)
..expandChromosome 18 Pericentric Inversion (C563734)
..expandChromosome 1q21.1 Duplication Syndrome (C567290)
..expandChromosome 1q43-Q44 Deletion Syndrome (C567346)
..expandChromosome 2q31.2 Deletion Syndrome (C567344)
..expandChromosome 2q32-Q33 Deletion Syndrome (C567350)
..expandChromosome 3q29 Deletion Syndrome (C567184)
..expandCHROMOSOME 7q11.23 DELETION SYNDROME, DISTAL, 1.2-MB (OMIM:613729)
..expandCHROMOSOME 8q21.11 DELETION SYNDROME (OMIM:614230)
..expandChromosome Xq28 Duplication Syndrome (C567580)
..expandChudley-Rozdilsky syndrome (C535458)
..expandCleft Palate, Isolated, And Mental Retardation (C566991)
..expandCoffin syndrome 1 (C536435)
..expandCoffin-Siris syndrome (C536436)
..expandCohen syndrome (C536438)
..expandColoboma, cleft lip-palate and mental retardation syndrome (C535971)
..expandCOLOBOMA, OCULAR, WITH OR WITHOUT HEARING IMPAIRMENT, CLEFT LIP/PALATE, AND/OR MENTAL RETARDATION (OMIM:120433)
..expandColoboma, Uveal, with Cleft Lip and Palate and Mental Retardation (C565173)
..expandColoboma-Obesity-Hypogenitalism-Mental Retardation Syndrome (C566623)
..expandCONGENITAL HEART DEFECTS, DYSMORPHIC FACIAL FEATURES, AND INTELLECTUAL DEVELOPMENTAL DISORDER (OMIM:617360)
..expandConvulsive Disorder, Familial, with Prenatal or Early Onset (C565678)
..expandCorpus Callosum, Agenesis of, with Mental Retardation, Ocular Coloboma, and Micrognathia (C564509)
..expandCortical Blindness, Retardation, and Postaxial Polydactyly (C565674)
..expandCraniofaciofrontodigital Syndrome (C567298)
..expandCraniosynostosis Mental Retardation Clefting Syndrome (C565663)
..expandCraniosynostosis-Mental Retardation Syndrome of Lin and Gettig (C565664)
..expandCree Mental Retardation Syndrome (C564654)
..expandCri-du-Chat Syndrome (D003410) Child6
..expandCryohydrocytosis, Stomatin-Deficient, with Mental Retardation, Seizures, Cataracts, and Massive Hepatosplenomegaly (C563840)
..expandCubitus Valgus with Mental Retardation and Unusual Facies (C564510)
..expandCuratolo Cilio Pessagno syndrome (C536701)
..expandCutis Verticis Gyrata and Mental Deficiency (C565661)
..expandCystic Fibrosis with Helicobacter Pylori Gastritis, Megaloblastic Anemia, and Subnormal Mentality (C565658)
..expandDavis Lafer syndrome (C535989)
..expandDe Barsy syndrome (C535990)
..expandDe Lange Syndrome (D003635) Child1
..expandDe Sanctis-Cacchione syndrome (C535992)
..expandDeafness, Cochlear, with Myopia and Intellectual Impairment (C565645)
..expandDeafness, congenital onychodystrophy, recessive form (C538204)
..expandDevriendt syndrome (C535947)
..expandDiabetes Insipidus, Nephrogenic, with Mental Retardation and Intracerebral Calcification (C565632)
..expandDicarboxylicaminoaciduria (C536171)
..expandDigitorenocerebral Syndrome (C563052)
..expandDislocated Elbows, Bowed Tibias, Scoliosis, Deafness, Cataract, Microcephaly, And Mental Retardation (C566408)
..expandDown Syndrome (D004314) Child6
..expandDubowitz syndrome (C535718)
..expandDuker Weiss Siber syndrome (C535719)
..expandDuplication 15q11-q13 Syndrome (C557830)
..expandDwarfism, Low-Birth-Weight Type, with Unresponsiveness to Growth Hormone (C565615)
..expandDyggve-Melchior-Clausen syndrome (C535726)
..expandDysequilibrium syndrome (C535731)
..expandDysmyelination With Jaundice (C565610)
..expandEctodermal dysplasia mental retardation syndactyly (C538018)
..expandEctodermal Dysplasia, Hypohidrotic, with Hypothyroidism and Agenesis of the Corpus Callosum (C565605)
..expandElliott Ludman Teebi syndrome (C536204)
..expandEmanuel syndrome (C535733)
..expandEmphysema, Congenital, With Deafness, Penoscrotal Web, And Mental Retardation (C566519)
..expandEncephalopathy with Intracranial Calcification, Growth Hormone Deficiency, Microcephaly, and Retinal Degeneration (C565594)
..expandEpidermolysis bullosa, late-onset localized junctional, with mental retardation (C535492)
..expandEpilepsy telangiectasia (C535497)
..expandEpilepsy, Female-Restricted, with Mental Retardation (C564715)
..expandEPILEPSY, FOCAL, WITH SPEECH DISORDER AND WITH OR WITHOUT MENTAL RETARDATION (OMIM:245570)
..expandEPILEPSY, HEARING LOSS, AND MENTAL RETARDATION SYNDROME (OMIM:616577)
..expandEpilepsy, Photogenic, with Spastic Diplegia and Mental Retardation (C565587)
..expandFacial Abnormalities, Kyphoscoliosis, and Mental Retardation (C565580)
..expandFaciocardiomelic Syndrome (C567176)
..expandFallot complex with severe mental and growth retardation (C536608)
..expandFeingold Trainer syndrome (C536179)
..expandFg Syndrome 5 (C564480)
..expandFibromatosis, Gingival, with Hypertrichosis and Mental Retardation (C565331)
..expandFilippi syndrome (C538152)
..expandFine-Lubinsky syndrome (C537933)
..expandFitzsimmons Walson Mellor syndrome (C537937)
..expandFitzsimmons-McLachlan-Gilbert syndrome (C537058)
..expandFountain syndrome (C537270)
..expandFryns-Aftimos Syndrome (C565258)
..expandGarret Tripp syndrome (C535646)
..expandGenitopatellar Syndrome (C565255)
..expandGoniodysgenesis-Mental Retardation-Short Stature Syndrome (C564214)
..expandGrowth and Developmental Retardation, Ocular Ptosis, Cardiac Defect, and Anal Atresia (C565755)
..expandGrowth and mental retardation, mandibulofacial dysostosis, microcephaly, and cleft palate (C537405)
..expandGrowth Deficiency and Mental Retardation with Facial Dysmorphism (C565358)
..expandGrowth Failure, Microcephaly, Mental Retardation, Cataracts, Large Joint Contractures, Osteoporosis, Cortical Dysplasia, and Cerebellar Atrophy (C564264)
..expandGrowth mental deficiency syndrome of Myhre (C537620)
..expandGROWTH RETARDATION, INTELLECTUAL DEVELOPMENTAL DISORDER, HYPOTONIA, AND HEPATOPATHY (OMIM:617093)
..expandGurrieri Sammito Bellussi syndrome (C537625)
..expandHair defect with photosensitivity and mental retardation (C537628)
..expandHall Riggs mental retardation syndrome (C535623)
..expandHAREL-YOON SYNDROME (OMIM:617183)
..expandHarrod Doman Keele syndrome (C535635)
..expandHaspeslagh Fryns Muelenaere syndrome (C535844)
..expandHELSMOORTEL-VAN DER AA SYNDROME (OMIM:615873)
..expandHittner Hirsch Kreh syndrome (C538323)
..expandHoloprosencephaly, Ectrodactyly, and Bilateral Cleft Lip-Palate (C564484)
..expandHooft disease (C535329)
..expandHordnes Engebretsen Knudtson syndrome (C536067)
..expandHoyeraal Hreidarsson syndrome (C536068)
..expandHunter-McAlpine syndrome (C536072)
..expandHydronephrosis, Congenital, with Cleft Palate, Characteristic Facies, Hypotonia, and Mental Retardation (C565736)
..expandHydroxylysinuria (C565502)
..expandHyperleucine-Isoleucinemia (C562674)
..expandHyperlysinemia Due To Defect In Lysine Transport Into Mitochondria (C565499)
..expandHyperphosphatasia with Mental Retardation (C565495) Child2
..expandHypertelorism, Severe, With Midface Prominence, Myopia, Mental Retardation, And Bone Fragility (C566988)
..expandHypertrichosis, hyperkeratosis, mental retardation, and distinctive facial features (C538391)
..expandHyperuricemia, Infantile, with Abnormal Behavior and Normal Hypoxanthine Guanine Phosphoribosyltransferase (C565489)
..expandHypogonadism with Low-Grade Mental Deficiency and Microcephaly (C565482)
..expandHypogonadism, Male, With Mental Retardation And Skeletal Anomalies (C564406)
..expandHYPOMAGNESEMIA, SEIZURES, AND MENTAL RETARDATION (OMIM:616418)
..expandHypoparathyroidism-retardation-dysmorphism syndrome (C537157)
..expandHypospadias-Mental Retardation Syndrome (C563067)
..expandHypotonia-Cystinuria Syndrome (C564710)  LSDB  L: 00416;
..expandIchthyosis and male hypogonadism (C537365)
..expandIchthyosis, mental retardation, dwarfism, and renal impairment (C536274)
..expandIchthyosis-Mental Retardation Syndrome with Large Keratohyalin Granules in the Skin (C563402)
..expandIndolylacroyl Glycinuria with Mental Retardation (C565466)
..expandINTELLECTUAL DEVELOPMENTAL DISORDER WITH CARDIAC ARRHYTHMIA (OMIM:617173)
..expandINTELLECTUAL DEVELOPMENTAL DISORDER WITH DYSMORPHIC FACIES AND PTOSIS (OMIM:617333)
..expandINTELLECTUAL DEVELOPMENTAL DISORDER WITH DYSMORPHIC FACIES, SEIZURES, AND DISTAL LIMB ANOMALIES (OMIM:617452)
..expandINTELLECTUAL DEVELOPMENTAL DISORDER WITH GASTROINTESTINAL DIFFICULTIES AND HIGH PAIN THRESHOLD (OMIM:617450)
..expandINTELLECTUAL DEVELOPMENTAL DISORDER WITH PERSISTENCE OF FETAL HEMOGLOBIN (OMIM:617101)
..expandIris Coloboma with Ptosis, Hypertelorism, and Mental Retardation (C565462)
..expandJagell Holmgren Hofer syndrome (C537364)
..expandJohanson Blizzard syndrome (C535880)
..expandJoubert Syndrome 7 (C566916)
..expandJoubert Syndrome 9 (C567364)
..expandKahrizi Syndrome (C567196)
..expandKaler Garrity Stern syndrome (C537706)
..expandKapur Toriello syndrome (C537008)
..expandKarandikar Maria Kamble syndrome (C537009)
..expandKatsantoni Papadakou Lagoyanni syndrome (C537012)
..expandKaufman oculocerebrofacial syndrome (C537013)
..expandKBG syndrome (C537015)
..expandKEPPEN-LUBINSKY SYNDROME (OMIM:614098)
..expandKleefstra Syndrome (C563043)
..expandKoone Rizzo Elias syndrome (C537023)
..expandKosztolanyi syndrome (C537024)
..expandKozlowski Ouvrier syndrome (C537508)
..expandKozlowski Rafinski Klicharska syndrome (C537509)
..expandKozlowski-Krajewska syndrome (C537615)
..expandKuzniecky syndrome (C538091)
..expandLAMB-SHAFFER SYNDROME (OMIM:616803)
..expandLambert syndrome (C538396)
..expandLenz Majewski hyperostotic dwarfism (C537115)
..expandLeukomelanoderma, Infantilism, Mental Retardation, Hypodontia, Hypotrichosis (C565440)
..expandLight Fixation Seizure Syndrome (C566367)
..expandLimb Defects, Distal Transverse, with Mental Retardation and Spasticity (C565438)
..expandLipodystrophy, Generalized, with Mental Retardation, Deafness, Short Stature, and Slender Bones (C564283)
..expandLissencephaly 3 (C566908)
..expandLowry Maclean syndrome (C537037)
..expandLowry Wood syndrome (C537038)
..expandLubani Al Saleh Teebi syndrome (C537039)
..expandLUSCAN-LUMISH SYNDROME (OMIM:616831)
..expandLynch Lee Murday syndrome (C537713)
..expandMacrogyria, pseudobulbar palsy and mental retardation (C537722)
..expandMacrosomia obesity macrocephaly ocular abnormalities (C535812)
..expandMale pseudohermaphroditism-mental retardation syndrome, Verloes type (C535693)
..expandMandibulofacial Dysostosis with Mental Deficiency (C565420)
..expandMarfanoid Mental Retardation Syndrome, Autosomal (C565410)
..expandMarinesco-Sjogren-like syndrome (MSLS) (C535913)
..expandMartin-Probst Deafness-Mental Retardation Syndrome (C564495)
..expandMartsolf syndrome (C536028)
..expandMASA (Mental Retardation, Aphasia, Shuffling Gait, Adducted Thumbs) Syndrome (C536029)
..expandMcDonough syndrome (C538158)
..expandMEGALENCEPHALIC LEUKOENCEPHALOPATHY WITH SUBCORTICAL CYSTS 2B, REMITTING, WITH OR WITHOUT MENTAL RETARDATION (OMIM:613926)
..expandMEND SYNDROME (OMIM:300960)
..expandMental and Growth Retardation with Amblyopia (C563591)
..expandMENTAL RETARDATION AND DISTINCTIVE FACIAL FEATURES WITH OR WITHOUT CARDIAC DEFECTS (OMIM:616789)
..expandMental Retardation associated with Psoriasis (C564107)
..expandMental retardation Mietens Weber type (C537444)
..expandMental retardation Smith Fineman Myers type (C537445)
..expandMental retardation spasticity ectrodactyly (C537446)
..expandMental retardation syndrome, Belgian type (C537447)
..expandMENTAL RETARDATION WITH LANGUAGE IMPAIRMENT AND WITH OR WITHOUT AUTISTIC FEATURES (OMIM:613670)
..expandMental Retardation with Optic Atrophy, Facial Dysmorphism, Microcephaly, and Short Stature (C563810)
..expandMental Retardation with Spastic Paraplegia (C564099)
..expandMental retardation Wolff type (C537448)
..expandMENTAL RETARDATION, ANTERIOR MAXILLARY PROTRUSION, AND STRABISMUS (OMIM:613671)
..expandMental Retardation, Autosomal Dominant 1 (C566947)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 10 (OMIM:614256)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 11 (OMIM:614257)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 13 (OMIM:614563)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 18 (OMIM:615074)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 19 (OMIM:615075)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 2 (OMIM:614113)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 20 (OMIM:613443)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 21 (OMIM:615502)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 22 (OMIM:612337)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 23 (OMIM:615761)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 24 (OMIM:615828)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 26 (OMIM:615834)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 27 (OMIM:615866)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 29 (OMIM:616078)
..expandMental Retardation, Autosomal Dominant 3 (C567241)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 30 (OMIM:616083)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 31 (OMIM:616158)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 32 (OMIM:616268)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 33 (OMIM:616311)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 34 (OMIM:616351)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 35 (OMIM:616355)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 36 (OMIM:616362)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 38 (OMIM:616393)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 39 (OMIM:616521)
..expandMental Retardation, Autosomal Dominant 4 (C567240)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 40 (OMIM:616579)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 41 (OMIM:616944)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 42 (OMIM:616973)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 43 (OMIM:616977)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 44 (OMIM:617061)
..expandMental Retardation, Autosomal Dominant 5 (C567234)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 6, WITH OR WITHOUT SEIZURES (OMIM:613970)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 7 (OMIM:614104)
..expandMENTAL RETARDATION, AUTOSOMAL DOMINANT 9 (OMIM:614255)
..expandMental Retardation, Autosomal Recessive 1 (C565406)
..expandMental Retardation, Autosomal Recessive 10 (C567013)
..expandMental Retardation, Autosomal Recessive 11 (C567012)
..expandMental Retardation, Autosomal Recessive 12 (C567019)
..expandMental Retardation, Autosomal Recessive 13 (C567714)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 14 (OMIM:614020)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 15 (OMIM:614202)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 16 (OMIM:614208)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 18 (OMIM:614249)
..expandMental Retardation, Autosomal Recessive 2 (C564404)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 27 (OMIM:614340)
..expandMental Retardation, Autosomal Recessive 3 (C563929)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 34, WITH VARIANT LISSENCEPHALY (OMIM:614499)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 36 (OMIM:615286)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 37 (OMIM:615493)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 38 (OMIM:615516)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 39 (OMIM:615541)
..expandMental Retardation, Autosomal Recessive 4 (C567008)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 40 (OMIM:615599)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 41 (OMIM:615637)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 42 (OMIM:615802)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 43 (OMIM:615817)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 44 (OMIM:615942)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 45 (OMIM:615979)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 46 (OMIM:616116)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 47 (OMIM:616193)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 48 (OMIM:616269)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 49 (OMIM:616281)
..expandMental Retardation, Autosomal Recessive 5 (C567018)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 50 (OMIM:616460)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 51 (OMIM:616739)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 52 (OMIM:616887)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 53 (OMIM:616917)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 54 (OMIM:617028)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 55 (OMIM:617051)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 56 (OMIM:617125)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 57 (OMIM:617188)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 58 (OMIM:617270)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 59 (OMIM:617323)
..expandMental Retardation, Autosomal Recessive 6 (C567017)
..expandMENTAL RETARDATION, AUTOSOMAL RECESSIVE 60 (OMIM:617432)
..expandMental Retardation, Autosomal Recessive 7 (C567016)
..expandMental Retardation, Autosomal Recessive 8 (C567015)
..expandMental Retardation, Autosomal Recessive 9 (C567014)
..expandMental Retardation, Buenos Aires Type (C563095)
..expandMental Retardation, Fra12a Type (C566980)
..expandMental Retardation, Joint Hypermobility, And Skin Laxity, With Or Without Metabolic Abnormalities (C567209)
..expandMental retardation, keratoconus, febrile seizures, and sinoatrial block (C537452)
..expandMental retardation, macrocephaly, short stature and craniofacial dysmorphism (C537453)
..expandMental Retardation, Microcephaly, Epilepsy, And Coarse Face (C563342)
..expandMental Retardation, Microcephaly, Growth Retardation, Joint Contractures, and Facial Dysmorphism (C565246)
..expandMental Retardation, Severe, With Spasticity And Pigmentary Tapetoretinal Degeneration (C566429)
..expandMental Retardation, Short Stature, Facial Anomalies, and Joint Dislocations (C565248)
..expandMental Retardation, Skeletal Dysplasia, and Abducens Palsy (C564101)
..expandMental Retardation, X-Linked (D038901) Child134  LSDB C:4
..expandMental Retardation, X-Linked, Syndromic 12 (C564106)
..expandMental Retardation, X-Linked, Syndromic, Christianson Type (C567484)
..expandMental Retardation, X-Linked, Syndromic, Turner Type (C567476)
..expandMental Retardation, X-Linked, Syndromic, Zdhhc9-Related (C567586)
..expandMental Retardation, X-Linked, With Panhypopituitarism (C567485)
..expandMental Retardation, X-Linked, Znf711-Related (C567583)
..expandMetaphyseal Dysostosis, Mental Retardation, and Conductive Deafness (C565396)
..expandMethionine Malabsorption Syndrome (C562682)
..expandMicrocephalic primordial dwarfism Toriello type (C537321)
..expandMicrocephaly cervical spine fusion anomalies (C537325)
..expandMicrocephaly deafness syndrome (C537326)
..expandMicrocephaly seizures mental retardation heart disorders (C537544)
..expandMicrocephaly sparse hair mental retardation seizures (C537545)
..expandMicrocephaly with Mental Retardation and Digital Anomalies (C567101)
..expandMICROCEPHALY WITH OR WITHOUT CHORIORETINOPATHY, LYMPHEDEMA, OR MENTAL RETARDATION (OMIM:152950)
..expandMicrocephaly, corpus callosum dysgenesis and cleft lip-palate (C537547)
..expandMicrocephaly, Facial Abnormalities, Micromelia, and Mental Retardation (C566361)
..expandMicrocephaly, Macrotia, And Mental Retardation (C566525)
..expandMicrophthalmia and mental deficiency (C537462)
..expandMirhosseini-Holmes-Walton syndrome (C538367)
..expandMohr-Tranebjaerg syndrome (C535808)  LSDB  L: 00113;
..expandMollica Pavone Antener syndrome (C535809)
..expandMOMES Syndrome (C564660)
..expandMorillo-Cucci Passarge syndrome (C536983)
..expandMORM syndrome (C536984)
..expandMowat-Wilson syndrome (C536990)
..expandMuscular Dystrophy, Congenital, associated with Calf Hypertrophy, Microcephaly, and Severe Mental Retardation (C565506)
..expandMuscular Dystrophy, Congenital, plus Mental Retardation (C565505)
..expandMuscular Dystrophy, Congenital, Type 1D (C563844)
..expandMUSCULAR DYSTROPHY, CONGENITAL, WITH CATARACTS AND INTELLECTUAL DISABILITY (OMIM:617404)
..expandMUSCULAR DYSTROPHY-DYSTROGLYCANOPATHY (CONGENITAL WITH MENTAL RETARDATION), TYPE B, 1 (OMIM:613155)
..expandMUSCULAR DYSTROPHY-DYSTROGLYCANOPATHY (CONGENITAL WITH MENTAL RETARDATION), TYPE B, 14 (OMIM:615351)
..expandMUSCULAR DYSTROPHY-DYSTROGLYCANOPATHY (CONGENITAL WITH MENTAL RETARDATION), TYPE B, 2 (OMIM:613156)
..expandMUSCULAR DYSTROPHY-DYSTROGLYCANOPATHY (CONGENITAL WITH MENTAL RETARDATION), TYPE B, 3 (OMIM:613151)
..expandMUSCULAR DYSTROPHY-DYSTROGLYCANOPATHY (CONGENITAL WITH MENTAL RETARDATION), TYPE B, 6 (OMIM:608840)
..expandMyotonia with Skeletal Abnormalities and Mental Retardation (C564967)
..expandN syndrome (C536108)
..expandNakamura Osame syndrome (C538335)
..expandNeuhauser syndrome (C536143)
..expandNEURODEVELOPMENTAL DISORDER WITH OR WITHOUT HYPERKINETIC MOVEMENTS AND SEIZURES, AUTOSOMAL DOMINANT (OMIM:614254)
..expandNeurofaciodigitorenal syndrome (C537388)
..expandNeurologic Disease, Infantile Multisystem, with Osseous Fragility (C564954)
..expandNF1 Microdeletion Syndrome (C563524)
..expandNF1 Microduplication Syndrome (C567173)
..expandNicolaides Baraitser syndrome (C536116)
..expandOculodigitoesophagoduodenal syndrome (C537734)
..expandOKUR-CHUNG NEURODEVELOPMENTAL SYNDROME (OMIM:617062)
..expandOliver Syndrome (C564931)
..expandOliver-McFarlane syndrome (C536554)
..expandOnychotrichodysplasia and neutropenia (C537752)
..expandOphthalmoplegia, Progressive, with Scrotal Tongue and Mental Deficiency (C563498)
..expandOpitz trigonocephaly syndrome (C537418)
..expandOPTIC ATROPHY 10 WITH OR WITHOUT ATAXIA, MENTAL RETARDATION, AND SEIZURES (OMIM:616732)
..expandOsteolysis syndrome recessive (C536052)
..expandPACHYGYRIA WITH MENTAL RETARDATION, SEIZURES, AND ARACHNOID CYSTS (OMIM:600176)
..expandPalant cleft palate syndrome (C538102)
..expandPallister W syndrome (C538106)
..expandParastremmatic dwarfism (C537172)
..expandParkinsonism, early onset with mental retardation (C537179)
..expandPashayan syndrome (C536303)
..expandPatella hypoplasia mental retardation (C536308)
..expandPavone Fiumara Rizzo syndrome (C536313)
..expandPerisylvian syndrome (C536658)
..expandPerniola Krajewska Carnevale syndrome (C536660)
..expandPfeiffer Kapferer syndrome (C537887)
..expandPfeiffer Mayer syndrome (C537888)
..expandPfeiffer Tietze Welte syndrome (C537891)
..expandPHOSPHOSERINE PHOSPHATASE DEFICIENCY (OMIM:614023)
..expandPilotto syndrome (C537400)
..expandPitt-Hopkins syndrome (C537403)
..expandPiussan Lenaerts Mathieu syndrome (C537511)
..expandPrader-Willi Syndrome (D011218) Child2
..expandPrimrose syndrome (C536420)
..expandProlonged Bleeding Time, Brachydactyly, and Mental Retardation (C564207)
..expandProud Syndrome (C563110)
..expandPrune Belly Syndrome with Pulmonic Stenosis, Mental Retardation, and Deafness (C562894)
..expandPseudoaminopterin syndrome (C535823)
..expandPseudouridinuria and Mental Defect (C564864)
..expandPterygium colli mental retardation digital anomalies (C535831)
..expandQazi Markouizos syndrome (C536259)
..expandRadioulnar synostosis retinal pigment abnormalities (C536270)
..expandRamon Syndrome (C535285)
..expandRamos Arroyo Clark syndrome (C535286)
..expandReardon Wilson Cavanagh syndrome (C535295)
..expandRenal Tubular Acidosis, Proximal, With Ocular Abnormalities And Mental Retardation (C567038)
..expandRetinitis Pigmentosa, Deafness, Mental Retardation, and Hypogonadism (C564841)
..expandRichards-Rundle syndrome (C535674)
..expandRobin Sequence with Distinctive Facial Appearance and Brachydactyly (C563880)
..expandRolandic Epilepsy, Mental Retardation, And Speech Dyspraxia, Autosomal Dominant (C563392)
..expandRolandic Epilepsy, Mental Retardation, and Speech Dyspraxia, X-Linked (C564467)
..expandRubinstein-Taybi Syndrome (D012415) Child2
..expandRud Syndrome (C535878)
..expandRuzicka Goerz Anton syndrome (C537192)
..expandSammartino De Crecchio Syndrome (C537229)
..expandSao Paulo MCA-MR Syndrome (C563119)
..expandScaphocephaly, Maxillary Retrusion, And Mental Retardation (C566511)
..expandSCARF syndrome (C536625)
..expandSchinzel-Giedion syndrome (C536632)
..expandSchofer Beetz Bohl syndrome (C535949)
..expandScholte syndrome (C536638)
..expandSchrander-Stumpel Theunissen Hulsmans syndrome (C536639)
..expandSclerosing bone dysplasia mental retardation (C537523)
..expandScott Bryant Graham syndrome (C537528)
..expandSeckel Syndrome 3 (C563881)
..expandSECKEL SYNDROME 4 (OMIM:613676)
..expandSeemanova Lesny syndrome (C537536)
..expandSeSAME syndrome (C557674)
..expandShort Stature, Mental Retardation, Callosal Agenesis, Heminasal Hypoplasia, Microphthalmia, And Atypical Clefting (C566989)
..expandSimpson-Golabi-Behmel syndrome (C537340)
..expandSingh Chhaparwal Dhanda syndrome (C537341)
..expandSkeletal Defects, Genital Hypoplasia, And Mental Retardation (C567306)
..expandSketetal dysplasia coarse facies mental retardation (C536671)
..expandSpastic Ataxia (C564815)
..expandSpastic diplegia infantile type (C537481)
..expandSpastic paraplegia 14, autosomal recessive (C537486)
..expandSpastic Paraplegia 18, Autosomal Recessive (C567628)
..expandSpastic Paraplegia 32, Autosomal Recessive (C566983)
..expandSpastic paraplegia epilepsy mental retardation (C536869)
..expandSpastic Paraplegia, Ataxia, And Mental Retardation (C564378)
..expandSpastic Paraplegia, Sensorineural Deafness, Mental Retardation, And Progressive Nephropathy (C566682)
..expandSpastic Paresis, Glaucoma, and Mental Retardation (C564809)
..expandSpastic Quadriplegia, Retinitis Pigmentosa, and Mental Retardation (C564808)
..expandSpinal Muscular Atrophy with Mental Retardation (C564807)
..expandSpinal Muscular Atrophy with Microcephaly and Mental Subnormality (C564806)
..expandSpondyloepimetaphyseal dysplasia, Genevieve type (C535785)
..expandSpondyloepiphyseal Dysplasia Tarda with Mental Retardation (C564796)
..expandSpondyloepiphyseal Dysplasia With Coronal Craniosynostosis, Cataracts, Cleft Palate, And Mental Retardation (C566515)
..expandStevenson-Carey Syndrome (C567446)
..expandSucrosuria, Hiatus Hernia and Mental Retardation (C564792)
..expandSUPERNUMERARY DER(22)t(8 (OMIM:613700)
..expandTAKENOUCHI-KOSAKI SYNDROME (OMIM:616737)
..expandTamari Goodman syndrome (C536896)
..expandTATTON-BROWN-RAHMAN SYNDROME (OMIM:615879)
..expandTemple-Baraitser Syndrome (C567516)
..expandTemtamy preaxial brachydactyly syndrome (C536958)
..expandTENORIO SYNDROME (OMIM:616260)
..expandTetrasomy X (C536502)
..expandTonoki syndrome (C536967)
..expandTrichodental syndrome (C536551)
..expandTRICHOTHIODYSTROPHY 1, PHOTOSENSITIVE (OMIM:601675)
..expandTrisomy 13 Syndrome (D000073839)
..expandTryptophanuria With Dwarfism (C562658)
..expandTsukahara Syndrome (C566376)
..expandUlna hypoplasia with mental retardation (C536934)
..expandUlnar Hypoplasia with Mental Retardation (C564757)
..expandUpton Young syndrome (C536473)
..expandVan Bogaert-Hozay syndrome (C536526)
..expandVan Den Bosch Syndrome (C563129)
..expandVan Maldergem Wetzburger Verloes syndrome (C536530)
..expandVasquez Hurst Sotos syndrome (C536533)
..expandVerloes Gillerot Fryns syndrome (C536539)
..expandViljoen Kallis Voges syndrome (C536349)
..expandVitiligo, Progressive, with Mental Retardation and Urethral Duplication (C564739)
..expandVolcke Soekarman syndrome (C537718)
..expandWAGR Syndrome (D017624) Child2
..expandWalker Dyson syndrome (C536568)
..expandWarburg Sjo Fledelius syndrome (C536681)
..expandWarburton Anyane Yeboa syndrome (C536682)
..expandWiedemann Grosse Dibbern syndrome (C536704)
..expandWiedemann Oldigs Oppermann syndrome (C536705)
..expandWIEDEMANN-STEINER SYNDROME (OMIM:605130)
..expandWilliams Syndrome (D018980) Child1
..expandWinship Viljoen Leary syndrome (C536711)
..expandWoodhouse Sakati syndrome (C536742)
..expandWorster Drought syndrome (C536747)
..expandXIA-GIBBS SYNDROME (OMIM:615829)
..expandYorifuji Okuno syndrome (C536714)
..expandYoung Hughes syndrome (C536715)
..expandYoung Simpson syndrome (C536717)
..expandZazam Sheriff Phillips syndrome (C536723)
..expandZechi-Ceide Syndrome (C567865)
..expandZerres Rietschel Majewski syndrome (C536724)
..expandZlotogora-Ogur syndrome (C536726)
..expandZTTK SYNDROME (OMIM:617140)
..expandZunich neuroectodermal syndrome (C536729)
   

Human Disease MESH is developed by UMLS.
Further data from MedGen, OMIM,ClinVar, CTD
Term ID:10912
Name:Rubinstein-Taybi Syndrome
Definition:A chromosomal disorder characterized by MENTAL RETARDATION, broad thumbs, webbing of fingers and toes, beaked nose, short upper lip, pouting lower lip, agenesis of corpus callosum, large foramen magnum, keloid formation, pulmonary stenosis, vertebral anomalies, chest wall anomalies, sleep apnea, and megacolon. The disease has an autosomal dominant pattern of inheritance and is associated with deletions of the short arm of chromosome 16 (16p13.3).
Alternative IDs:DO:DOID:1933|OMIM:180849|OMIM:613684
ParentIDs:MESH:D000015|MESH:D004413|MESH:D008607|MESH:D019465|MESH:D025063
TreeNumbers:C05.116.099.370.797 |C05.660.207.850 |C10.597.606.360.700 |C16.131.077.804 |C16.131.260.790 |C16.131.621.207.850 |C16.320.180.790
Synonyms:Broad Thumb Hallux Syndrome |Broad Thumb-Hallux Syndrome |Broad Thumb-Hallux Syndromes |Broad Thumbs and Great Toes, Characteristic Facies, and Mental Retardation |RSTS |RSTS1 |RSTS2 |Rubinstein Syndrome |Rubinstein Taybi Syndrome |RUBINSTEIN-TAYBI SYNDROME 1 |RUB
Slim Mappings:Congenital abnormality|Genetic disease (inborn)|Musculoskeletal disease|Nervous system disease
Reference: MedGen: D012415
MeSH: D012415
OMIM: 180849;
MSeqDR LSDB:  
Genes: CREBBP; EP300;
Phenotypes
1 HP:0000006Autosomal dominant inheritance
2 HP:0000481Abnormal cornea morphology
3 HP:0006483Abnormal number of teeth
4 HP:0000539Abnormality of refraction
5 HP:0003319Abnormality of the cervical spine
6 HP:0000077Abnormality of the kidney
NAMDC:  Abnormality of the kidney
7 HP:0000377Abnormality of the pinna
8 HP:0002251Aganglionic megacolon
9 HP:0001274Agenesis of corpus callosum
10 HP:0000756Agoraphobia
11 HP:0011675Arrhythmia
NAMDC:  Cardiac conduction block
12 HP:0001631Atrial septal defect
13 HP:0000717Autism
NAMDC:  Autism
14 HP:0005743Avascular necrosis of the capital femoral epiphysis
15 HP:0000136Bifid uterus
16 HP:0001335Bimanual synkinesia
17 HP:0010055Broad hallux
18 HP:0011304Broad thumb
19 HP:0000957Cafe-au-lait spot
20 HP:0005306Capillary hemangioma
21 HP:0000518Cataract
NAMDC:  Cataracts
22 HP:0001135Chorioretinal dystrophy
23 HP:0004209Clinodactyly of the 5th finger
24 HP:0000589Coloboma
25 HP:0002019Constipation
26 HP:0000444Convex nasal ridge
27 HP:0000028Cryptorchidism
28 HP:0000490Deeply set eye
29 HP:0000270Delayed cranial suture closure
30 HP:0002750Delayed skeletal maturation
31 HP:0000750Delayed speech and language development
NAMDC:  Delayed language
32 HP:0000678Dental crowding
33 HP:0000689Dental malocclusion
34 HP:0004411Deviated nasal septum
35 HP:0003083Dislocated radial head
36 HP:0000494Downslanted palpebral fissures
37 HP:0009921Duane anomaly
38 HP:0010066Duplication of phalanx of hallux
39 HP:0002353EEG abnormality
40 HP:0000286Epicanthus
41 HP:0000273Facial grimacing
42 HP:0001508Failure to thrive Infantile onset
43 HP:0008872Feeding difficulties in infancy
44 HP:0002869Flared iliac wings
45 HP:0001371Flexion contracture
46 HP:0002007Frontal bossing
47 HP:0002236Frontal upsweep of hair
48 HP:0001290Generalized hypotonia
49 HP:0000501Glaucoma
50 HP:0000365Hearing impairment
51 HP:0001425Heterogeneous
52 HP:0001042High axial triradius
53 HP:0000218High palate
54 HP:0002553Highly arched eyebrow
55 HP:0001007Hirsutism
56 HP:0000752Hyperactivity
57 HP:0001347Hyperreflexia
NAMDC:  Hyperreactive reflexes (incl. Babinski sign, Hoffman sign)
58 HP:0006297Hypoplasia of dental enamel
59 HP:0000327Hypoplasia of the maxilla
60 HP:0002866Hypoplastic iliac wing
61 HP:0000047Hypospadias
62 HP:0100710Impulsivity
63 HP:0001249Intellectual disability
64 HP:0001382Joint hypermobility
65 HP:0001388Joint laxity
66 HP:0010562Keloids
67 HP:0002700Large foramen magnum
68 HP:0001601Laryngomalacia
69 HP:0000527Long eyelashes
70 HP:0000294Low anterior hairline
71 HP:0009765Low hanging columella
72 HP:0002162Low posterior hairline
73 HP:0000369Low-set ears
74 HP:0000252Microcephaly
75 HP:0000347Micrognathia
76 HP:0001252Muscular hypotonia
NAMDC:  Hypotonia
77 HP:0000160Narrow mouth
78 HP:0000189Narrow palate
79 HP:0000579Nasolacrimal duct obstruction
80 HP:0002870Obstructive sleep apnea
81 HP:0009715Papillary cystadenoma of the epididymis
82 HP:0002697Parietal foramina
83 HP:0002999Patellar dislocation
84 HP:0001643Patent ductus arteriosus
85 HP:0000767Pectus excavatum
86 HP:0001763Pes planus
87 HP:0002183Phonophobia
88 HP:0008107Plantar crease between first and second toes
89 HP:0010442Polydactyly
90 HP:0001561Polyhydramnios
91 HP:0002370Poor coordination
92 HP:0008897Postnatal growth retardation
93 HP:0010314Premature thelarche
94 HP:0001212Prominent fingertip pads
95 HP:0000520Proptosis
96 HP:0000508Ptosis
NAMDC:  Ptosis
97 HP:0005895Radial deviation of thumb terminal phalanx
98 HP:0002788Recurrent upper respiratory tract infections Infantile onset
99 HP:0002098Respiratory distress Neonatal onset
100 HP:0000278Retrognathia
101 HP:0002650Scoliosis
102 HP:0001250Seizures
NAMDC:  Seizures
103 HP:0000742Self-mutilation
104 HP:0000049Shawl scrotum
105 HP:0000736Short attention span
106 HP:0004322Short stature
NAMDC:  Short stature (patient¡¯s height is below the 3rd percentile)
107 HP:0000954Single transverse palmar crease
108 HP:0003298Spina bifida occulta
109 HP:0003745Sporadic
110 HP:0000733Stereotypy
111 HP:0001159Syndactyly
112 HP:0011087Talon cusp
113 HP:0002144Tethered cord
114 HP:0000574Thick eyebrow
115 HP:0001956Truncal obesity Juvenile onset
116 HP:0002317Unsteady gait
117 HP:0003828Variable expressivity
118 HP:0010775Vascular ring
119 HP:0001629Ventricular septal defect
120 HP:0000260Wide anterior fontanel
121 HP:0000431Wide nasal bridge
Disease Causing ClinVar Variants
Variation_NameGeneIDGeneSymbolClinicalSignificancedbSNPRCVaccessionTestedInGTRPhenotypeIDsChromosomeStartStopHGVS_cHGVS_pHGVS_gOtherIDsDisease_ClinVar
NG_009873.1:g.(?_5000)_(160068_?)del1387CREBBPPathogenic-1RCV000417106; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637750543930122nana-
NM_001079846.1(CREBBP):c.7147_*247delinsC (p.Ser2383_Ter2405delinsXaa)1387CREBBPLikely pathogenicrs1555470631RCV000625603; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637774723777787AAACGGAAAAAAAAGAACCCCCCCCACCCCCCCGCCAAAAAAAAACCAAAGAGAGAGACCAGATATTTAAATCAACTGGTTTTTAACAAAAAAATATATTCTTTGTATTGG16:g.3777473_3777571delClinGen:CA658798522C0035934 180849 Rubinstein-Taybi syndrome;
NM_004380.3(CREBBP):c.7311G>T (p.Lys2437Asn)1387CREBBPUncertain significancers895608889RCV000723280; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637777373777737CA16:g.3777737C>A-
NM_004380.3(CREBBP):c.7245C>T (p.Pro2415=)1387CREBBPLikely benignrs1555470758RCV000559542; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637778033777803GA16:g.3777803G>AClinGen:CA493393159C0035934 180849 Rubinstein-Taybi syndrome;
NM_004380.3(CREBBP):c.7162G>A (p.Ala2388Thr)1387CREBBPUncertain significancers756011865RCV000714678; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637778863777886CT16:g.3777886C>T-
NM_004380.3(CREBBP):c.6454C>T (p.Pro2152Ser)1387CREBBPUncertain significance-1RCV001270736; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637785943778594GA16:g.3778594G>A-
NM_004380.3(CREBBP):c.6449C>T (p.Pro2150Leu)1387CREBBPUncertain significancers587783512RCV000145778; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637785993778599GA16:g.3778599G>AClinGen:CA271440
NM_004380.3(CREBBP):c.6444C>T (p.Gly2148=)1387CREBBPUncertain significancers148539895RCV000632999; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637786043778604GA16:g.3778604G>AClinGen:CA7869110C0035934 180849 Rubinstein-Taybi syndrome;
NM_004380.3(CREBBP):c.6436C>T (p.Gln2146Ter)1387CREBBPPathogenicrs1596783639RCV000856797; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637786123778612GA16:g.3778612G>A-
NM_004380.3(CREBBP):c.6395_6417dup (p.Gln2140fs)1387CREBBPPathogenicrs797045500RCV000192313; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637786303778631GGCAGGCTGGGCTGCTGGTGCATGC16:g.3778630_3778631insCAGGCTGGGCTGCTGGTGCATGCClinGen:CA276936
NM_004380.3(CREBBP):c.6395_6417del (p.Gly2132fs)1387CREBBPPathogenicrs797045500RCV000856888; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637786313778653GCAGGCTGGGCTGCTGGTGCATGCG16:g.3778631_3778653del-
NM_004380.3(CREBBP):c.6324C>A (p.Tyr2108Ter)1387CREBBPLikely pathogenicrs199821421RCV000497205|RCV000623929; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783|MeSH:D030342,MedGen:C09501231637787243778724GT16:g.3778724G>TClinGen:CA394553636C0950123 Inborn genetic diseases;
NM_004380.3(CREBBP):c.6275C>G (p.Ser2092Ter)1387CREBBPLikely pathogenicrs1555471077RCV000503664; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637787733778773GC16:g.3778773G>CClinGen:CA394553744C0035934 180849 Rubinstein-Taybi syndrome;
NM_004380.3(CREBBP):c.6250C>T (p.Gln2084Ter)1387CREBBPLikely pathogenic-1RCV001265550; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637787983778798GA16:g.3778798G>A-
NM_004380.3(CREBBP):c.6221_6230del (p.Leu2074fs)1387CREBBPPathogenicrs1596784310RCV000856887; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637788183778827GGGCGACTTCAG16:g.3778818_3778827del-
NM_004380.3(CREBBP):c.6130_6171del (p.Ala2044_Gln2057del)1387CREBBPLikely pathogenicrs587783511RCV000145777; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637788773778918GCTGCACGCTGGGCATCCGGGGCCCAGCCACGGCCGCCTGGGCG16:g.3778877_3778918delClinGen:CA271438
NM_004380.3(CREBBP):c.6113_6137dup (p.Ala2047fs)1387CREBBPPathogenicrs1596784713RCV000856886; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637789103778911CCGCCTGGGCCTGCATGGATATCACAG16:g.3778910_3778911insGCCTGGGCCTGCATGGATATCACAG-
NM_004380.3(CREBBP):c.6113_6137del (p.Pro2038fs)1387CREBBPPathogenicrs1596784713RCV000856885; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637789113778935CGCCTGGGCCTGCATGGATATCACAGC16:g.3778911_3778935del-
NM_004380.3(CREBBP):c.6107_6116del (p.Pro2036fs)1387CREBBPPathogenicrs797045499RCV000194469; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637789323778941CACAGGCCTGGC16:g.3778932_3778941delClinGen:CA277328
NM_004380.3(CREBBP):c.6104del (p.Leu2035fs)1387CREBBPPathogenic-1RCV001252210; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637789443778944CAC16:g.3778944_3778944del-
NM_004380.3(CREBBP):c.6088C>T (p.Gln2030Ter)1387CREBBPPathogenicrs587783510RCV000145775; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637789603778960GA16:g.3778960G>AClinGen:CA271436
NM_004380.3(CREBBP):c.6071C>T (p.Ala2024Val)1387CREBBPUncertain significancers745551441RCV000540484|RCV000719900; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783|MedGen:C27117541637789773778977GA16:g.3778977G>AClinGen:CA7869187C0035934 180849 Rubinstein-Taybi syndrome;
NM_004380.3(CREBBP):c.6028G>A (p.Gly2010Arg)1387CREBBPUncertain significance-1RCV001195818; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637790203779020CT16:g.3779020C>T-
NM_004380.3(CREBBP):c.5986del (p.Ala1996fs)1387CREBBPPathogenicrs1596785514RCV000856884; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637790623779062GCG16:g.3779062_3779062del-
NM_004380.3(CREBBP):c.5936_5937insT (p.Ser1980fs)1387CREBBPPathogenicrs797045498RCV000193252; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637791113779112GGA16:g.3779111_3779112insAClinGen:CA277105
NM_004380.3(CREBBP):c.5905C>T (p.Gln1969Ter)1387CREBBPPathogenicrs1567262537RCV000754905; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637791433779143GA16:g.3779143G>A-
NM_004380.3(CREBBP):c.5869del (p.Glu1957fs)1387CREBBPPathogenicrs587783508RCV000145773; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637791793779179TCT16:g.3779179_3779179delClinGen:CA271433
NM_004380.3(CREBBP):c.5845dup (p.Ala1949fs)1387CREBBPPathogenicrs1596786219RCV000856926; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637792023779203GGC16:g.3779202_3779203insC-
NM_004380.3(CREBBP):c.5834_5844del (p.Pro1945fs)1387CREBBPPathogenicrs587783506RCV000145771; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637792043779214CCGGGGGTGGGGC16:g.3779204_3779214delClinGen:CA271431
NM_004380.3(CREBBP):c.5837dup (p.Pro1947fs)1387CREBBPPathogenicrs587783507RCV000195029; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637792103779211TTG16:g.3779210_3779211insGClinGen:CA277424C0035934 180849 Rubinstein-Taybi syndrome;
NM_001079846.1(CREBBP):c.5723del (p.Pro1908fs)1387CREBBPPathogenicrs587783507RCV000145772|RCV000681911; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783|MedGen:CN5172021637792113779211TGT16:g.3779211_3779211delClinGen:CA271432
NM_004380.3(CREBBP):c.5837C>A (p.Pro1946Gln)1387CREBBPUncertain significancers765600316RCV000700488; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637792113779211GT16:g.3779211G>T-
NM_004380.3(CREBBP):c.5821C>T (p.Gln1941Ter)1387CREBBPPathogenicrs587783505RCV000145769; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637792273779227GA16:g.3779227G>AClinGen:CA271429
NM_004380.3(CREBBP):c.5800T>C (p.Ser1934Pro)1387CREBBPConflicting interpretations of pathogenicityrs587783504RCV000145768|RCV000177560|RCV001087896; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783|MedGen:CN517202|MONDO:MONDO:0019188,MedGen:C0035934,OMIM:PS180849, Orphanet:7831637792483779248AG16:g.3779248A>GClinGen:CA243769CN169374 not specified;
NM_004380.3(CREBBP):c.5790dup (p.Thr1931fs)1387CREBBPPathogenicrs1596786512RCV000856925; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637792573779258TTG16:g.3779257_3779258insG-
NM_004380.3(CREBBP):c.5776C>G (p.Arg1926Gly)1387CREBBPLikely benignrs778915687RCV000989507; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637792723779272GC16:g.3779272G>C-
NM_004380.3(CREBBP):c.5763C>G (p.Phe1921Leu)1387CREBBPLikely benign-1RCV001262784; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637792853779285GC16:g.3779285G>C-
NM_004380.3(CREBBP):c.5740G>A (p.Val1914Met)1387CREBBPUncertain significancers760771706RCV000714851; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637793083779308CT16:g.3779308C>T-
NM_004380.3(CREBBP):c.5722del (p.Gln1908fs)1387CREBBPPathogenicrs1596786752RCV000856924; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637793263779326TGT16:g.3779326_3779326del-
NM_004380.3(CREBBP):c.5719G>A (p.Ala1907Thr)1387CREBBPConflicting interpretations of pathogenicityrs199990883RCV000081061|RCV000145767|RCV000224624|RCV000715211|RCV001085724; NMedGen:CN169374|MONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783|MedGen:CN517202|MedGen:C2711754|MONDO:MONDO:0019188,MedGen:C0035934,OMIM:PS180849, Orphanet:7831637793293779329CT16:g.3779329C>TClinGen:CA248675CN517202 not provided;
NM_004380.3(CREBBP):c.5694_5703del (p.Ser1898fs)1387CREBBPPathogenicrs1555471323RCV000552014; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637793453779354TCTGGGGTGTGT16:g.3779345_3779354delClinGen:CA658658386C0035934 180849 Rubinstein-Taybi syndrome;
NM_001079846.1(CREBBP):c.5525_5526AG[1] (p.Leu1844fs)1387CREBBPPathogenicrs1567263114RCV000710038|RCV000823101; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783|MONDO:MONDO:0019188,MedGen:C0035934,OMIM:PS180849, Orphanet:7831637794063779407ACTA16:g.3779406_3779407del-
NM_004380.3(CREBBP):c.5614A>G (p.Met1872Val)1387CREBBPPathogenic/Likely pathogenicrs797045037RCV000191076|RCV000523539|RCV000757968|RCV001260745; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783|MedGen:CN517202|MONDO:MONDO:0020763,MedGen:C5193034,OMIM:618332|Human Phenotype Ontology:HP:0000730,Human Phenotype Ontology:HP:0001249,Human Phenotype Ontology:HP:0001267,Huma1637794343779434TC16:g.3779434T>CClinGen:CA276136,OMIM:600140.0012CN517202 not provided;
NM_004380.3(CREBBP):c.5611A>C (p.Thr1871Pro)1387CREBBPUncertain significance-1RCV001198109; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637794373779437TG16:g.3779437T>G-
NM_004380.3(CREBBP):c.5482_5484del (p.Tyr1828del)1387CREBBPLikely pathogenicrs1596787459RCV000824846; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637795643779566GGTAG16:g.3779564_3779566del-
NM_004380.3(CREBBP):c.5412C>A (p.His1804Gln)1387CREBBPLikely pathogenicrs797045496RCV000194204; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637796363779636GT16:g.3779636G>TClinGen:CA277274
NM_004380.3(CREBBP):c.5357G>A (p.Arg1786His)1387CREBBPLikely pathogenic-1RCV001249612; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637796913779691CT16:g.3779691C>T-
NM_004380.3(CREBBP):c.5237G>T (p.Gly1746Val)1387CREBBPLikely pathogenicrs869312714RCV000209852; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637798113779811CA16:g.3779811C>AClinGen:CA357158C0035934 180849 Rubinstein-Taybi syndrome;
NM_004380.3(CREBBP):c.5186G>C (p.Cys1729Ser)1387CREBBPLikely pathogenic-1RCV001089539; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637798623779862CG16:g.3779862C>G-
NM_004380.3(CREBBP):c.5158T>C (p.Cys1720Arg)1387CREBBPLikely pathogenic-1RCV001253321; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637812073781207AG16:g.3781207A>G-
NM_004380.3(CREBBP):c.5051C>A (p.Ser1684Tyr)1387CREBBPUncertain significancers1555471841RCV000541813; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637813143781314GT16:g.3781314G>TClinGen:CA394558493C0035934 180849 Rubinstein-Taybi syndrome;
NM_004380.3(CREBBP):c.5050T>C (p.Ser1684Pro)1387CREBBPLikely pathogenicrs587783503RCV000145765; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637813153781315AG16:g.3781315A>GClinGen:CA271427
NM_001079846.1(CREBBP):c.4922_4924CCT[1] (p.Ser1642del)1387CREBBPPathogenic/Likely pathogenicrs587783502RCV000145764; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637813243781326AAGGA16:g.3781324_3781326delClinGen:CA271425
NM_004380.3(CREBBP):c.5027G>A (p.Trp1676Ter)1387CREBBPPathogenicrs797045495RCV000193359; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637813383781338CT16:g.3781338C>TClinGen:CA277127
NM_004380.3(CREBBP):c.5014A>T (p.Arg1672Ter)1387CREBBPPathogenicrs1555471874RCV000632997; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637813513781351TA16:g.3781351T>AClinGen:CA394558691
NM_004380.3(CREBBP):c.4991G>A (p.Arg1664His)1387CREBBPLikely pathogenicrs1596791996RCV000856923; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637813743781374CT16:g.3781374C>T-
NM_004380.3(CREBBP):c.4894T>C (p.Phe1632Leu)1387CREBBPUncertain significancers587783501RCV000145763; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637814713781471AG16:g.3781471A>GClinGen:CA271423
NM_004380.3(CREBBP):c.4890+6C>T1387CREBBPUncertain significancers1567265838RCV000703260; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637817713781771GA16:g.3781771G>A-
NM_004380.3(CREBBP):c.4890+1G>A1387CREBBPPathogenicrs1596793242RCV000856922; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637817763781776CT16:g.3781776C>T-
NM_004380.3(CREBBP):c.4792del (p.Ser1598fs)1387CREBBPPathogenicrs587783500RCV000145762; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637818753781875CTC16:g.3781875_3781875delClinGen:CA271422
NC_000016.9:g.(?_3786017)_(3786836_?)dup1387CREBBPLikely pathogenic-1RCV000707788; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637860173786836nana-C0035934 180849 Rubinstein-Taybi syndrome;
NM_004380.3(CREBBP):c.4728+2del1387CREBBPPathogenicrs1596803811RCV000856921; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637860353786035TAT16:g.3786035_3786035del-
NM_004380.3(CREBBP):c.4689del (p.Lys1565fs)1387CREBBPPathogenicrs587783499RCV000145760; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637860763786076TCT16:g.3786076_3786076delClinGen:CA271421
NM_004380.3(CREBBP):c.4663G>T (p.Glu1555Ter)1387CREBBPPathogenicrs1555472931RCV000632996; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637861023786102CA16:g.3786102C>AClinGen:CA394562323
NM_004380.3(CREBBP):c.4660A>T (p.Lys1554Ter)1387CREBBPPathogenicrs1567269316RCV000754903; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637861053786105TA16:g.3786105T>A-
NM_004380.3(CREBBP):c.4644_4646dup (p.Leu1549dup)1387CREBBPPathogenicrs1596804073RCV000856920; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637861183786119TTAAC16:g.3786118_3786119insAAC-
NM_004380.3(CREBBP):c.4642_4643GT[1] (p.Leu1549fs)1387CREBBPPathogenicrs1555472938RCV000538610; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637861203786121AACA16:g.3786120_3786121delClinGen:CA658658388C0035934 180849 Rubinstein-Taybi syndrome;
NM_004380.3(CREBBP):c.4613C>T (p.Pro1538Leu)1387CREBBPLikely pathogenicrs1596804126RCV000856919; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637861523786152GA16:g.3786152G>A-
NC_000016.9:g.(?_3786631)_(3790570_?)dup1387CREBBPLikely pathogenic-1RCV000633006; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637866313790570nana-
NM_004380.3(CREBBP):c.4559A>T (p.Lys1520Met)1387CREBBPUncertain significancers1596805575RCV000856918; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637866523786652TA16:g.3786652T>A-
NM_004380.3(CREBBP):c.4508A>G (p.Tyr1503Cys)1387CREBBPPathogenicrs587783497RCV000145757; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637867033786703TC16:g.3786703T>CClinGen:CA271419
NM_004380.3(CREBBP):c.4460A>G (p.His1487Arg)1387CREBBPLikely pathogenicrs1596805792RCV000856917; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637867513786751TC16:g.3786751T>C-
NM_004380.3(CREBBP):c.4459C>T (p.His1487Tyr)1387CREBBPUncertain significancers1057519207RCV000416059|RCV000856916; NMedGen:CN517202|MONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637867523786752GA16:g.3786752G>AClinGen:CA16043855CN517202 not provided;
NM_004380.3(CREBBP):c.4458_4459insT (p.His1487fs)1387CREBBPPathogenicrs1596805807RCV000856915; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637867523786753GGA16:g.3786752_3786753insA-
NM_004380.3(CREBBP):c.4445A>G (p.Tyr1482Cys)1387CREBBPLikely pathogenicrs587783496RCV000145756; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637867663786766TC16:g.3786766T>CClinGen:CA271417
NM_004380.3(CREBBP):c.4444T>G (p.Tyr1482Asp)1387CREBBPPathogenicrs587783495RCV000145755; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637867673786767AC16:g.3786767A>CClinGen:CA271415
NM_004380.3(CREBBP):c.4439A>G (p.Asp1480Gly)1387CREBBPPathogenic/Likely pathogenicrs886041286RCV000334678|RCV000850544; NMedGen:CN517202|MONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637867723786772TC16:g.3786772T>CClinGen:CA10603272
NM_004380.3(CREBBP):c.4436_4438del (p.Gly1479del)1387CREBBPLikely pathogenicrs1555473122RCV000677660; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637867733786775TCTCT16:g.3786773_3786775del-
NM_004380.3(CREBBP):c.4421_4422delinsTC (p.Cys1474Phe)1387CREBBPUncertain significancers1555473126RCV000632992; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637867893786790ACGANC_000016.9:g.3786789_3786790delinsGAClinGen:CA658798528C0035934 180849 Rubinstein-Taybi syndrome;
NM_004380.3(CREBBP):c.4417G>A (p.Ala1473Thr)1387CREBBPLikely pathogenicrs1596805927RCV000856883; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637867943786794CT16:g.3786794C>T-
NM_004380.3(CREBBP):c.4398T>A (p.Tyr1466Ter)1387CREBBPPathogenicrs147688139RCV000145754; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637868133786813AT16:g.3786813A>TClinGen:CA271413
NM_004380.3(CREBBP):c.4394+3_4394+7del1387CREBBPUncertain significancers1596810185RCV000856882; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637885533788557AAACTCA16:g.3788553_3788557del-
NM_004380.3(CREBBP):c.4376A>G (p.Glu1459Gly)1387CREBBPLikely pathogenicrs587783494RCV000145753; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637885783788578TC16:g.3788578T>CClinGen:CA271411
NM_004380.3(CREBBP):c.4303G>T (p.Asp1435Tyr)1387CREBBPLikely pathogenicrs1596810419RCV000856881; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637886513788651CA16:g.3788651C>A-
NM_004380.3(CREBBP):c.4297T>C (p.Tyr1433His)1387CREBBPLikely pathogenicrs1596810435RCV000856880; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637886573788657AG16:g.3788657A>G-
NM_004380.3(CREBBP):c.4290C>A (p.Tyr1430Ter)1387CREBBPPathogenicrs1596810465RCV000856879; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637886643788664GT16:g.3788664G>T-
NM_004380.3(CREBBP):c.4283G>C (p.Arg1428Pro)1387CREBBPLikely pathogenicrs778448390RCV000856878; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637886713788671CG16:g.3788671C>G-
NM_004380.3(CREBBP):c.4281G>T (p.Arg1427Ser)1387CREBBPLikely pathogenicrs797045494RCV000195137; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637886733788673CA16:g.3788673C>AClinGen:CA277444
NM_004380.3(CREBBP):c.4281-11C>G1387CREBBPLikely pathogenicrs587783493RCV000145752; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637886843788684GC16:g.3788684G>CClinGen:CA271410
NM_004380.3(CREBBP):c.4279A>G (p.Arg1427Gly)1387CREBBPUncertain significancers794727401RCV000176558|RCV000856877; NMedGen:CN517202|MONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637895803789580TC16:g.3789580T>CClinGen:CA242550CN169374 not specified;
NM_004380.3(CREBBP):c.4277C>G (p.Thr1426Arg)1387CREBBPLikely pathogenicrs145988918RCV000856876; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637895823789582GC16:g.3789582G>C-
NM_004380.3(CREBBP):c.4262G>T (p.Cys1421Phe)1387CREBBPLikely pathogenic-1RCV001249613; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637895973789597CA16:g.3789597C>A-
NM_004380.3(CREBBP):c.4243C>T (p.Gln1415Ter)1387CREBBPPathogenicrs1596812202RCV000856875; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637896163789616GA16:g.3789616G>A-
NM_004380.3(CREBBP):c.4230dup (p.Gly1411fs)1387CREBBPPathogenicrs1555473668RCV000632995; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637896283789629CCA16:g.3789628_3789629insAClinGen:CA658798529C0035934 180849 Rubinstein-Taybi syndrome;
NM_004380.3(CREBBP):c.4226T>C (p.Phe1409Ser)1387CREBBPLikely pathogenicrs587783492RCV000145750; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637896333789633AG16:g.3789633A>GClinGen:CA271408
NM_004380.3(CREBBP):c.4206del (p.Ile1402fs)1387CREBBPPathogenicrs1596812256RCV000856783; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637896533789653CAC16:g.3789653_3789653del-
NM_004380.3(CREBBP):c.4175G>T (p.Arg1392Leu)1387CREBBPLikely pathogenicrs1596812290RCV000856874; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637896843789684CA16:g.3789684C>A-
NM_004380.3(CREBBP):c.4174C>T (p.Arg1392Ter)1387CREBBPPathogenicrs1596812306RCV000856873; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637896853789685GA16:g.3789685G>A-
NM_004380.3(CREBBP):c.4145C>T (p.Ser1382Phe)1387CREBBPLikely pathogenicrs149877180RCV000856872; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637897143789714GA16:g.3789714G>A-
NM_004380.3(CREBBP):c.4134-1G>T1387CREBBPLikely pathogenicrs886041048RCV000258851; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637897263789726CA16:g.3789726C>AClinGen:CA10602670
NM_004380.3(CREBBP):c.4133+1G>A1387CREBBPPathogenicrs587783491RCV000145749; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637903993790399CT16:g.3790399C>TClinGen:CA271407
NM_004380.3(CREBBP):c.4133G>C (p.Arg1378Pro)1387CREBBPPathogenicrs121434626RCV000010037; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637904003790400CG16:g.3790400C>GClinGen:CA254813,UniProtKB:Q92793#VAR_015578,OMIM:600140.0003C0035934 180849 Rubinstein-Taybi syndrome;
NM_004380.3(CREBBP):c.4078dup (p.Arg1360fs)1387CREBBPPathogenicrs1596813570RCV000856871; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637904543790455CCG16:g.3790454_3790455insG-
NM_004380.3(CREBBP):c.4078C>T (p.Arg1360Ter)1387CREBBPPathogenicrs587783490RCV000145748; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637904553790455GA16:g.3790455G>AClinGen:CA271405C0035934 180849 Rubinstein-Taybi syndrome;
NM_004380.3(CREBBP):c.4045C>T (p.Gln1349Ter)1387CREBBPPathogenicrs587783489RCV000145747; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637904883790488GA16:g.3790488G>AClinGen:CA271403
NM_004380.3(CREBBP):c.4040G>C (p.Arg1347Pro)1387CREBBPLikely pathogenicrs1596813665RCV000856870; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637904933790493CG16:g.3790493C>G-
NM_004380.3(CREBBP):c.4022G>C (p.Arg1341Pro)1387CREBBPLikely pathogenicrs587783488RCV000145746; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637905113790511CG16:g.3790511C>GClinGen:CA271401
NM_004380.3(CREBBP):c.3989A>G (p.Gln1330Arg)1387CREBBPUncertain significancers587783487RCV000145745; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637905443790544TC16:g.3790544T>CClinGen:CA271399
NM_004380.3(CREBBP):c.3983-2A>G1387CREBBPPathogenicrs587783486RCV000145744; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637905523790552TC16:g.3790552T>CClinGen:CA271398
NC_000016.10:g.(?_3744874)_(3758992_?)del1387CREBBPLikely pathogenic-1RCV000633005; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637948753808993nana-C0035934 180849 Rubinstein-Taybi syndrome;
NM_004380.3(CREBBP):c.3982+3A>T1387CREBBPLikely pathogenicrs1596823180RCV000989508; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637948923794892TA16:g.3794892T>A-
NM_004380.3(CREBBP):c.3982+1G>A1387CREBBPPathogenicrs398124145RCV000081051|RCV000499536; NMedGen:CN517202|MONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637948943794894CT16:g.3794894C>TClinGen:CA222694CN517202 not provided;
GRCh37/hg19 16p13.3(chr16:3794894-3795355)1387CREBBPPathogenic-1RCV000754906; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637948943795355nana-
NM_004380.3(CREBBP):c.3977del (p.Ala1326fs)1387CREBBPPathogenicrs1567276741RCV000686230; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637949003794900AGA16:g.3794900_3794900del-
NM_004380.3(CREBBP):c.3914+3G>T1387CREBBPLikely pathogenicrs587783485RCV000145743; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637952753795275CA16:g.3795275C>AClinGen:CA271397
NM_004380.3(CREBBP):c.3914+1G>T1387CREBBPPathogenicrs1555475352RCV000502986; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637952773795277CA16:g.3795277C>AClinGen:CA394566710
NM_004380.3(CREBBP):c.3914+1G>A1387CREBBPPathogenicrs1555475352RCV000856869; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637952773795277CT16:g.3795277C>T-
NM_004380.3(CREBBP):c.3892T>C (p.Tyr1298His)1387CREBBPUncertain significance-1RCV001196918; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637953003795300AG16:g.3795300A>G-
NM_004380.3(CREBBP):c.3837-2A>T1387CREBBPPathogenicrs1567277287RCV000010041; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637953573795357TA16:g.3795357T>AOMIM:600140.0007
NC_000016.9:g.(?_3799608)_(3821007_?)dup1387CREBBPPathogenic-1RCV000707927; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637996083821007nana-C0035934 180849 Rubinstein-Taybi syndrome;
NM_004380.3(CREBBP):c.3836+1G>A1387CREBBPPathogenicrs200782888RCV000145741; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637996273799627CT16:g.3799627C>TClinGen:CA271396
NM_004380.3(CREBBP):c.3836+1G>C1387CREBBPPathogenicrs200782888RCV000688322; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637996273799627CG16:g.3799627C>G-C0035934 180849 Rubinstein-Taybi syndrome;
NM_004380.3(CREBBP):c.3832G>A (p.Glu1278Lys)1387CREBBPPathogenic/Likely pathogenicrs267606752RCV000010040|RCV000255660|RCV001260694|RCV001267080; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783|MedGen:CN517202|Human Phenotype Ontology:HP:0000730,Human Phenotype Ontology:HP:0001249,Human Phenotype Ontology:HP:0001267,Human Phenotype Ontology:HP:0001286,Human Phenotype 1637996323799632CT16:g.3799632C>TUniProtKB:Q92793#VAR_035080,OMIM:600140.0006,ClinGen:CA254815CN517202 not provided;
NM_004380.3(CREBBP):c.3832del (p.Glu1278fs)1387CREBBPPathogenicrs1596834998RCV000856914; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831637996323799632TCT16:g.3799632_3799632del-
NM_004380.3(CREBBP):c.3779+1G>A1387CREBBPPathogenicrs587783483RCV000145739|RCV000255068|RCV001260696; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783|MedGen:CN517202|Human Phenotype Ontology:HP:0000730,Human Phenotype Ontology:HP:0001249,Human Phenotype Ontology:HP:0001267,Human Phenotype Ontology:HP:0001286,Human Phenotype 1638017263801726CT16:g.3801726C>TClinGen:CA271393CN517202 not provided;
NM_004380.3(CREBBP):c.3779+1G>T1387CREBBPPathogenicrs587783483RCV000856913; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638017263801726CA16:g.3801726C>A-
NM_004380.3(CREBBP):c.3779+1G>C1387CREBBPPathogenic-1RCV001252207; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638017263801726CG16:g.3801726C>G-
NM_004380.3(CREBBP):c.3719G>A (p.Cys1240Tyr)1387CREBBPLikely pathogenicrs1596839714RCV000856912; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638017873801787CT16:g.3801787C>T-
NM_004380.3(CREBBP):c.3698+5G>T1387CREBBPUncertain significancers1596852349RCV000856911; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638072843807284CA16:g.3807284C>A-
NM_004380.3(CREBBP):c.3698G>A (p.Arg1233Lys)1387CREBBPLikely pathogenicrs1057518844RCV000415361|RCV001198296; NHuman Phenotype Ontology:HP:0001172,MONDO:MONDO:0008561,MedGen:C4759712,OMIM:188100; Human Phenotype Ontology:HP:0000501,MONDO:MONDO:0005041,MedGen:C0017601|MONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638072893807289CT16:g.3807289C>TClinGen:CA16043514
NM_004380.3(CREBBP):c.3690T>G (p.Tyr1230Ter)1387CREBBPPathogenicrs748451307RCV000856910; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638072973807297AC16:g.3807297A>C-
NM_004380.3(CREBBP):c.3661_3665del (p.Ile1221fs)1387CREBBPPathogenicrs1596852443RCV000856909; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638073223807326AGGAATA16:g.3807322_3807326del-
NM_004380.3(CREBBP):c.3659_3660delinsATGGTA (p.Thr1220fs)1387CREBBPPathogenicrs1596852463RCV000856908; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638073273807328GGTACCAT16:g.3807327_3807328insACCAT-
NM_004380.3(CREBBP):c.3625C>T (p.Gln1209Ter)1387CREBBPPathogenicrs1596852578RCV000856907; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638073623807362GA16:g.3807362G>A-
NM_004380.3(CREBBP):c.3613G>T (p.Glu1205Ter)1387CREBBPPathogenicrs587783482RCV000145738; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638073743807374CA16:g.3807374C>AClinGen:CA271391
NM_004380.3(CREBBP):c.3610-1G>C1387CREBBPPathogenicrs1596852670RCV000856905; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638073783807378CG16:g.3807378C>G-
NM_004380.3(CREBBP):c.3610-2A>G1387CREBBPPathogenicrs1596852674RCV000856906; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638073793807379TC16:g.3807379T>C-
NM_004380.3(CREBBP):c.3598del (p.Cys1200fs)1387CREBBPPathogenic-1RCV001261356; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638078213807821CAC16:g.3807821_3807821del-
NM_004380.3(CREBBP):c.3495_3575del (p.Trp1165_Val1192delinsCys)1387CREBBPLikely pathogenicrs1596853925RCV001027692; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638078443807924GACAGGGTCAATTTCCTGCTCAAAGACCTCTGCAAGCTTACTGCAAAACTTATAGACTCGGGATGTCTTGCGATTATAGAGCG16:g.3807844_3807924del-
NM_004380.3(CREBBP):c.3535A>G (p.Ser1179Gly)1387CREBBPLikely pathogenicrs1596854023RCV000856904; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638078843807884TC16:g.3807884T>C-
NM_004380.3(CREBBP):c.3524A>G (p.Tyr1175Cys)1387CREBBPLikely pathogenicrs28937315RCV000010039; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638078953807895TC16:g.3807895T>CClinGen:CA254814,UniProtKB:Q92793#VAR_037305,OMIM:600140.0005C0035934 180849 Rubinstein-Taybi syndrome;
NM_004380.3(CREBBP):c.3512C>G (p.Thr1171Arg)1387CREBBPLikely pathogenic-1RCV000760233; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638079073807907GC16:g.3807907G>C-
NM_004380.3(CREBBP):c.3500A>G (p.Tyr1167Cys)1387CREBBPConflicting interpretations of pathogenicityrs587783481RCV000145737; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638079193807919TC16:g.3807919T>CClinGen:CA271389
NM_004380.3(CREBBP):c.3490G>C (p.Ala1164Pro)1387CREBBPLikely pathogenicrs797045492RCV000192723|RCV001261355; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783|1638079293807929CG16:g.3807929C>GClinGen:CA277012C0035934 180849 Rubinstein-Taybi syndrome;
NM_004380.3(CREBBP):c.3461dup (p.Asp1155fs)1387CREBBPPathogenicrs797045490RCV000194047; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638079573807958CCA16:g.3807957_3807958insAClinGen:CA277251
NM_004380.3(CREBBP):c.3436C>T (p.Gln1146Ter)1387CREBBPPathogenicrs797045489RCV000192840; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638079833807983GA16:g.3807983G>AClinGen:CA277030
NM_004380.3(CREBBP):c.3432_3433del (p.Gly1145fs)1387CREBBPPathogenicrs1596854369RCV000856903; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638079863807987CCTC16:g.3807986_3807987del-
NM_004380.3(CREBBP):c.3369+1G>T1387CREBBPPathogenic/Likely pathogenicrs587783480RCV000145736|RCV001268616; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783|MedGen:CN5172021638088543808854CA16:g.3808854C>AClinGen:CA271388C0035934 180849 Rubinstein-Taybi syndrome;
NM_004380.3(CREBBP):c.3366dup (p.Pro1123fs)1387CREBBPPathogenicrs1596856176RCV000856868; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638088573808858GGA16:g.3808857_3808858insA-
NM_004380.3(CREBBP):c.3330_3334del (p.Phe1111fs)1387CREBBPPathogenicrs1596856285RCV000856867; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638088903808894CGGAAAC16:g.3808890_3808894del-
NM_004380.3(CREBBP):c.3310C>T (p.Gln1104Ter)1387CREBBPPathogenicrs587783479RCV000145735; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638089143808914GA16:g.3808914G>AClinGen:CA271386
NM_004380.3(CREBBP):c.3292del (p.Thr1097_Leu1098insTer)1387CREBBPPathogenicrs1596856390RCV000856866; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638089323808932AGA16:g.3808932_3808932del-
NM_004380.3(CREBBP):c.3190G>A (p.Glu1064Lys)1387CREBBPUncertain significancers886041006RCV000258504; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638177813817781CT16:g.3817781C>TClinGen:CA10602613C0035934 180849 Rubinstein-Taybi syndrome;
NM_004380.3(CREBBP):c.3168dup (p.Val1057fs)1387CREBBPPathogenicrs1596878700RCV000856865; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638178023817803CCT16:g.3817802_3817803insT-
NM_004380.3(CREBBP):c.3097A>T (p.Lys1033Ter)1387CREBBPPathogenicrs1596878921RCV000856864; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638178743817874TA16:g.3817874T>A-
NM_001079846.1(CREBBP):c.2963_2971delinsAA (p.Leu988_Ala991delinsTer)1387CREBBPPathogenicrs797045488RCV000194630; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638178863817894CTCCTTGCATT16:g.3817887_3817894delClinGen:CA277351
NM_004380.3(CREBBP):c.3061-1G>T1387CREBBPPathogenicrs1555481030RCV000661965; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638179113817911CA16:g.3817911C>A-
NM_004380.3(CREBBP):c.3060+1G>T1387CREBBPPathogenicrs1596882004RCV000856863; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638191743819174CA16:g.3819174C>A-
NM_004380.3(CREBBP):c.3058G>T (p.Glu1020Ter)1387CREBBPPathogenicrs1596882010RCV000856862; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638191773819177CA16:g.3819177C>A-
NM_004380.3(CREBBP):c.3020_3021dup (p.Pro1008fs)1387CREBBPPathogenicrs1596882124RCV000856861; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638192133819214GGCT16:g.3819213_3819214insCT-
NM_004380.3(CREBBP):c.2941G>A (p.Ala981Thr)1387CREBBPBenignrs61753380RCV000081042|RCV000509267|RCV000715867|RCV000870748; NMedGen:CN169374|MONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783|MedGen:C2711754|MONDO:MONDO:0019188,MedGen:C0035934,OMIM:PS180849, Orphanet:7831638192943819294CT16:g.3819294C>TClinGen:CA148113CN169374 not specified;
NM_004380.3(CREBBP):c.2911A>T (p.Arg971Ter)1387CREBBPPathogenicrs1374436403RCV000856860; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638193243819324TA16:g.3819324T>A-
NM_004380.3(CREBBP):c.2910dup (p.Arg971fs)1387CREBBPPathogenicrs1596882629RCV000856859; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638193243819325TTG16:g.3819324_3819325insG-
NM_004380.3(CREBBP):c.2854_2863dup (p.Gln955fs)1387CREBBPPathogenicrs1596885651RCV000856858; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638205873820588TTGGGCGTGCAC16:g.3820587_3820588insGGGCGTGCAC-
NM_004380.3(CREBBP):c.2817_2818delinsT (p.Ala940fs)1387CREBBPPathogenicrs1596885894RCV000856857; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638206333820634CCA16:g.3820634_3820634del-
NM_004380.3(CREBBP):c.2811G>A (p.Pro937=)1387CREBBPConflicting interpretations of pathogenicityrs146168040RCV000081041|RCV000145731|RCV000716121|RCV001085008; NMedGen:CN517202|MONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783|MedGen:C2711754|MONDO:MONDO:0019188,MedGen:C0035934,OMIM:PS180849, Orphanet:7831638206403820640CT16:g.3820640C>TClinGen:CA222687CN169374 not specified;
NM_004380.3(CREBBP):c.2810dup (p.Ser938fs)1387CREBBPPathogenicrs797045485RCV000194548; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638206403820641CCG16:g.3820640_3820641insGClinGen:CA277340
NM_004380.3(CREBBP):c.2791C>T (p.Gln931Ter)1387CREBBPPathogenicrs587783475RCV000145730; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638206603820660GA16:g.3820660G>AClinGen:CA271379
NM_004380.3(CREBBP):c.2787dup (p.Pro930fs)1387CREBBPPathogenicrs1596886048RCV000856856; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638206633820664GGC16:g.3820663_3820664insC-
NM_004380.3(CREBBP):c.2773C>T (p.Gln925Ter)1387CREBBPPathogenicrs1596886132RCV000856855; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638206783820678GA16:g.3820678G>A-
NM_004380.3(CREBBP):c.2728A>G (p.Thr910Ala)1387CREBBPBenign/Likely benignrs143247685RCV000022942|RCV000145728|RCV000421582|RCV000716234|RCV001087789|RCV001252206; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783|MedGen:CN169374|MedGen:CN517202|MedGen:C2711754|MONDO:MONDO:0019188,MedGen:C0035934,OMIM:PS180849, Orphanet:783|Human Phenotype Ontology:HP:0000730,Human Phenotype Ontology:HP:01638207233820723TC16:g.3820723T>CClinGen:CA171789,UniProtKB:Q92793#VAR_072917,OMIM:600140.0008CN517202 not provided;
NM_004380.3(CREBBP):c.2713_2719del (p.Ser905fs)1387CREBBPPathogenicrs1596886295RCV000856854; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638207323820738GGCACTGAG16:g.3820732_3820738del-
NM_001079846.1(CREBBP):c.2565_2576delinsCC (p.Ser856fs)1387CREBBPPathogenicrs797045484RCV000193709; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638207613820772TGCCCGGAAGACGG16:g.3820762_3820772delClinGen:CA277190
NM_004380.3(CREBBP):c.2679G>A (p.Ser893=)1387CREBBPUncertain significancers587783474RCV000145727; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638207723820772CT16:g.3820772C>TClinGen:CA271377
NM_004380.3(CREBBP):c.2678C>T (p.Ser893Leu)1387CREBBPBenign/Likely benignrs142047649RCV000081040|RCV000429335|RCV000716938|RCV000989509|RCV001086640; NMedGen:CN169374|MedGen:CN517202|MedGen:C2711754|MONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783|MONDO:MONDO:0019188,MedGen:C0035934,OMIM:PS180849, Orphanet:7831638207733820773GA16:g.3820773G>AClinGen:CA148111CN517202 not provided;
NM_001079846.1(CREBBP):c.2488_2489TC[2] (p.Leu831fs)1387CREBBPPathogenicrs587783473RCV000145726; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638208443820845GGAG16:g.3820844_3820845delClinGen:CA271376
NM_004380.3(CREBBP):c.2606T>C (p.Leu869Pro)1387CREBBPUncertain significancers587783472RCV000145725; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638208453820845AG16:g.3820845A>GClinGen:CA271374
NM_004380.3(CREBBP):c.2557C>A (p.Leu853Met)1387CREBBPUncertain significance-1RCV001197022; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638208943820894GT16:g.3820894G>T-
NM_004380.3(CREBBP):c.2535C>A (p.Cys845Ter)1387CREBBPPathogenicrs587783471RCV000145724; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638209163820916GT16:g.3820916G>TClinGen:CA271372
NM_004380.3(CREBBP):c.2530C>T (p.Pro844Ser)1387CREBBPUncertain significance-1RCV001253247; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638209213820921GA16:g.3820921G>A-
NM_004380.3(CREBBP):c.2505G>T (p.Met835Ile)1387CREBBPUncertain significance-1RCV001197473; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638209463820946CA16:g.3820946C>A-
NM_004380.3(CREBBP):c.2505G>A (p.Met835Ile)1387CREBBPUncertain significance-1RCV001199275; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638209463820946CT16:g.3820946C>T-
NM_004380.3(CREBBP):c.2456dup (p.Ser820fs)1387CREBBPPathogenicrs1596894889RCV000856902; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638237583823759CCA16:g.3823758_3823759insA-
NM_004380.3(CREBBP):c.2420G>C (p.Ser807Thr)1387CREBBPUncertain significance-1RCV001198921; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638237953823795CG16:g.3823795C>G-
NM_004380.3(CREBBP):c.2417T>G (p.Met806Arg)1387CREBBPUncertain significancers1596895058RCV000856901; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638237983823798AC16:g.3823798A>C-
NM_004380.3(CREBBP):c.2417T>C (p.Met806Thr)1387CREBBPUncertain significance-1RCV001270737; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638237983823798AG16:g.3823798A>G-
NM_004380.3(CREBBP):c.2383_2400dup (p.Pro795_Pro800dup)1387CREBBPLikely benignrs1596895167RCV000989510; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638238143823815AACGGGAACTGGTTCTGTGG16:g.3823814_3823815insCGGGAACTGGTTCTGTGG-
NM_004380.3(CREBBP):c.2330del (p.Gly777fs)1387CREBBPPathogenicrs1596895500RCV000856900; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638238853823885ACA16:g.3823885_3823885del-
NM_004380.3(CREBBP):c.2314C>A (p.Pro772Thr)1387CREBBPUncertain significancers1555482779RCV000625604; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638239013823901GT16:g.3823901G>TClinGen:CA394553093C0035934 180849 Rubinstein-Taybi syndrome;
NM_004380.3(CREBBP):c.2312A>G (p.Gln771Arg)1387CREBBPUncertain significancers147805823RCV000081037|RCV000764069; NMedGen:CN517202|MONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638239033823903TC16:g.3823903T>CClinGen:CA222683CN169374 not specified;
NM_004380.3(CREBBP):c.2193C>T (p.Asn731=)1387CREBBPLikely benignrs746813014RCV000633002; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638246603824660GA16:g.3824660G>AClinGen:CA7870214
NM_004380.3(CREBBP):c.2178dup (p.Met727fs)1387CREBBPPathogenicrs797045483RCV000192496; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638246743824675TTG16:g.3824674_3824675insGClinGen:CA276978
NM_004380.3(CREBBP):c.2159-1G>T1387CREBBPPathogenicrs1596897799RCV000856899; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638246953824695CA16:g.3824695C>A-
NM_004380.3(CREBBP):c.2141G>T (p.Arg714Leu)1387CREBBPUncertain significancers141098117RCV000632993; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638276313827631CA16:g.3827631C>AClinGen:CA394554059C0035934 180849 Rubinstein-Taybi syndrome;
NM_004380.3(CREBBP):c.2122_2123del (p.Leu708fs)1387CREBBPPathogenicrs587783470RCV000145723; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638276493827650CAGC16:g.3827649_3827650delClinGen:CA271371
NM_004380.3(CREBBP):c.2031del (p.Ile678fs)1387CREBBPLikely pathogenicrs1555483716RCV000624200; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638280943828094TGT16:g.3828094_3828094delClinGen:CA658798530
NM_004380.3(CREBBP):c.2026del (p.Gln676fs)1387CREBBPPathogenicrs587783469RCV000145722; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638280993828099TGT16:g.3828099_3828099delClinGen:CA271370
NM_004380.3(CREBBP):c.1977C>A (p.Tyr659Ter)1387CREBBPPathogenic-1RCV001253817; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638281483828148GT16:g.3828148G>T-
NM_004380.3(CREBBP):c.1955A>C (p.His652Pro)1387CREBBPUncertain significancers587783468RCV000145721; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638281703828170TG16:g.3828170T>GClinGen:CA271368
NM_004380.3(CREBBP):c.1941+2T>C1387CREBBPPathogenicrs1596909656RCV000856898; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638286993828699AG16:g.3828699A>G-
NM_004380.3(CREBBP):c.1941+1G>A1387CREBBPPathogenicrs1555483834RCV000632994; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638287003828700CT16:g.3828700C>TClinGen:CA394555078
NM_004380.3(CREBBP):c.1941+1G>T1387CREBBPPathogenicrs1555483834RCV000754898; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638287003828700CA16:g.3828700C>A-
NM_004380.3(CREBBP):c.1917dup (p.Met640fs)1387CREBBPPathogenicrs1567306142RCV000692076; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638287243828725TTG16:g.3828724_3828725insG-
NM_004380.3(CREBBP):c.1907_1912del (p.Val636_Glu637del)1387CREBBPPathogenicrs1596909791RCV000856897; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638287303828735CCTTCCAC16:g.3828730_3828735del-
NM_004380.3(CREBBP):c.1824-1G>A1387CREBBPPathogenicrs1596910004RCV000856896; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638288193828819CT16:g.3828819C>T-
NM_004380.3(CREBBP):c.1823T>C (p.Leu608Pro)1387CREBBPLikely pathogenic-1RCV001249727; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638307333830733AG16:g.3830733A>G-
NM_004380.3(CREBBP):c.1821del (p.Lys607fs)1387CREBBPPathogenicrs587783467RCV000145719; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638307353830735GTG16:g.3830735_3830735delClinGen:CA271367
NM_004380.3(CREBBP):c.1801C>T (p.Arg601Trp)1387CREBBPLikely pathogenicrs1354934373RCV000856895; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638307553830755GA16:g.3830755G>A-
NM_004380.3(CREBBP):c.1732C>T (p.Pro578Ser)1387CREBBPConflicting interpretations of pathogenicityrs148023511RCV000153119|RCV000719668|RCV000764070; NMedGen:CN517202|MedGen:C2711754|MONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638308243830824GA16:g.3830824G>AClinGen:CA233869CN169374 not specified;
NM_004380.3(CREBBP):c.1694del (p.Gly565fs)1387CREBBPPathogenicrs1596916327RCV000989511; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638308623830862GCG16:g.3830862_3830862del-
NM_004380.3(CREBBP):c.1646C>G (p.Ser549Ter)1387CREBBPPathogenicrs1596917200RCV000856894; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638312353831235GC16:g.3831235G>C-
NM_004380.3(CREBBP):c.1590del (p.Asn530fs)1387CREBBPPathogenicrs587783465RCV000145717; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638312913831291TGT16:g.3831291_3831291delClinGen:CA271364
NM_004380.3(CREBBP):c.1573+1G>A1387CREBBPPathogenicrs1596920360RCV000856893; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638326843832684CT16:g.3832684C>T-
NM_001079846.1(CREBBP):c.1446_1447TC[1] (p.Leu483fs)1387CREBBPPathogenicrs1567309482RCV000678969; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638326953832696TGAT16:g.3832695_3832696del-C0035934 180849 Rubinstein-Taybi syndrome;
NM_004380.3(CREBBP):c.1549C>T (p.Gln517Ter)1387CREBBPPathogenicrs1596920501RCV000856892|RCV001234331; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783|MONDO:MONDO:0019188,MedGen:C0035934,OMIM:PS180849, Orphanet:7831638327093832709GA16:g.3832709G>A-
NM_004380.3(CREBBP):c.1483C>T (p.Gln495Ter)1387CREBBPPathogenicrs1596920745RCV000856891; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638327753832775GA16:g.3832775G>A-
NM_004380.3(CREBBP):c.1447C>T (p.Arg483Ter)1387CREBBPPathogenicrs1555484797RCV000557340|RCV001268046; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783|MedGen:CN5172021638328113832811GA16:g.3832811G>AClinGen:CA394557681C0035934 180849 Rubinstein-Taybi syndrome;
NM_004380.3(CREBBP):c.1280_1281del (p.Cys427fs)1387CREBBPPathogenicrs1567316655RCV000754900; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638420313842032GACG16:g.3842031_3842032del-
NM_004380.3(CREBBP):c.1270C>T (p.Arg424Ter)1387CREBBPPathogenicrs587783464RCV000145716; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638420423842042GA16:g.3842042G>AClinGen:CA271362
NM_004380.3(CREBBP):c.1257G>A (p.Trp419Ter)1387CREBBPPathogenicrs587783463RCV000145715; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638420553842055CT16:g.3842055C>TClinGen:CA271360
NM_004380.3(CREBBP):c.1237C>T (p.Arg413Ter)1387CREBBPPathogenicrs1302427305RCV000501651|RCV000579110; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783|MedGen:CN5172021638420753842075GA16:g.3842075G>AClinGen:CA394560862
NM_004380.3(CREBBP):c.1225_1231del (p.Cys409fs)1387CREBBPPathogenicrs1596944340RCV000856890; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638420813842087GATGCACAG16:g.3842081_3842087del-
NM_004380.3(CREBBP):c.1216+2T>A1387CREBBPPathogenicrs1596947522RCV000856889; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638433853843385AT16:g.3843385A>T-
NM_004380.3(CREBBP):c.1213C>G (p.Gln405Glu)1387CREBBPUncertain significance-1RCV001249728; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638433903843390GC16:g.3843390G>C-
NM_004380.3(CREBBP):c.1156C>T (p.Arg386Ter)1387CREBBPPathogenicrs587783461RCV000145713; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638434473843447GA16:g.3843447G>AClinGen:CA271358C0035934 180849 Rubinstein-Taybi syndrome;
NM_004380.3(CREBBP):c.1149G>A (p.Pro383=)1387CREBBPConflicting interpretations of pathogenicityrs61759495RCV000081028|RCV000145712|RCV000716378|RCV000872923; NMedGen:CN169374|MONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783|MedGen:C2711754|MONDO:MONDO:0019188,MedGen:C0035934,OMIM:PS180849, Orphanet:7831638434543843454CT16:g.3843454C>TClinGen:CA148108CN169374 not specified;
NM_004380.3(CREBBP):c.1125_1126AG[3] (p.Val377fs)1387CREBBPPathogenicrs1596947732RCV000856853; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638434743843475CCCT16:g.3843474_3843475insCT-
NM_004380.3(CREBBP):c.1124del (p.Gly375fs)1387CREBBPPathogenicrs1596947743RCV000856852; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638434793843479TCT16:g.3843479_3843479del-
NM_004380.3(CREBBP):c.1108C>T (p.Arg370Ter)1387CREBBPPathogenicrs1384496494RCV000856851; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638434953843495GA16:g.3843495G>A-
NM_004380.3(CREBBP):c.1089T>C (p.His363=)1387CREBBPLikely benignrs969407052RCV000633003; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638435143843514AG16:g.3843514A>GClinGen:CA276986622C0035934 180849 Rubinstein-Taybi syndrome;
NM_004380.3(CREBBP):c.1069C>T (p.Gln357Ter)1387CREBBPPathogenicrs121434625RCV000010036; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638435343843534GA16:g.3843534G>AClinGen:CA254811,OMIM:600140.0002C0035934 180849 Rubinstein-Taybi syndrome;
NM_004380.3(CREBBP):c.1063C>T (p.Gln355Ter)1387CREBBPPathogenicrs587783460RCV000145711; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638435403843540GA16:g.3843540G>AClinGen:CA271356
NM_004380.3(CREBBP):c.1062dup (p.Gln355fs)1387CREBBPPathogenicrs1567318022RCV000754899; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638435403843541GGT16:g.3843540_3843541insT-
NM_004380.3(CREBBP):c.1044del (p.Glu349fs)1387CREBBPPathogenicrs1596948052RCV000856850; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638435593843559CAC16:g.3843559_3843559del-
NM_004380.3(CREBBP):c.998G>A (p.Gly333Glu)1387CREBBPLikely benign-1RCV001255819; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638436053843605CT16:g.3843605C>T-
NM_004380.3(CREBBP):c.997G>T (p.Gly333Ter)1387CREBBPPathogenicrs1596948165RCV000856849; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638436063843606CA16:g.3843606C>A-
NM_004380.3(CREBBP):c.967_974dup (p.Met325fs)1387CREBBPPathogenicrs1596984633RCV000856848; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638606043860605CCATATTTGG16:g.3860604_3860605insATATTTGG-
NM_004380.3(CREBBP):c.953C>A (p.Ser318Ter)1387CREBBPPathogenicrs587783516RCV000145784; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638606263860626GT16:g.3860626G>TClinGen:CA271443
NM_004380.3(CREBBP):c.859_860inv (p.Pro287Gly)1387CREBBPLikely pathogenic-1RCV001268960; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638607193860720GGCCNC_000016.9:g.3860719_3860720inv-
NM_004380.3(CREBBP):c.827_828dup (p.Gly277fs)1387CREBBPPathogenicrs797045502RCV000192380; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831638607503860751CCAA16:g.3860750_3860751insAAClinGen:CA276962
NM_004380.3(CREBBP):c.772A>G (p.Thr258Ala)1387CREBBPUncertain significancers1597053070RCV000856847; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831639003243900324TC16:g.3900324T>C-
NM_004380.3(CREBBP):c.758A>G (p.His253Arg)1387CREBBPLikely benign-1RCV001255802; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831639003383900338TC16:g.3900338T>C-
NM_004380.3(CREBBP):c.712G>C (p.Val238Leu)1387CREBBPLikely benignrs146887252RCV000175777|RCV000878810|RCV000989512; NMedGen:CN169374|MONDO:MONDO:0019188,MedGen:C0035934,OMIM:PS180849, Orphanet:783|MONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831639003843900384CG16:g.3900384C>GClinGen:CA241543CN169374 not specified;
NM_004380.3(CREBBP):c.662_698del (p.Gly221fs)1387CREBBPPathogenicrs1597053322RCV000856846; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831639003983900434GCCCTGCATGGCTGGAGTAGGGTACGGCATTCCAGCTCG16:g.3900398_3900434del-
NM_004380.3(CREBBP):c.668G>C (p.Gly223Ala)1387CREBBPUncertain significance-1RCV001196410; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831639004283900428CG16:g.3900428C>G-
NM_004380.3(CREBBP):c.613C>T (p.Gln205Ter)1387CREBBPPathogenicrs1597053504RCV000856845; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831639004833900483GA16:g.3900483G>A-
NM_004380.3(CREBBP):c.598C>T (p.Gln200Ter)1387CREBBPPathogenicrs587783509RCV000145774; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831639004983900498GA16:g.3900498G>AClinGen:CA271434
NM_004380.3(CREBBP):c.508C>T (p.Gln170Ter)1387CREBBPPathogenicrs1555496560RCV000527062; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831639005883900588GA16:g.3900588G>AClinGen:CA394560816
NM_004380.3(CREBBP):c.494_507del (p.Ser165fs)1387CREBBPPathogenicrs1597053795RCV000856844; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831639005893900602GTGACGTGGCAGGGCG16:g.3900589_3900602del-
NM_004380.3(CREBBP):c.472del (p.Gln158fs)1387CREBBPPathogenicrs1555496581RCV000548840; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831639006243900624TGT16:g.3900624_3900624delClinGen:CA658658390
NM_004380.3(CREBBP):c.437C>T (p.Ala146Val)1387CREBBPUncertain significancers1295662710RCV000856843; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831639006593900659GA16:g.3900659G>A-
NM_004380.3(CREBBP):c.406C>T (p.Gln136Ter)1387CREBBPPathogenicrs121434624RCV000010035; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831639006903900690GA16:g.3900690G>AClinGen:CA254809,OMIM:600140.0001C0035934 180849 Rubinstein-Taybi syndrome;
NM_004380.3(CREBBP):c.376G>T (p.Gly126Ter)1387CREBBPPathogenicrs1597054242RCV000856842; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831639007203900720CA16:g.3900720C>A-
NM_004380.3(CREBBP):c.348_349dup (p.Ala117fs)1387CREBBPPathogenicrs797045491RCV000195252; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831639007463900747GGCA16:g.3900746_3900747insCAClinGen:CA277466
NM_004380.3(CREBBP):c.316C>T (p.Gln106Ter)1387CREBBPPathogenicrs587783478RCV000145734; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831639007803900780GA16:g.3900780G>AClinGen:CA271384
NM_004380.3(CREBBP):c.299del (p.Gly100fs)1387CREBBPPathogenicrs587783477RCV000145733; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831639007973900797ACA16:g.3900797_3900797delClinGen:CA271383
NM_004380.3(CREBBP):c.286C>T (p.Gln96Ter)1387CREBBPPathogenicrs587783476RCV000145732; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831639008103900810GA16:g.3900810G>AClinGen:CA271381
NM_004380.3(CREBBP):c.282dup (p.Val95fs)1387CREBBPPathogenicrs797045486RCV000192951; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831639008133900814CCG16:g.3900813_3900814insGClinGen:CA277056
NM_004380.3(CREBBP):c.283G>A (p.Val95Met)1387CREBBPUncertain significancers756802946RCV000989513; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831639008133900813CT16:g.3900813C>T-
NM_004380.3(CREBBP):c.271G>T (p.Ala91Ser)1387CREBBPConflicting interpretations of pathogenicityrs200673670RCV000658735|RCV001198613; NMedGen:CN517202|MONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831639008253900825CA16:g.3900825C>A-CN517202 not provided;
NM_004380.3(CREBBP):c.258A>G (p.Ile86Met)1387CREBBPLikely benign-1RCV001255816; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831639008383900838TC16:g.3900838T>C-
NM_004380.3(CREBBP):c.243_244insTA (p.Ile82Ter)1387CREBBPPathogenicrs1597054662RCV000856841; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831639008523900853TTTA16:g.3900852_3900853insTA-
NM_004380.3(CREBBP):c.173_185del (p.Asn58fs)1387CREBBPPathogenicrs1597054837RCV000856840; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831639009113900923ATCTGGAACAAGGTA16:g.3900911_3900923del-
NM_004380.3(CREBBP):c.164A>G (p.Asn55Ser)1387CREBBPUncertain significancers587783466RCV000145718; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831639009323900932TC16:g.3900932T>CClinGen:CA271365
NM_004380.3(CREBBP):c.86-1G>T1387CREBBPPathogenicrs11644721RCV000193581; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831639010113901011CA16:g.3901011C>AClinGen:CA277172
NM_004380.3(CREBBP):c.86-2A>C1387CREBBPPathogenicrs587783515RCV000145783; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831639010123901012TG16:g.3901012T>GClinGen:CA271442
NC_000016.9:g.(?_3929813)_(4387545_?)dup1387CREBBPUncertain significance-1RCV000708038; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831639298134387545nana-
NM_004380.3(CREBBP):c.85+1G>A1387CREBBPLikely pathogenicrs1597099388RCV000850371; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831639298323929832CT16:g.3929832C>T-
NM_004380.2(CREBBP):c.(?_-23)_85+?del1387CREBBPPathogenic-1RCV000192615; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831639298333929940nana-1-
NM_004380.3(CREBBP):c.-204_85del (p.Met1fs)1387CREBBPPathogenicrs1567386034RCV000698529; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831639298333930121CCTGTGCTGTCATTCGCCGAGAAACCGGGCGAGCTGAGTTTGGCTCTTTTGGGGTTGGGCGGTCCGTCCAGCAAGTTCTCAGCCATTTTCACCTGCTCGCGAAAACAGCCC16:g.3929833_3929931del-
NM_004380.3(CREBBP):c.62G>A (p.Gly21Asp)1387CREBBPUncertain significance-1RCV001198521; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831639298563929856CT16:g.3929856C>T-
NM_004380.3(CREBBP):c.37A>G (p.Lys13Glu)1387CREBBPLikely pathogenicrs587783484RCV000145740; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831639298813929881TC16:g.3929881T>CClinGen:CA271394
NM_004380.3(CREBBP):c.2T>A (p.Met1Lys)1387CREBBPPathogenicrs797045487RCV000193780; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:7831639299163929916AT16:g.3929916A>TClinGen:CA277198
NM_001429.4(EP300):c.444G>A (p.Thr148=)2033EP300Likely benignrs376779611RCV000279884|RCV000908576; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783|MONDO:MONDO:0013364,MedGen:C3150941,OMIM:613684, Orphanet:353284, Orphanet:783; MONDO:MONDO:0005575,MedGen:C0009402,OMIM:114500224151354041513540GA22:g.41513540G>AClinGen:CA10252250C0035934 180849 Rubinstein-Taybi syndrome;
NM_001429.4(EP300):c.730-18_730-9del2033EP300Benignrs61120041RCV000079682|RCV000371284|RCV000546558; NMedGen:CN169374|MONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783|MONDO:MONDO:0013364,MedGen:C3150941,OMIM:613684, Orphanet:353284, Orphanet:783; MONDO:MONDO:0005575,MedGen:C0009402,OMIM:114500224152184941521858CTTTTGTTTCTC22:g.41521849_41521858delClinGen:CA147277C0699790 114500 Carcinoma of colon;
NM_001429.4(EP300):c.1516A>G (p.Met506Val)2033EP300Uncertain significancers886057556RCV000285290; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783224152762541527625AG22:g.41527625A>GClinGen:CA10651393
NM_001429.4(EP300):c.2091T>G (p.Ser697Arg)2033EP300Benign/Likely benignrs61756764RCV000120704|RCV000367429|RCV000551246|RCV001252243; NMedGen:CN169374|MONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783|MONDO:MONDO:0005575,MedGen:C0009402,OMIM:114500; MONDO:MONDO:0013364,MedGen:C3150941,OMIM:613684, Orphanet:353284, Orphanet:783|Human Phenotype Ontology:HP:0000730224154278041542780TG22:g.41542780T>GClinGen:CA158481C0699790 114500 Carcinoma of colon;
NM_001429.4(EP300):c.2242-6_2242-4del2033EP300Uncertain significancers747710183RCV000260663; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783224154502541545027GTTTG22:g.41545025_41545027delClinGen:CA10651396
NM_001429.4(EP300):c.2351C>T (p.Pro784Leu)2033EP300Likely benignrs201480900RCV000990449; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783224154515141545151CT22:g.41545151C>T-
NM_001429.4(EP300):c.2773C>A (p.Pro925Thr)2033EP300Benign/Likely benignrs148884710RCV000120708|RCV000294667|RCV000445350|RCV001080710; NMedGen:CN169374|MONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783|MedGen:CN517202|MONDO:MONDO:0005575,MedGen:C0009402,OMIM:114500; MONDO:MONDO:0013364,MedGen:C3150941,OMIM:613684, Orphanet:353284, Orphanet:783224154615841546158CA22:g.41546158C>AClinGen:CA158488CN517202 not provided;
NM_001429.4(EP300):c.3070_3071insT (p.Lys1024fs)2033EP300Pathogenicrs1601621506RCV000856773; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783224154828241548283AAT22:g.41548282_41548283insT-
NM_001429.4(EP300):c.3143-4del2033EP300Conflicting interpretations of pathogenicityrs757931697RCV000175159|RCV000297575; NMedGen:CN169374|MONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783224155098541550985CTC22:g.41550985_41550985delClinGen:CA201326CN169374 not specified;
NM_001429.4(EP300):c.3262-2A>G2033EP300Pathogenic/Likely pathogenicrs1555910114RCV000578180|RCV001034552; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783|MONDO:MONDO:0008965,MedGen:C0265354,OMIM:214800, Orphanet:138224155317141553171AG22:g.41553171A>GClinGen:CA411694508C0035934 180849 Rubinstein-Taybi syndrome;
NM_001429.4(EP300):c.3573T>A (p.Tyr1191Ter)2033EP300Likely pathogenicrs565779970RCV000190511|RCV000990451; NMONDO:MONDO:0013364,MedGen:C3150941,OMIM:613684, Orphanet:353284, Orphanet:783|MONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783224155448741554487TA22:g.41554487T>AClinGen:CA275975C3150941 613684 Rubinstein-Taybi syndrome 2;
NM_001429.4(EP300):c.3624C>G (p.Ile1208Met)2033EP300Uncertain significancers143660871RCV000990452; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783224155667941556679CG22:g.41556679C>G-
NM_001429.4(EP300):c.3707dup (p.Asn1236fs)2033EP300Pathogenicrs1601628237RCV000990453; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783224155875641558757GGA22:g.41558756_41558757insA-
NM_001429.4(EP300):c.3749G>A (p.Cys1250Tyr)2033EP300Likely pathogenicrs1601629319RCV000990454; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783224156007741560077GA22:g.41560077G>A-
NM_001429.4(EP300):c.4026G>A (p.Arg1342=)2033EP300Uncertain significancers146119145RCV000990455; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783224156472541564725GA22:g.41564725G>A-
NM_001429.4(EP300):c.4692dup (p.Arg1565Ter)2033EP300Likely pathogenicrs1601636935RCV000990456; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783224156970041569701GGT22:g.41569700_41569701insT-
NM_001429.4(EP300):c.6015_6028del (p.Gln2005fs)2033EP300Likely pathogenic-1RCV001261286; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783224157372941573742CAACTACAGTCTGGGC22:g.41573729_41573742del-
NM_001429.4(EP300):c.6437C>A (p.Pro2146His)2033EP300Uncertain significancers745528077RCV000661969; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783224157415241574152CA22:g.41574152C>A-
NM_001429.4(EP300):c.6798_6800del (p.Gln2268del)2033EP300Benign/Likely benignrs533875300RCV000120717|RCV000394928|RCV000514498|RCV001027440|RCV001086988; NMedGen:CN169374|MONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783|MedGen:CN517202|MONDO:MONDO:0013364,MedGen:C3150941,OMIM:613684, Orphanet:353284, Orphanet:783|MONDO:MONDO:0013364,MedGen:C3150941,OMIM:613684, Orphanet:353284,Orp224157451141574513TCAGT22:g.41574511_41574513delClinGen:CA158506
NM_001429.4(EP300):c.6912C>T (p.Ser2304=)2033EP300Likely benignrs113329190RCV000308663|RCV000883192; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783|MedGen:CN517202224157462741574627CT22:g.41574627C>TClinGen:CA10253974
NM_001429.4(EP300):c.7014_7028del (p.His2338_Pro2342del)2033EP300Uncertain significancers1601642386RCV000990457; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783224157472441574738TCCACACCACGTTTCCT22:g.41574724_41574738del-
NM_001429.4(EP300):c.*40_*44del2033EP300Uncertain significancers751376755RCV000356031; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783224157499841575002TTTCTCT22:g.41574998_41575002delClinGen:CA10254086
NM_001429.4(EP300):c.*340dup2033EP300Likely benignrs561569141RCV000326718; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783224157529241575293AAT22:g.41575292_41575293insTClinGen:CA10645611
NM_001429.4(EP300):c.*592dup2033EP300Uncertain significancers60283061RCV000293084; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783224157553741575538TTA22:g.41575537_41575538insAClinGen:CA10645613
NM_001429.4(EP300):c.*591_*592dup2033EP300Uncertain significancers60283061RCV000352830; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783224157553741575538TTAA22:g.41575537_41575538insAAClinGen:CA10653583
NM_001429.4(EP300):c.*592del2033EP300Uncertain significancers60283061RCV000397568; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783224157553841575538TAT22:g.41575538_41575538delClinGen:CA10645612
NM_001429.4(EP300):c.*745del2033EP300Uncertain significancers532524940RCV000280368; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783224157570541575705TGT22:g.41575705_41575705delClinGen:CA10654163
NM_001429.4(EP300):c.*785_*786del2033EP300Uncertain significancers886057577RCV000389987; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783224157574041575741ATTA22:g.41575740_41575741delClinGen:CA10653586C0035934 180849 Rubinstein-Taybi syndrome;
NM_001429.4(EP300):c.*921dup2033EP300Uncertain significancers1161532977RCV000401601; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783224157587541575876AAC22:g.41575875_41575876insCClinGen:CA10651410C0035934 180849 Rubinstein-Taybi syndrome;
NM_001429.4(EP300):c.*922_*932delinsC2033EP300Uncertain significancers886057580RCV000270725; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783224157588241575892ACTCACACACAC22:g.41575883_41575892delClinGen:CA10645616C0035934 180849 Rubinstein-Taybi syndrome;
NM_001429.4(EP300):c.*922_*932delinsCCC2033EP300Uncertain significancers886057580RCV000325816; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783224157588241575892ACTCACACACACCC22:g.41575883_41575892delClinGen:CA10645617C0035934 180849 Rubinstein-Taybi syndrome;
NM_001429.4(EP300):c.*922_*938delinsC2033EP300Uncertain significancers886057581RCV000366399; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783224157588241575898ACTCACACACACACACAC22:g.41575883_41575898delClinGen:CA10645622C0035934 180849 Rubinstein-Taybi syndrome;
NM_001429.4(EP300):c.*922_*942delinsCC2033EP300Uncertain significancers1555912616RCV000331628; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783224157588241575902ACTCACACACACACACACACACC22:g.41575883_41575902delClinGen:CA10651411C0035934 180849 Rubinstein-Taybi syndrome;
NM_001429.4(EP300):c.*922_*930delinsC2033EP300Uncertain significancers1555912614RCV000306058; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783224157588241575890ACTCACACAC22:g.41575883_41575890delClinGen:CA10653590C0035934 180849 Rubinstein-Taybi syndrome;
NM_001429.4(EP300):c.*922_*930delinsCCC2033EP300Uncertain significancers1555912614RCV000360762; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783224157588241575890ACTCACACACCC22:g.41575883_41575890delClinGen:CA10653591C0035934 180849 Rubinstein-Taybi syndrome;
NM_001429.4(EP300):c.*922_*942delinsC2033EP300Uncertain significancers1555912616RCV000271755; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783224157588241575902ACTCACACACACACACACACAC22:g.41575883_41575902delClinGen:CA10653594C0035934 180849 Rubinstein-Taybi syndrome;
NM_001429.4(EP300):c.*926_*927AC[23]2033EP300Uncertain significancers59721178RCV000278768; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783224157588441575885TTCACA22:g.41575884_41575885insCACAClinGen:CA10645628
NM_001429.4(EP300):c.*926_*927AC[22]2033EP300Uncertain significancers59721178RCV000373228; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783224157588441575885TTCA22:g.41575884_41575885insCAClinGen:CA10653598
NM_001429.4(EP300):c.*926_*927AC[20]2033EP300Uncertain significancers59721178RCV000337034; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783224157588541575886TCAT22:g.41575885_41575886delClinGen:CA10645629
NM_001429.4(EP300):c.*926_*927AC[18]2033EP300Uncertain significancers59721178RCV000395952; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783224157588541575890TCACACAT22:g.41575885_41575890delClinGen:CA10654168C0035934 180849 Rubinstein-Taybi syndrome;
NM_001429.4(EP300):c.*1083_*1085del2033EP300Likely benignrs561433394RCV000367957; NMONDO:MONDO:0008393,MedGen:C4551859,OMIM:180849, Orphanet:353277, Orphanet:783224157604141576043TTTCT22:g.41576041_41576043delClinGen:CA10654169
MSeqDR Portal