MSeqDR Mitochondrial Disease Portal


 
*:HP: HPO terms, UMDF: 1= Disease, ND: NAMDC terms.
  Most Studied  CPEO, Complex I Deficiency, COXPD1, Leigh, LHON, MELAS, MERRF, Myopathy, SANDO
Disease Browser
Parent Node:
expand
Abnormalities, Multiple (D000015)
Parent Node:
expand
Chromosome Disorders (D025063)
Parent Node:
expand
Intellectual Disability (D008607)
Parent Node:
expand
Obesity (D009765)
..Starting node
..expand
Prader-Willi Syndrome (D011218)

       Child Nodes:
........expandPrader-Willi habitus, osteopenia, and camptodactyly (C538276)
........expandPrader-Willi-Like Syndrome Associated With Chromosome 6 (C566764)



 Sister Nodes: 
..expandADIPONECTIN, SERUM LEVEL OF, QUANTITATIVE TRAIT LOCUS 2 (OMIM:606770)
..expandADIPONECTIN, SERUM LEVEL OF, QUANTITATIVE TRAIT LOCUS 3 (OMIM:606771)
..expandAyazi syndrome (C537793)
..expandBiemond syndrome II (C565902)
..expandBODY MASS INDEX QUANTITATIVE TRAIT LOCUS 10 (OMIM:607514)
..expandBODY MASS INDEX QUANTITATIVE TRAIT LOCUS 11 (OMIM:300306)
..expandBODY MASS INDEX QUANTITATIVE TRAIT LOCUS 12 (OMIM:612362)
..expandBODY MASS INDEX QUANTITATIVE TRAIT LOCUS 13 (OMIM:612459)
..expandBODY MASS INDEX QUANTITATIVE TRAIT LOCUS 14 (OMIM:612460)
..expandBODY MASS INDEX QUANTITATIVE TRAIT LOCUS 18 (OMIM:615457)
..expandBODY MASS INDEX QUANTITATIVE TRAIT LOCUS 4 (OMIM:607447)
..expandBODY MASS INDEX QUANTITATIVE TRAIT LOCUS 7 (OMIM:608410)
..expandBODY MASS INDEX QUANTITATIVE TRAIT LOCUS 8 (OMIM:603188)
..expandBODY MASS INDEX QUANTITATIVE TRAIT LOCUS 9 (OMIM:602025)
..expandBorjeson-Forssman-Lehmann syndrome (C536575)
..expandCamera Marugo Cohen syndrome (C537964)
..expandCHOPS SYNDROME (OMIM:616368)
..expandClark-Baraitser syndrome (C536208)
..expandCohen syndrome (C536438)
..expandColoboma-Obesity-Hypogenitalism-Mental Retardation Syndrome (C566623)
..expandFASTING INSULIN LEVEL QUANTITATIVE TRAIT LOCUS 1 (OMIM:606035)
..expandMacrosomia obesity macrocephaly ocular abnormalities (C535812)
..expandMEHMO syndrome (C537451)
..expandMidface Hypoplasia, Obesity, Developmental Delay, and Neonatal Hypotonia (C563896)
..expandMOMES Syndrome (C564660)
..expandMORM syndrome (C536984)
..expandObesity Hypoventilation Syndrome (D010845)
..expandObesity, Abdominal (D056128)
..expandObesity, Hyperphagia, and Developmental Delay (C563938)
..expandObesity, Metabolically Benign (D000067329)
..expandObesity, Morbid (D009767)
..expandPediatric Obesity (D063766)
..expandPrader-Willi Syndrome (D011218) Child2
..expandProlactin Deficiency with Obesity and Enlarged Testes (C564870)
..expandProopiomelanocortin Deficiency (C565726)
..expandProprotein Convertase 1 3 Deficiency (C563423)
..expandRETINAL DYSTROPHY AND OBESITY (OMIM:616188)
..expandShort Stature-Obesity Syndrome (C564821)
..expandVasquez Hurst Sotos syndrome (C536533)
..expandWilms Tumor, Aniridia, Genitourinary Anomalies, Mental Retardation, and Obesity Syndrome (C567292)
..expandWilson-Turner X-linked mental retardation syndrome (C536708)
..expandYoung Hughes syndrome (C536715)
   

Human Disease MESH is developed by UMLS.
Further data from MedGen, OMIM,ClinVar, CTD
Term ID:10139
Name:Prader-Willi Syndrome
Definition:An autosomal dominant disorder caused by deletion of the proximal long arm of the paternal chromosome 15 (15q11-q13) or by inheritance of both of the pair of chromosomes 15 from the mother (UNIPARENTAL DISOMY) which are imprinted (GENETIC IMPRINTING) and hence silenced. Clinical manifestations include MENTAL RETARDATION; MUSCULAR HYPOTONIA; HYPERPHAGIA; OBESITY; short stature; HYPOGONADISM; STRABISMUS; and HYPERSOMNOLENCE. (Menkes, Textbook of Child Neurology, 5th ed, p229)
Alternative IDs:DO:DOID:11983|OMIM:176270
ParentIDs:MESH:D000015|MESH:D008607|MESH:D009765|MESH:D025063
TreeNumbers:C10.597.606.360.690 |C16.131.077.730 |C16.131.260.700 |C16.320.180.700 |C18.654.726.500.740
Synonyms:Labhart Willi Prader Fanconi Syndrome |Labhart-Willi-Prader-Fanconi Syndrome |Labhart Willi Syndrome |Labhart-Willi Syndrome |Prader Labhart Willi Syndrome |Prader-Labhart-Willi Syndrome |PRADER-LABHART-WILLI SYNDROME PRADER-WILLI SYNDROME CHROMOSOME REGION, I
Slim Mappings:Congenital abnormality|Genetic disease (inborn)|Nervous system disease|Nutrition disorder
Reference: MedGen: D011218
MeSH: D011218
OMIM: 176270;
MSeqDR LSDB:  
Genes: NDN; SNRPN;
Phenotypes
1 HP:0012743Abdominal obesity
2 HP:0000846Adrenal insufficiencyHP:0040284
3 HP:0007874Almond-shaped palpebral fissureHP:0040282
4 HP:0007018Attention deficit hyperactivity disorderHP:0040282 Infantile onset
5 HP:0000717Autism
NAMDC:  Autism
HP:0040284
6 HP:0000670Carious teethHP:0040283
7 HP:0030084Clinodactyly
8 HP:0000060Clitoral hypoplasiaHP:0040282
9 HP:0000028CryptorchidismHP:0040284
10 HP:0000992Cutaneous photosensitivityHP:0040282
11 HP:0001558Decreased fetal movement
12 HP:0003199Decreased muscle massHP:0040282 Adult onset
13 HP:0000823Delayed puberty
NAMDC:  Prolonged pubertal growth spurt
HP:0040282
14 HP:0000750Delayed speech and language development
NAMDC:  Delayed language
HP:0040281
15 HP:0000268Dolichocephaly
16 HP:0002714Downturned corners of mouthHP:0040282
17 HP:0000565EsotropiaHP:0040283
18 HP:0001531Failure to thrive in infancyHP:0040281
19 HP:0002236Frontal upsweep of hairHP:0040283
20 HP:0007513Generalized hypopigmentation
21 HP:0001290Generalized hypotoniaHP:0040281 Neonatal onset
22 HP:0001263Global developmental delay
NAMDC:  Delayed development (evidence of at least one of A through F)
HP:0040281
23 HP:0001263Global developmental delay
NAMDC:  Mental retardation
HP:0040281
24 HP:0000824Growth hormone deficiencyHP:0040281
25 HP:0001385Hip dysplasiaHP:0040284
26 HP:0000842Hyperinsulinemia
27 HP:0000540Hypermetropia
28 HP:0000044Hypogonadotrophic hypogonadism
NAMDC:  Hypogonadotropic hypogonadism
HP:0040281
29 HP:0005599Hypopigmentation of hairHP:0040284
30 HP:0000064Hypoplastic labia minoraHP:0040282
31 HP:0002791Hypoventilation
32 HP:0007328Impaired pain sensationHP:0040282
33 HP:0000789InfertilityHP:0040281
34 HP:0007730Iris hypopigmentationHP:0040284
35 HP:0002808KyphosisHP:0040282
36 HP:0000054MicropenisHP:0040282
37 HP:0001270Motor delayHP:0040281
38 HP:0000545MyopiaHP:0040283
39 HP:0000341Narrow foreheadHP:0040282
40 HP:0000446Narrow nasal bridgeHP:0040282
41 HP:0004283Narrow palmHP:0040281
42 HP:0001611Nasal speechHP:0040282
43 HP:0000876OligomenorrheaHP:0040282
44 HP:0000938OsteopeniaHP:0040283
45 HP:0000939OsteoporosisHP:0040283
46 HP:0002591PolyphagiaHP:0040281 Infantile onset
47 HP:0007010Poor fine motor coordinationHP:0040283
48 HP:0007015Poor gross motor coordination
49 HP:0002033Poor suckHP:0040281
50 HP:0000826Precocious pubertyHP:0040284
51 HP:0000786Primary amenorrheaHP:0040284
52 HP:0000709PsychosisHP:0040284
53 HP:0009466Radial deviation of fingerHP:0040283
54 HP:0002205Recurrent respiratory infectionsHP:0040282
55 HP:0002650ScoliosisHP:0040282
56 HP:0000046Scrotal hypoplasiaHP:0040284
57 HP:0001250Seizures
NAMDC:  Seizures
HP:0040284
58 HP:0001773Short footHP:0040281
59 HP:0004279Short palmHP:0040281
60 HP:0004322Short stature
NAMDC:  Short stature (patient¡¯s height is below the 3rd percentile)
HP:0040281
61 HP:0010535Sleep apneaHP:0040282
62 HP:0200055Small hand
63 HP:0001328Specific learning disabilityHP:0040281
64 HP:0003745Sporadic
65 HP:0001159SyndactylyHP:0040283
66 HP:0005968Temperature instabilityHP:0040283
67 HP:0000219Thin upper lip vermilionHP:0040282
68 HP:0000219Thin upper lip vermilion
69 HP:0005978Type II diabetes mellitusHP:0040284 Young adult onset
70 HP:0000582Upslanted palpebral fissureHP:0040283
71 HP:0002119VentriculomegalyHP:0040282
Disease Causing ClinVar Variants
Variation_NameGeneIDGeneSymbolClinicalSignificancedbSNPRCVaccessionTestedInGTRPhenotypeIDsChromosomeStartStopHGVS_cHGVS_pHGVS_gOtherIDsDisease_ClinVar
NM_004667.5(HERC2):c.13612G>A (p.Val4538Met)8924HERC2Uncertain significancers149338352RCV000439219|RCV000763955; NMedGen:CN517202|MedGen:C1856895,OMIM:227220; MONDO:MONDO:0014224,MedGen:C3809753,OMIM:615516, Orphanet:329195; MONDO:MONDO:0008300,MedGen:C0032897,OMIM:176270, Orphanet:739152836068528360685CT15:g.28360685C>TClinGen:CA7439894CN169374 not specified;
NM_004667.6(HERC2):c.11701-1G>A8924HERC2Pathogenic-1RCV001198553; NMONDO:MONDO:0008300,MedGen:C0032897,OMIM:176270, Orphanet:739152838699328386993CT15:g.28386993C>T-
NM_004667.6(HERC2):c.10424C>T (p.Ser3475Phe)8924HERC2Uncertain significance-1RCV001197668; NMONDO:MONDO:0008300,MedGen:C0032897,OMIM:176270, Orphanet:739152841296328412963GA15:g.28412963G>A-
NM_004667.6(HERC2):c.8598C>G (p.Ile2866Met)8924HERC2Uncertain significance-1RCV001196468; NMONDO:MONDO:0008300,MedGen:C0032897,OMIM:176270, Orphanet:739152843616228436162GC15:g.28436162G>C-
NM_004667.6(HERC2):c.8012C>G (p.Ala2671Gly)8924HERC2Uncertain significance-1RCV001196115; NMONDO:MONDO:0008300,MedGen:C0032897,OMIM:176270, Orphanet:739152844171528441715GC15:g.28441715G>C-
NM_004667.6(HERC2):c.5351G>A (p.Arg1784His)8924HERC2Uncertain significance-1RCV001197669; NMONDO:MONDO:0008300,MedGen:C0032897,OMIM:176270, Orphanet:739152847347728473477CT15:g.28473477C>T-
NM_019066.5(MAGEL2):c.3131C>T (p.Ser1044Leu)54551MAGEL2Uncertain significance-1RCV001196510; NMONDO:MONDO:0008300,MedGen:C0032897,OMIM:176270, Orphanet:739152388975923889759GA15:g.23889759G>A-
NM_019066.5(MAGEL2):c.3017C>G (p.Thr1006Ser)54551MAGEL2Benign/Likely benignrs138628273RCV000173469|RCV000421322|RCV000755643; NMedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0014243,MedGen:C3809877,OMIM:615547; MONDO:MONDO:0008300,MedGen:C0032897,OMIM:176270, Orphanet:739152388987323889873GC15:g.23889873G>CClinGen:CA200555CN517202 not provided;
NM_019066.5(MAGEL2):c.2945_2946del (p.Leu981_Ser982insTer)54551MAGEL2Likely pathogenic-1RCV001195825; NMONDO:MONDO:0008300,MedGen:C0032897,OMIM:176270, Orphanet:739152388994423889945CAGC15:g.23889944_23889945del-
NM_019066.5(MAGEL2):c.1912C>T (p.Gln638Ter)54551MAGEL2Pathogenic/Likely pathogenicrs797044883RCV000190699|RCV000238706|RCV000508676|RCV000762935; NMeSH:D030342,MedGen:C0950123|MedGen:CN517202|MONDO:MONDO:0014243,MedGen:C3809877,OMIM:615547|MONDO:MONDO:0014243,MedGen:C3809877,OMIM:615547; MONDO:MONDO:0008300,MedGen:C0032897,OMIM:176270, Orphanet:739152389097823890978GA15:g.23890978G>AOMIM:605283.0008,ClinGen:CA204677C0950123 Inborn genetic diseases;
NM_019066.5(MAGEL2):c.1715C>T (p.Ala572Val)54551MAGEL2Uncertain significancers1064797195RCV000488318|RCV000765201; NMedGen:CN517202|MONDO:MONDO:0014243,MedGen:C3809877,OMIM:615547; MONDO:MONDO:0008300,MedGen:C0032897,OMIM:176270, Orphanet:739152389117523891175GA15:g.23891175G>AClinGen:CA16621669CN517202 not provided;
NM_019066.5(MAGEL2):c.1220C>T (p.Pro407Leu)54551MAGEL2Uncertain significance-1RCV001196912; NMONDO:MONDO:0008300,MedGen:C0032897,OMIM:176270, Orphanet:739152389167023891670GA15:g.23891670G>A-
NM_019066.5(MAGEL2):c.539_568del (p.Val180_Met189del)54551MAGEL2Uncertain significance-1RCV001197127; NMONDO:MONDO:0008300,MedGen:C0032897,OMIM:176270, Orphanet:739152389232223892351GCCATCGGGGTCCCCGGAGGAGGAGGATGCAG15:g.23892322_23892351del-
NM_019066.5(MAGEL2):c.385A>G (p.Met129Val)54551MAGEL2Conflicting interpretations of pathogenicityrs188762916RCV000501872|RCV001198742; NMedGen:CN169374|MONDO:MONDO:0008300,MedGen:C0032897,OMIM:176270, Orphanet:739152389250523892505TC15:g.23892505T>CClinGen:CA7430116
NM_002487.3(NDN):c.533G>A (p.Arg178Lys)4692NDNUncertain significancers1555376130RCV000662114; NMONDO:MONDO:0008300,MedGen:C0032897,OMIM:176270, Orphanet:739152393183223931832CT15:g.23931832C>T-C0032897 176270 Prader-Willi syndrome;
NM_002487.3(NDN):c.472dup (p.Thr158fs)4692NDNUncertain significance-1RCV001196772; NMONDO:MONDO:0008300,MedGen:C0032897,OMIM:176270, Orphanet:739152393189223931893GGT15:g.23931892_23931893insT-
NM_002487.3(NDN):c.212A>G (p.Gln71Arg)4692NDNUncertain significance-1RCV001196147; NMONDO:MONDO:0008300,MedGen:C0032897,OMIM:176270, Orphanet:739152393215323932153TC15:g.23932153T>C-
Single allele-1subset of 23 genes: MAGEL2:SNUPathogenic-1RCV000520873; NMONDO:MONDO:0008300,MedGen:C0032897,OMIM:176270, Orphanet:739152370743528520316nana-C1968689 243700 Hyperimmunoglobulin E recurrent infection syndrome, autosomal recessive;
GRCh37/hg19 15q11.2-13.1(chr15:23810184-28525505)-1subset of 23 genes: MAGEL2:SNUPathogenic-1RCV000767726; NMONDO:MONDO:0008300,MedGen:C0032897,OMIM:176270, Orphanet:739152381018428525505nana-
GRCh37/hg19 15q11.2-13.1(chr15:23615768-28561671)-1subset of 24 genes: MAGEL2:SNUPathogenic-1RCV000767724; NMONDO:MONDO:0007113,MedGen:C0162635,OMIM:105830, Orphanet:72; MONDO:MONDO:0008300,MedGen:C0032897,OMIM:176270, Orphanet:739152361576828561671nana-
GRCh37/hg19 15q11.2-13.1(chr15:23683783-28530182)-1subset of 24 genes: MAGEL2:SNUPathogenic-1RCV000767725; NMONDO:MONDO:0007113,MedGen:C0162635,OMIM:105830, Orphanet:72; MONDO:MONDO:0008300,MedGen:C0032897,OMIM:176270, Orphanet:739152368378328530182nana-
GRCh37/hg19 15q11.2-13.1(chr15:22770994-29050198)-1subset of 29 genes: MAGEL2:SNUPathogenic-1RCV000767721; NMONDO:MONDO:0007113,MedGen:C0162635,OMIM:105830, Orphanet:72; MONDO:MONDO:0008300,MedGen:C0032897,OMIM:176270, Orphanet:739152277099429050198nana-
GRCh37/hg19 15q11.2-13.3(chr15:20848750-32925141)-1subset of 52 genes: MAGEL2:SNUPathogenic-1RCV000767719; NMONDO:MONDO:0007113,MedGen:C0162635,OMIM:105830, Orphanet:72; MONDO:MONDO:0008300,MedGen:C0032897,OMIM:176270, Orphanet:739152084875032925141nana-
MSeqDR Portal