MSeqDR Mitochondrial Disease Portal


 
*:HP: HPO terms, UMDF: 1= Disease, ND: NAMDC terms.
  Most Studied  CPEO, Complex I Deficiency, COXPD1, Leigh, LHON, MELAS, MERRF, Myopathy, SANDO
Disease Browser
Parent Node:
expand
Adenomatous Polyps (D018256)
Parent Node:
expand
Colorectal Neoplasms (D015179)
Parent Node:
expand
Intestinal Polyposis (D044483)
Parent Node:
expand
Neoplastic Syndromes, Hereditary (D009386)
..Starting node
..expand
Adenomatous Polyposis Coli (D011125)

       Child Nodes:
........expandAttenuated familial adenomatous polyposis (C538265)
........expandColorectal Adenomatous Polyposis, Autosomal Recessive (C563924)
........expandDesmoid disease, hereditary (C535944)
........expandGardner Syndrome (D005736) Child3
........expandLeukemia, Acute Myelocytic, with Polyposis Coli and Colon Cancer (C565441)
........expandPolyposis Syndrome, Hereditary Mixed, 1 (C563365)
........expandPolyposis Syndrome, Hereditary Mixed, 2 (C566451)



 Sister Nodes: 
..expandAdenomatous Polyposis Coli (D011125) Child10
..expandBasal Cell Nevus Syndrome (D001478) Child1
..expandBirt-Hogg-Dube Syndrome (D058249)
..expandCancer, Familial, with In Vitro Radioresistance (C566179)
..expandCollagenoma, Familial Cutaneous (C562925)
..expandColorectal Neoplasms, Hereditary Nonpolyposis (D003123) Child10
..expandDiaphyseal medullary stenosis with malignant fibrous histiocytoma (C536169)
..expandDysplastic Nevus Syndrome (D004416)
..expandExostoses, Multiple Hereditary (D005097) Child14
..expandFamilial cylindromatosis (C536611)
..expandGenochondromatosis (C563215)
..expandHamartoma Syndrome, Multiple (D006223) Child10
..expandHemangioma, capillary infantile (C535860)
..expandHereditary Breast and Ovarian Cancer Syndrome (D061325)
..expandHereditary leiomyomatosis and renal cell cancer (C535516)
..expandJuvenile polyposis syndrome (C537702)
..expandLi-Fraumeni Syndrome (D016864) Child4
..expandMelanoma-Pancreatic Cancer Syndrome (C563985)
..expandMeningioma, familial (C537443)
..expandMultiple Endocrine Neoplasia (D009377) Child6
..expandMyelocytic leukemia-like syndrome, familial, chronic (C536093)
..expandNeurofibromatoses (D017253) Child13  LSDB C:1
..expandParagangliomas 2 (C566646)
..expandParagangliomas 3 (C565335)
..expandPeutz-Jeghers Syndrome (D010580)
..expandProstate Cancer, Hereditary, 12 (C567510)
..expandTuberous Sclerosis (D014402) Child4
..expandTurcot syndrome (C536928)
..expandWilms Tumor (D009396) Child10
   

Human Disease MESH is developed by UMLS.
Further data from MedGen, OMIM,ClinVar, CTD
Term ID:300
Name:Adenomatous Polyposis Coli
Definition:A polyposis syndrome due to an autosomal dominant mutation of the APC genes (GENES, APC) on CHROMOSOME 5. The syndrome is characterized by the development of hundreds of ADENOMATOUS POLYPS in the COLON and RECTUM of affected individuals by early adulthood.
Alternative IDs:DO:DOID:0050424|OMIM:175100|OMIM:616415|OMIM:617100
ParentIDs:MESH:D009386|MESH:D015179|MESH:D018256|MESH:D044483
TreeNumbers:C04.557.470.035.215.100 |C04.588.274.476.411.307.089 |C04.700.100 |C06.301.371.411.307.090 |C06.405.249.411.307.090 |C06.405.469.158.356.090 |C06.405.469.491.307.090 |C06.405.469.578.249 |C16.320.700.100
Synonyms:AAPC, INCLUDED |Adenomatous Intestinal Polyposes |Adenomatous Intestinal Polyposis |Adenomatous Polyposes, Familial |ADENOMATOUS POLYPOSIS COLI, ATTENUATED, INCLUDED |Adenomatous Polyposis Coli, Familial |Adenomatous Polyposis Colus |Adenomatous Polyposis, Fami
Slim Mappings:Cancer|Digestive system disease|Genetic disease (inborn)
Reference: MedGen: D011125
MeSH: D011125
OMIM: 175100;
MSeqDR LSDB:  
Genes: APC; PKLR;
Phenotypes
1 HP:0000006Autosomal dominant inheritance
2 HP:0005227Adenomatous colonic polyposisHP:0040281
3 HP:0008256Adrenocortical adenomaHP:0040284
4 HP:0006744Adrenocortical carcinoma
5 HP:0009592Astrocytoma
6 HP:0000670Carious teethHP:0040283
7 HP:0003003Colon cancerHP:0040282
8 HP:0007649Congenital hypertrophy of retinal pigment epitheliumHP:0040283
9 HP:0100245Desmoid tumorsHP:0040284
10 HP:0006771Duodenal adenocarcinomaHP:0040284
11 HP:0004783Duodenal polyposisHP:0040284
12 HP:0200040Epidermoid cystHP:0040283
13 HP:0010619Fibroadenoma of the breastHP:0040283
14 HP:0002884HepatoblastomaHP:0040284
15 HP:0000953Hyperpigmentation of the skin
16 HP:0011069Increased number of teethHP:0040283
17 HP:0010562Keloids
18 HP:0002885MedulloblastomaHP:0040284
19 HP:0004394Multiple gastric polypsHP:0040282
20 HP:0001012Multiple lipomas
21 HP:0011068Odontoma
22 HP:0100246OsteomaHP:0040283
23 HP:0002895Papillary thyroid carcinomaHP:0040284
24 HP:0006722Small intestine carcinoid
25 HP:0000706Unerupted toothHP:0040283
26 HP:0003828Variable expressivity
Disease Causing ClinVar Variants
Variation_NameGeneIDGeneSymbolClinicalSignificancedbSNPRCVaccessionTestedInGTRPhenotypeIDsChromosomeStartStopHGVS_cHGVS_pHGVS_gOtherIDsDisease_ClinVar
NC_000005.9:g.112001178_112043328del42151324APCLikely pathogenic-1RCV000704595; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112001178112043328nana-C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.9:g.(?_112001178)_(112043328_?)del324APCPathogenic-1RCV001920059; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112001178112043328nana-1-
NC_000005.9:g.112043006_112043009delinsCCCA324APCUncertain significance-1RCV002015123; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043006112043009GGGCCCCA112043006-
NC_000005.10:g.(?_112707312)_(112707902_?)del324APCPathogenic-1RCV000493148|RCV001865533; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043009112043599nana-C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.9:g.(?_112043009)_(112043599_?)dup324APCUncertain significance-1RCV000557176|RCV001853708; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043009112043599nana-C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.10:g.(?_112707312)_(112780909_?)del324APCPathogenic-1RCV000535350|RCV001853709; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043009112116606nana-1-
NM_000038.5(APC):c.-30632C>T324APCBenignrs185951958RCV000534603; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043009112043009CTNC_000005.9:g.112043009C>TClinGen:CA124924532C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.9:g.(?_112043009)_(112073585_?)dup324APCUncertain significance-1RCV000808623|RCV001856253; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043009112073585nana-
NC_000005.10:g.(?_112707312)_(112780913_?)del324APCPathogenic-1RCV000802583|RCV001856249; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043009112116610nana-
NC_000005.10:g.(?_112707312)_(112844136_?)del324APCPathogenic-1RCV000813324|RCV001869256; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043009112179833nana-
NC_000005.9:g.(?_112043009)_(112111444_?)dup324APCUncertain significance-1RCV000821942; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043009112111444nana-
NC_000005.10:g.(?_112707312)_(112844126_?)del324APCPathogenic-1RCV000820596|RCV001856258; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043009112179823nana-
NC_000005.10:g.(?_112707312)_(112755035_?)del324APCPathogenic-1RCV001032582; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043009112090732nana-1-
NC_000005.10:g.(?_112707312)_(112779851_?)dup324APCUncertain significance-1RCV001032224|RCV001862449; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043009112115548nana-1-
NC_000005.10:g.(?_112707312)_(112828982_?)dup324APCUncertain significance-1RCV001031303|RCV001862443; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043009112164679nana-1-
NC_000005.10:g.(?_112707312)_(112844136_?)dup324APCUncertain significance-1RCV001032102; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043009112179833nana-1-
NC_000005.9:g.112043009_112043010insTGCA324APCUncertain significance-1RCV001368938; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043009112043010CCTGCA112043009-
NC_000005.9:g.(?_112043009)_(112151296_?)del324APCPathogenic-1RCV001381156; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043009112151296nana-1-
NC_000005.9:g.(?_112043009)_(112182936_?)del324APCPathogenic-1RCV001381152; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043009112182936nana-1-
NC_000005.9:g.(?_112043009)_(112073585_?)del324APCPathogenic-1RCV001953897; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043009112073585nana-1-
NC_000005.9:g.(?_112043009)_(112103097_?)del324APCPathogenic-1RCV001953492; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043009112103097nana-1-
NC_000005.9:g.(?_112043009)_(112179829_?)del324APCPathogenic-1RCV001949513; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043009112179829nana-1-
NM_000038.6(APC):c.-30630G>A324APCUncertain significancers1214142280RCV000803445; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043011112043011GA5:g.112043011G>A-
NC_000005.9:g.112043012C>T324APCUncertain significancers1750548089RCV001297737; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043012112043012CT112043012-
NC_000005.9:g.112043013A>G324APCUncertain significance-1RCV002010155; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043013112043013AG112043013-
NC_000005.9:g.112043013A>T324APCUncertain significance-1RCV001940042; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043013112043013AT112043013-
NC_000005.9:g.112043014G>C324APCUncertain significance-1RCV001870634; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043014112043014GC112043014-
NM_000038.5(APC):c.-30626C>G324APCUncertain significancers931897682RCV000558548; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043015112043015CG5:g.112043015C>GClinGen:CA124924533C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.9:g.112043017C>A324APCUncertain significance-1RCV001965565; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043017112043017CA112043017-
NC_000005.9:g.112043020T>C324APCUncertain significance-1RCV001363041; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043020112043020TC112043020-
NC_000005.9:g.112043022C>G324APCUncertain significancers1750548351RCV001351971; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043022112043022CG112043022-
NC_000005.9:g.112043023_112043024insGAGAAGGCCAGTAAGTGCTGCAACT324APCUncertain significance-1RCV001373802; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043023112043024AAGAGAAGGCCAGTAAGTGCTGCAACT112043023-
NC_000005.9:g.112043023A>T324APCUncertain significance-1RCV001890049; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043023112043023AT112043023-
NC_000005.9:g.112043024G>C324APCUncertain significancers1750548429RCV001320857; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043024112043024GC112043024-
NC_000005.9:g.112043025_112043027del324APCUncertain significance-1RCV002037106; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043025112043027GAGAG112043024-
NC_000005.9:g.112043026G>A324APCUncertain significancers1750548760RCV001325712; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043026112043026GA112043026-
NM_000038.6(APC):c.-30612G>A324APCUncertain significancers1461935725RCV000799564; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043029112043029GA5:g.112043029G>A-
NM_000038.6(APC):c.-30612G>C324APCUncertain significancers1461935725RCV000804953; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043029112043029GC5:g.112043029G>C-
NC_000005.9:g.112043029del324APCUncertain significance-1RCV001360440; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043029112043029AGA112043028-
NM_000038.5(APC):c.-30611G>T324APCUncertain significancers1554060090RCV000646547; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043030112043030GT5:g.112043030G>TClinGen:CA658796584C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.-30611G>A324APCUncertain significancers1554060090RCV000792135; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043030112043030GA5:g.112043030G>A-
NM_000038.5(APC):c.-30610C>T324APCUncertain significancers1554060091RCV000546163; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043031112043031CTNC_000005.9:g.112043031C>TClinGen:CA658655864C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.5(APC):c.-30608A>G324APCUncertain significancers1554060092RCV000545228; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043033112043033AG5:g.112043033A>GClinGen:CA658655865C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.5(APC):c.-30608A>T324APCUncertain significancers1554060092RCV000557633; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043033112043033AT5:g.112043033A>TClinGen:CA658655866C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.-30608dup324APCUncertain significancers1293984809RCV000807321; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043033112043033CCA5:g.112043032_112043033insA-
NC_000005.9:g.112043034G>A324APCUncertain significance-1RCV002044864; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043034112043034GA112043034-
NM_000038.6(APC):c.-30606dup324APCUncertain significancers1156546602RCV000800720; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043035112043035GGT5:g.112043034_112043035insT-
NC_000005.9:g.112043035T>C324APCUncertain significancers1750549577RCV001346044; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043035112043035TC112043035-
NM_000038.5(APC):c.-30605A>T324APCUncertain significancers1554060095RCV000532741; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043036112043036ATNC_000005.9:g.112043036A>TClinGen:CA445747779C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.9:g.112043036A>G324APCUncertain significancers1554060095RCV001295133; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043036112043036AG112043036-
NC_000005.9:g.112043037A>G324APCUncertain significancers1469439532RCV001308881; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043037112043037AG112043037-
NM_000038.5(APC):c.-30603G>C324APCUncertain significancers1554060097RCV000646528; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043038112043038GCNC_000005.9:g.112043038G>CClinGen:CA658796585C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.-30602T>C324APCUncertain significancers1580995288RCV000802426; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043039112043039TC5:g.112043039T>C-
NC_000005.9:g.112043039T>G324APCUncertain significancers1580995288RCV001316399; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043039112043039TG112043039-
NM_000038.6(APC):c.-30601G>C324APCUncertain significancers1050218356RCV000822079; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043040112043040GC5:g.112043040G>C-
NC_000005.9:g.112043041C>G324APCUncertain significance-1RCV001372664; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043041112043041CG112043041-
NC_000005.9:g.112043042del324APCUncertain significancers1750550359RCV001313067; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043042112043042CTC112043041-
NC_000005.9:g.112043042T>C324APCUncertain significancers1750550286RCV001321554; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043042112043042TC112043042-
NM_000038.6(APC):c.-30598G>A324APCUncertain significancers1232455560RCV000792123; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043043112043043GA5:g.112043043G>A-
NC_000005.9:g.112043043G>C324APCUncertain significancers1232455560RCV001344582; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043043112043043GC112043043-
NC_000005.9:g.112043043G>T324APCUncertain significance-1RCV002049823; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043043112043043GT112043043-
NM_000038.6(APC):c.-30596A>G324APCUncertain significancers887610659RCV000816471; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043045112043045AG5:g.112043045A>G-
NC_000005.9:g.112043045A>C324APCUncertain significance-1RCV001973815; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043045112043045AC112043045-
NC_000005.9:g.112043046A>G324APCUncertain significancers1750550706RCV001348074; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043046112043046AG112043046-
NC_000005.9:g.112043047C>T324APCUncertain significancers1750550790RCV001299893; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043047112043047CT112043047-
NC_000005.9:g.112043047C>A324APCUncertain significancers1750550790RCV001320223; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043047112043047CA112043047-
NM_000038.5(APC):c.-30593T>C324APCUncertain significancers1554060105RCV000556687; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043048112043048TCNC_000005.9:g.112043048T>CClinGen:CA658655867C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.9:g.112043049G>T324APCUncertain significance-1RCV002021578; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043049112043049GT112043049-
NM_000038.6(APC):c.-30591dup324APCUncertain significancers1580995299RCV000808111; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043050112043050GGA5:g.112043049_112043050insA-
NM_000038.5(APC):c.-30590G>A324APCLikely benignrs545524187RCV000544296; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043051112043051GANC_000005.9:g.112043051G>AClinGen:CA124924542C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.9:g.112043051G>C324APCUncertain significancers545524187RCV001337730; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043051112043051GC112043051-
NC_000005.9:g.112043052A>G324APCUncertain significancers1750551409RCV001326226; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043052112043052AG112043052-
NC_000005.9:g.112043052A>T324APCUncertain significance-1RCV002024325; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043052112043052AT112043052-
NC_000005.9:g.112043053C>T324APCUncertain significance-1RCV001996528; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043053112043053CT112043053-
NM_000038.6(APC):c.-30587T>A324APCUncertain significancers1580995308RCV000795331; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043054112043054TA5:g.112043054T>A-
NM_000038.5(APC):c.-30586C>T324APCUncertain significancers1554060110RCV000646677; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043055112043055CT5:g.112043055C>TClinGen:CA658796586C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.5(APC):c.-30585G>T324APCUncertain significancers560366894RCV000646645; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043056112043056GTNC_000005.9:g.112043056G>TClinGen:CA658796587C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.-30585G>C324APCUncertain significancers560366894RCV000809131; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043056112043056GC5:g.112043056G>C-
NC_000005.9:g.112043058_112043059delinsTG324APCUncertain significancers1750551900RCV001299737; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043058112043059CTTG112043058-
NC_000005.9:g.112043058C>A324APCUncertain significancers1750551783RCV001337518; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043058112043058CA112043058-
NC_000005.9:g.112043058C>G324APCUncertain significancers1750551783RCV001339615; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043058112043058CG112043058-
NC_000005.9:g.112043058_112043059delinsGG324APCUncertain significance-1RCV001366310; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043058112043059CTGG112043058-
NC_000005.9:g.112043059T>C324APCUncertain significancers113077479RCV001319338; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043059112043059TC112043059-
NC_000005.9:g.112043059T>G324APCUncertain significance-1RCV001363097; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043059112043059TG112043059-
NC_000005.9:g.112043059T>A324APCUncertain significance-1RCV001982790; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043059112043059TA112043059-
NM_000038.6(APC):c.-30581G>A324APCUncertain significancers1580995331RCV000816264; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043060112043060GA5:g.112043060G>A-
NC_000005.9:g.112043060_112043061delinsCT324APCUncertain significance-1RCV002006158; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043060112043061GCCT112043060-
NC_000005.9:g.112043061C>T324APCUncertain significance-1RCV001995086; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043061112043061CT112043061-
NC_000005.9:g.112043061C>A324APCUncertain significance-1RCV001995137; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043061112043061CA112043061-
NM_000038.5(APC):c.-30579C>T324APCUncertain significancers1554060114RCV000531822; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043062112043062CT5:g.112043062C>TClinGen:CA658655868C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.5(APC):c.-30578T>C324APCUncertain significancers929883108RCV000555784; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043063112043063TCNC_000005.9:g.112043063T>CClinGen:CA124924550C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.9:g.112043063T>G324APCUncertain significance-1RCV002028198; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043063112043063TG112043063-
NM_000038.5(APC):c.-30577A>G324APCUncertain significancers1046974767RCV000538765; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043064112043064AGNC_000005.9:g.112043064A>GClinGen:CA124924554C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.9:g.112043064A>C324APCUncertain significance-1RCV001361106; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043064112043064AC112043064-
NM_000038.5(APC):c.-30576G>A324APCUncertain significancers1320184514RCV000646536; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043065112043065GANC_000005.9:g.112043065G>AClinGen:CA658796588C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.9:g.112043065G>T324APCUncertain significancers1320184514RCV001320965; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043065112043065GT112043065-
NM_000038.6(APC):c.-30575G>A324APCUncertain significancers1232017569RCV000801035; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043066112043066GA5:g.112043066G>A-
NM_000038.5(APC):c.-30574C>T324APCUncertain significancers1273083857RCV000530895; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043067112043067CT5:g.112043067C>TClinGen:CA561890078C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.9:g.112043067C>A324APCUncertain significance-1RCV001366214; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043067112043067CA112043067-
NC_000005.9:g.112043067C>G324APCUncertain significance-1RCV001902548; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043067112043067CG112043067-
NM_000038.5(APC):c.-30573A>G324APCUncertain significancers1554060123RCV000554842; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043068112043068AGNC_000005.9:g.112043068A>GClinGen:CA658655869C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.9:g.112043069_112043070delinsTT324APCUncertain significancers1750552770RCV001348652; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043069112043070GCTT112043069-
NC_000005.9:g.112043071A>C324APCUncertain significance-1RCV001894939; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043071112043071AC112043071-
NM_000038.5(APC):c.-30569A>G324APCBenignrs13180781RCV000421417|RCV000542411; NMedGen:CN169374|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043072112043072AG5:g.112043072A>GClinGen:CA12147799C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.9:g.112043072_112043073delinsGC324APCUncertain significancers1750553249RCV001338537; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043072112043073ATGC112043072-
NC_000005.9:g.112043072A>C324APCUncertain significance-1RCV001362678; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043072112043072AC112043072-
NM_000038.5(APC):c.-30568T>C324APCBenignrs1218378018RCV000525417; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043073112043073TC5:g.112043073T>CClinGen:CA561890079C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.9:g.112043073T>G324APCUncertain significancers1218378018RCV001317758; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043073112043073TG112043073-
NC_000005.9:g.112043074G>A324APCUncertain significancers1005173527RCV001341712; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043074112043074GA112043074-
NM_000038.6(APC):c.-30566G>C324APCUncertain significancers1243549213RCV000812467; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043075112043075GC5:g.112043075G>C-
NC_000005.9:g.112043075G>A324APCUncertain significancers1243549213RCV001301751; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043075112043075GA112043075-
NC_000005.9:g.112043075G>T324APCUncertain significance-1RCV001972156; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043075112043075GT112043075-
NC_000005.9:g.112043076C>G324APCUncertain significance-1RCV001374205; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043076112043076CG112043076-
NC_000005.9:g.112043078C>G324APCUncertain significance-1RCV001995903; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043078112043078CG112043078-
NC_000005.9:g.112043079A>T324APCUncertain significance-1RCV001986911; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043079112043079AT112043079-
NC_000005.9:g.112043080C>G324APCUncertain significancers1484697641RCV001344735; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043080112043080CG112043080-
NM_000038.5(APC):c.-30560G>A324APCUncertain significancers1554060128RCV000541490; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043081112043081GA5:g.112043081G>AClinGen:CA658655870C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.5(APC):c.-30560G>C324APCUncertain significancers1554060128RCV000549428; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043081112043081GCNC_000005.9:g.112043081G>CClinGen:CA658655871C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.5(APC):c.-30559G>C324APCLikely benignrs1192399402RCV000529027; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043082112043082GCNC_000005.9:g.112043082G>CClinGen:CA561890086C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.9:g.112043082G>A324APCUncertain significancers1192399402RCV001322826; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043082112043082GA112043082-
NM_000038.5(APC):c.-30558G>C324APCUncertain significancers1351477360RCV000548472; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043083112043083GCNC_000005.9:g.112043083G>CClinGen:CA658655872C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.9:g.112043083G>A324APCUncertain significance-1RCV001966471; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043083112043083GA112043083-
NM_000038.5(APC):c.-30555A>C324APCBenignrs1257642100RCV000535990; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043086112043086AC5:g.112043086A>CClinGen:CA561890088C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.9:g.112043086_112043087del324APCUncertain significancers1316145446RCV001300615; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043086112043087CAGC112043085-
NC_000005.9:g.112043086A>G324APCUncertain significance-1RCV002005136; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043086112043086AG112043086-
NC_000005.9:g.112043087G>C324APCUncertain significancers1750554761RCV001303797; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043087112043087GC112043087-
NC_000005.9:g.112043087G>T324APCUncertain significance-1RCV002037612; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043087112043087GT112043087-
NC_000005.9:g.112043088A>G324APCUncertain significance-1RCV001371623; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043088112043088AG112043088-
NC_000005.9:g.112043088A>T324APCUncertain significance-1RCV001963696; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043088112043088AT112043088-
NM_000038.5(APC):c.-30551C>G324APCUncertain significancers994601309RCV000559955; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043090112043090CG5:g.112043090C>GClinGen:CA124924605C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.9:g.112043090C>T324APCUncertain significance-1RCV001929626; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043090112043090CT112043090-
NM_000038.5(APC):c.-30550A>G324APCUncertain significancers571137741RCV000646684; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043091112043091AG5:g.112043091A>GClinGen:CA124924620C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.9:g.112043093C>T324APCUncertain significance-1RCV001362529; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043093112043093CT112043093-
NM_000038.5(APC):c.-30547G>T324APCUncertain significancers1554060134RCV000646618; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043094112043094GTNC_000005.9:g.112043094G>TClinGen:CA658796589C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.9:g.112043094G>A324APCUncertain significancers1554060134RCV001327854; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043094112043094GA112043094-
NC_000005.9:g.112043095A>C324APCUncertain significance-1RCV002048899; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043095112043095AC112043095-
NC_000005.9:g.112043095del324APCUncertain significance-1RCV002001446; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043095112043095GAG112043094-
NM_000038.6(APC):c.-30545A>G324APCUncertain significancers1580995476RCV000811852; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043096112043096AG5:g.112043096A>G-
NC_000005.9:g.112043096_112043097insGCAGTGCCCGGCAAGCGGAGC324APCUncertain significance-1RCV001934246; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043096112043097AAGCAGTGCCCGGCAAGCGGAGC112043096-
NC_000005.9:g.112043097G>A324APCUncertain significancers1750555732RCV001294660; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043097112043097GA112043097-
NC_000005.9:g.112043097_112043098insCAGT324APCUncertain significance-1RCV001366274; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043097112043098GGCAGT112043097-
NC_000005.9:g.112043097G>C324APCUncertain significance-1RCV001891530; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043097112043097GC112043097-
NM_000038.5(APC):c.-30543C>G324APCUncertain significancers1554060135RCV000646635; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043098112043098CGNC_000005.9:g.112043098C>GClinGen:CA658796590C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.9:g.112043099A>G324APCUncertain significance-1RCV001373872; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043099112043099AG112043099-
NC_000005.9:g.112043099A>C324APCUncertain significance-1RCV002008391; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043099112043099AC112043099-
NM_000038.5(APC):c.-30541G>C324APCUncertain significancers1035047381RCV000547630; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043100112043100GC5:g.112043100G>CClinGen:CA124924622C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.-30541G>A324APCUncertain significancers1035047381RCV000802886; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043100112043100GA5:g.112043100G>A-
NM_000038.5(APC):c.-30540T>C324APCUncertain significancers1248905809RCV000646580; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043101112043101TC5:g.112043101T>CClinGen:CA658796592C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.5(APC):c.-30540T>A324APCUncertain significancers1248905809RCV000646617; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043101112043101TANC_000005.9:g.112043101T>AClinGen:CA658796591C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.9:g.112043102G>A324APCUncertain significancers1580995493RCV001314676; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043102112043102GA112043102-
NC_000005.9:g.112043102G>C324APCUncertain significance-1RCV001916774; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043102112043102GC112043102-
NC_000005.9:g.112043103C>A324APCUncertain significancers1750556409RCV001308858; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043103112043103CA112043103-
NC_000005.9:g.112043103C>T324APCUncertain significancers1750556409RCV001306793; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043103112043103CT112043103-
NC_000005.9:g.112043103C>G324APCUncertain significance-1RCV001366602; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043103112043103CG112043103-
NC_000005.9:g.112043104C>A324APCUncertain significance-1RCV001360304; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043104112043104CA112043104-
NM_000038.5(APC):c.-30536C>G324APCUncertain significancers989021062RCV000646674; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043105112043105CG5:g.112043105C>GClinGen:CA124924626C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.9:g.112043105C>T324APCUncertain significancers989021062RCV001319613; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043105112043105CT112043105-
NM_000038.5(APC):c.-30535G>C324APCUncertain significancers1020543876RCV000646696; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043106112043106GC5:g.112043106G>CClinGen:CA658796593C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.9:g.112043106G>A324APCUncertain significancers1020543876RCV001295213; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043106112043106GA112043106-
NC_000005.9:g.112043106G>T324APCUncertain significance-1RCV001368770; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043106112043106GT112043106-
NC_000005.9:g.112043107G>A324APCUncertain significance-1RCV001368267; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043107112043107GA112043107-
NC_000005.9:g.112043108C>T324APCUncertain significance-1RCV002017468; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043108112043108CT112043108-
NM_000038.5(APC):c.-30532A>T324APCUncertain significancers1012461653RCV000535175; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043109112043109ATNC_000005.9:g.112043109A>TClinGen:CA561890092C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.5(APC):c.-30532A>C324APCUncertain significancers1012461653RCV000646668; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043109112043109AC5:g.112043109A>CClinGen:CA124924639C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.-30532A>G324APCUncertain significancers1012461653RCV000813084; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043109112043109AG5:g.112043109A>G-
NC_000005.9:g.112043109del324APCUncertain significancers1750557687RCV001325859; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043109112043109CAC112043108-
NM_000038.5(APC):c.-30531A>T324APCUncertain significancers1345543059RCV000559119; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043110112043110ATNC_000005.9:g.112043110A>TClinGen:CA658655873C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.-30531A>G324APCUncertain significancers1345543059RCV000824336; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043110112043110AG5:g.112043110A>G-
NM_000038.5(APC):c.-30530G>A324APCUncertain significancers1432662523RCV000529702; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043111112043111GANC_000005.9:g.112043111G>AClinGen:CA658655875C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.5(APC):c.-30530G>T324APCUncertain significancers1432662523RCV000546713; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043111112043111GTNC_000005.9:g.112043111G>TClinGen:CA658655874C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.-30529C>T324APCUncertain significancers1580995550RCV000802908; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043112112043112CT5:g.112043112C>T-
NC_000005.9:g.112043112C>G324APCUncertain significancers1580995550RCV001340063; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043112112043112CG112043112-
NC_000005.9:g.112043112C>A324APCUncertain significance-1RCV001891258; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043112112043112CA112043112-
NM_000038.5(APC):c.-30528G>T324APCUncertain significancers1373788988RCV000646666; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043113112043113GT5:g.112043113G>TClinGen:CA658796594C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.9:g.112043113G>C324APCUncertain significance-1RCV001359165; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043113112043113GC112043113-
NM_000038.6(APC):c.-30527G>C324APCUncertain significancers1173265814RCV000798344; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043114112043114GC5:g.112043114G>C-
NC_000005.9:g.112043114G>A324APCUncertain significancers1173265814RCV001312800; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043114112043114GA112043114-
NM_000038.5(APC):c.-30526A>C324APCLikely benignrs372923973RCV000545800; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043115112043115ACNC_000005.9:g.112043115A>CClinGen:CA124924643C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.5(APC):c.-30526A>G324APCLikely benignrs372923973RCV000558211; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043115112043115AG5:g.112043115A>GClinGen:CA124924645C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.9:g.112043116G>A324APCUncertain significance-1RCV001900768; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043116112043116GA112043116-
NC_000005.9:g.112043116_112043117del324APCUncertain significance-1RCV002038609; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043116112043117AGCA112043115-
NM_000038.6(APC):c.-30524C>G324APCUncertain significancers1427438975RCV000792202; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043117112043117CG5:g.112043117C>G-
NC_000005.9:g.112043117C>A324APCUncertain significancers1427438975RCV001298739; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043117112043117CA112043117-
NC_000005.9:g.112043117C>T324APCUncertain significancers1427438975RCV001296008; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043117112043117CT112043117-
NC_000005.9:g.112043119C>A324APCUncertain significancers1750559277RCV001304786; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043119112043119CA112043119-
NC_000005.9:g.112043120A>C324APCUncertain significance-1RCV001908102; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043120112043120AC112043120-
NC_000005.9:g.112043121G>C324APCUncertain significancers1185261719RCV001308961; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043121112043121GC112043121-
NM_000038.6(APC):c.-30517C>T324APCUncertain significancers1580995582RCV000814358; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043124112043124CT5:g.112043124C>T-
NC_000005.9:g.112043124C>A324APCUncertain significancers1580995582RCV001325089; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043124112043124CA112043124-
NC_000005.9:g.112043125C>T324APCUncertain significance-1RCV001906062; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043125112043125CT112043125-
NC_000005.9:g.112043125C>A324APCUncertain significance-1RCV002008885; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043125112043125CA112043125-
NC_000005.9:g.112043126C>T324APCUncertain significancers1343144964RCV001349875; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043126112043126CT112043126-
NC_000005.9:g.112043127A>G324APCUncertain significance-1RCV001893270; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043127112043127AG112043127-
NM_000038.6(APC):c.-30513T>A324APCUncertain significancers532048458RCV000805520; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043128112043128TA5:g.112043128T>A-
NM_000038.6(APC):c.-30513T>C324APCUncertain significancers532048458RCV000802545; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043128112043128TC5:g.112043128T>C-
NC_000005.9:g.112043128T>G324APCUncertain significancers532048458RCV001300887; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043128112043128TG112043128-
NC_000005.9:g.112043129T>C324APCUncertain significance-1RCV001968100; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043129112043129TC112043129-
NM_000038.6(APC):c.-30511G>A324APCUncertain significancers550204383RCV000791902; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043130112043130GA5:g.112043130G>A-
NC_000005.9:g.112043132G>C324APCUncertain significancers781399686RCV001318160; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043132112043132GC112043132-
NC_000005.9:g.112043132G>T324APCUncertain significance-1RCV001892013; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043132112043132GT112043132-
NC_000005.9:g.112043133C>T324APCUncertain significance-1RCV001943759; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043133112043133CT112043133-
NM_000038.6(APC):c.-30507_-30493del324APCUncertain significancers1219201829RCV000791744; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043134112043148CGCCTGCGCATAACAGC5:g.112043132_112043146del-
NC_000005.9:g.112043134C>G324APCUncertain significancers978748301RCV001308041; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043134112043134CG112043134-
NC_000005.9:g.112043134C>T324APCUncertain significancers978748301RCV001299748; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043134112043134CT112043134-
NM_000038.5(APC):c.-30506T>C324APCUncertain significancers1279143171RCV000646601; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043135112043135TCNC_000005.9:g.112043135T>CClinGen:CA658796595C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.9:g.112043136G>A324APCUncertain significancers1750561418RCV001337735; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043136112043136GA112043136-
NM_000038.6(APC):c.-30504C>A324APCUncertain significancers968227350RCV000799327; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043137112043137CA5:g.112043137C>A-
NC_000005.9:g.112043137C>T324APCUncertain significance-1RCV002033140; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043137112043137CT112043137-
NM_000038.5(APC):c.-30503G>A324APCUncertain significancers979191484RCV000533333; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043138112043138GANC_000005.9:g.112043138G>AClinGen:CA124924671C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.5(APC):c.-30502C>A324APCUncertain significancers1313658633RCV000540297; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043139112043139CANC_000005.9:g.112043139C>AClinGen:CA561890095C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.5(APC):c.-30502C>T324APCUncertain significancers1313658633RCV000552792; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043139112043139CTNC_000005.9:g.112043139C>TClinGen:CA658655876C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.9:g.112043139C>G324APCUncertain significancers1313658633RCV001348303; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043139112043139CG112043139-
NM_000038.5(APC):c.-30501A>G324APCUncertain significancers911239343RCV000646569; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043140112043140AG5:g.112043140A>GClinGen:CA124924675C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.5(APC):c.-30501A>T324APCUncertain significancers911239343RCV000646532; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043140112043140ATNC_000005.9:g.112043140A>TClinGen:CA658796596C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.5(APC):c.-30500T>C324APCUncertain significancers1213502095RCV000646605; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043141112043141TCNC_000005.9:g.112043141T>CClinGen:CA658796597C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.9:g.112043141T>A324APCUncertain significancers1213502095RCV001308597; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043141112043141TA112043141-
NC_000005.9:g.112043142A>G324APCUncertain significancers1750562759RCV001309011; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043142112043142AG112043142-
NC_000005.9:g.112043144C>G324APCUncertain significancers1750562869RCV001323606; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043144112043144CG112043144-
NM_000038.6(APC):c.-30496A>G324APCUncertain significancers1412978804RCV000813077; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043145112043145AG5:g.112043145A>G-
NM_000038.6(APC):c.-30495G>A324APCUncertain significancers1031191403RCV000796682; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043146112043146GA5:g.112043146G>A-
NC_000005.9:g.112043146G>T324APCUncertain significance-1RCV002045660; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043146112043146GT112043146-
NM_000038.5(APC):c.-30493C>T324APCLikely benignrs942777534RCV000532428; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043148112043148CT5:g.112043148C>TClinGen:CA124924686C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.9:g.112043148C>A324APCUncertain significancers942777534RCV001317863; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043148112043148CA112043148-
NM_000038.5(APC):c.-30492T>C324APCUncertain significancers866427693RCV000646686; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043149112043149TC5:g.112043149T>CClinGen:CA124924689C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.9:g.112043150C>G324APCUncertain significance-1RCV001909467; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043150112043150CG112043150-
NC_000005.9:g.112043150C>T324APCUncertain significance-1RCV001884066; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043150112043150CT112043150-
NM_000038.5(APC):c.-30490T>C324APCUncertain significancers1280021363RCV000646612; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043151112043151TC5:g.112043151T>CClinGen:CA658796598C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.-30489A>C324APCUncertain significancers956500063RCV000806280; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043152112043152AC5:g.112043152A>C-
NC_000005.9:g.112043152A>G324APCUncertain significancers956500063RCV001305505; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043152112043152AG112043152-
NC_000005.9:g.112043153G>T324APCUncertain significance-1RCV002022275; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043153112043153GT112043153-
NM_000038.5(APC):c.-30487T>C324APCUncertain significancers1312495728RCV000556365; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043154112043154TCNC_000005.9:g.112043154T>CClinGen:CA658655877C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.5(APC):c.-30487T>A324APCUncertain significancers1312495728RCV000646643; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043154112043154TA5:g.112043154T>AClinGen:CA658796599C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.9:g.112043154T>G324APCUncertain significance-1RCV001879045; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043154112043154TG112043154-
NM_000038.5(APC):c.-30486C>G324APCUncertain significancers748588164RCV000539378; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043155112043155CGNC_000005.9:g.112043155C>GClinGen:CA124924699C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.9:g.112043155C>T324APCUncertain significancers748588164RCV001349728; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043155112043155CT112043155-
NC_000005.9:g.112043156T>C324APCUncertain significance-1RCV001362462; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043156112043156TC112043156-
NM_000038.5(APC):c.-30484C>A324APCUncertain significancers1554060161RCV000646581; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043157112043157CA5:g.112043157C>AClinGen:CA658796600C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.9:g.112043157C>T324APCUncertain significance-1RCV001940802; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043157112043157CT112043157-
NC_000005.9:g.112043158C>T324APCUncertain significancers1360948145RCV001300737; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043158112043158CT112043158-
NC_000005.9:g.112043158C>G324APCUncertain significance-1RCV001362864; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043158112043158CG112043158-
NM_000038.5(APC):c.-30482G>C324APCUncertain significancers1409487828RCV000526915; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043159112043159GC5:g.112043159G>CClinGen:CA658655878C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.-30482G>A324APCUncertain significancers1409487828RCV000816322; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043159112043159GA5:g.112043159G>A-
NM_000038.6(APC):c.-30481G>T324APCUncertain significancers1580995745RCV000818050; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043160112043160GT5:g.112043160G>T-
NM_000038.5(APC):c.-30479C>A324APCUncertain significancers1424887097RCV000646690; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043162112043162CANC_000005.9:g.112043162C>AClinGen:CA658796601C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.9:g.112043162C>T324APCUncertain significance-1RCV001363118; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043162112043162CT112043162-
NM_000038.5(APC):c.-30478T>C324APCUncertain significancers931845291RCV000550858; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043163112043163TCNC_000005.9:g.112043163T>CClinGen:CA124924708C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.9:g.112043164G>C324APCUncertain significance-1RCV002036758; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043164112043164GC112043164-
NC_000005.9:g.112043164G>A324APCUncertain significance-1RCV001975409; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043164112043164GA112043164-
NM_000038.5(APC):c.-30476T>C324APCUncertain significancers538243333RCV000646537; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043165112043165TC5:g.112043165T>CClinGen:CA124924709C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.5(APC):c.-30476T>G324APCUncertain significancers538243333RCV000646626; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043165112043165TGNC_000005.9:g.112043165T>GClinGen:CA561890103C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.9:g.112043165T>A324APCUncertain significance-1RCV001897709; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043165112043165TA112043165-
NC_000005.9:g.112043166G>C324APCUncertain significancers1257302588RCV001308887; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043166112043166GC112043166-
NC_000005.9:g.112043167G>A324APCUncertain significance-1RCV001366282; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043167112043167GA112043167-
NM_000038.5(APC):c.-30471A>C324APCBenignrs75580617RCV000430440|RCV000646587|RCV001810903; NMedGen:CN169374|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN5172025112043170112043170AC5:g.112043170A>CClinGen:CA12120713C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.5(APC):c.-30467A>C324APCBenignrs190326008RCV000526023; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043174112043174AC5:g.112043174A>CClinGen:CA658655879C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.5(APC):c.-30467A>G324APCBenignrs190326008RCV000538385; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043174112043174AGNC_000005.9:g.112043174A>GClinGen:CA124924764C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.5(APC):c.-30467delA324APCBenignrs201014315RCV000601483|RCV000861801; NMedGen:CN169374|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043174112043174CACNC_000005.9:g.112043174delClinGen:CA124924761CN169374 not specified;
NM_000038.5(APC):c.-30466G>C324APCBenignrs59923692RCV000550019|RCV000606361; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN1693745112043175112043175GC5:g.112043175G>CClinGen:CA124924769C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.9:g.112043175G>A324APCUncertain significancers59923692RCV001296122; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043175112043175GA112043175-
NC_000005.9:g.112043175G>T324APCUncertain significancers59923692RCV001318900; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043175112043175GT112043175-
NC_000005.9:g.112043175del324APCBenign-1RCV002218719; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043175112043175AGA112043174-
NC_000005.9:g.112043176_112043178del324APCUncertain significancers1750567053RCV001305524; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043176112043178GCAAG112043175-
NC_000005.9:g.112043176C>T324APCUncertain significance-1RCV001360360; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043176112043176CT112043176-
NC_000005.9:g.112043176C>G324APCUncertain significance-1RCV001965627; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043176112043176CG112043176-
NC_000005.9:g.112043177A>G324APCUncertain significancers1750567134RCV001343123; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043177112043177AG112043177-
NM_000038.5(APC):c.-30460C>T324APCLikely benignrs145818737RCV000537525; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043181112043181CT5:g.112043181C>TClinGen:CA124924773C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.5(APC):c.-30460C>G324APCUncertain significancers145818737RCV000646670; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043181112043181CG5:g.112043181C>GClinGen:CA658796602C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.5(APC):c.-30459C>T324APCUncertain significancers1333841760RCV000556955; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043182112043182CTNC_000005.9:g.112043182C>TClinGen:CA658655880C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.9:g.112043182C>A324APCUncertain significancers1333841760RCV001306238; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043182112043182CA112043182-
NC_000005.9:g.112043182C>G324APCUncertain significancers1333841760RCV001316721; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043182112043182CG112043182-
NC_000005.9:g.112043182_112043183del324APCUncertain significance-1RCV001896571; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043182112043183CCTC112043181-
NM_000038.5(APC):c.-30458T>C324APCUncertain significancers1554060175RCV000549089; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043183112043183TCNC_000005.9:g.112043183T>CClinGen:CA658655881C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.9:g.112043184C>G324APCUncertain significancers1750567665RCV001344799; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043184112043184CG112043184-
NC_000005.9:g.112043184C>T324APCUncertain significance-1RCV001366743; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043184112043184CT112043184-
NC_000005.9:g.112043185T>C324APCUncertain significance-1RCV002017008; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043185112043185TC112043185-
NC_000005.9:g.112043186C>T324APCUncertain significance-1RCV001995604; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043186112043186CT112043186-
NM_000038.5(APC):c.-30453C>G324APCUncertain significancers1554060178RCV000536592; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043188112043188CGNC_000005.9:g.112043188C>GClinGen:CA658655882C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.9:g.112043190C>T324APCUncertain significance-1RCV001881339; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043190112043190CT112043190-
NM_000038.6(APC):c.-30450A>G324APCUncertain significancers1293734316RCV000809203; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043191112043191AG5:g.112043191A>G-
NM_001127511.3(APC):c.-220G>A324APCUncertain significancers1381567636RCV000805417; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043195112043195GA5:g.112043195G>A-
NM_001127511.3(APC):c.-219C>T324APCLikely benignrs1178835678RCV000560546; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043196112043196CT5:g.112043196C>TClinGen:CA561890110C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-218A>G324APCUncertain significancers1554060180RCV000646571; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043197112043197AG5:g.112043197A>GClinGen:CA658796603C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-217T>C324APCUncertain significancers1750568152RCV001340837; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043198112043198TC112043198-
NM_001127511.3(APC):c.-215G>A324APCUncertain significancers1750568226RCV001345742; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043200112043200GA112043200-
APC deletion324APCPathogenic-1RCV000000877; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043201112181937nanaOMIM:611731.0042C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-214T>C324APCUncertain significancers1580995847RCV000820804; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043201112043201TC5:g.112043201T>C-
NM_001127511.3(APC):c.-213A>G324APCUncertain significancers1554060181RCV000646636; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043202112043202AGNC_000005.9:g.112043202A>GClinGen:CA658796604C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-213A>T324APCUncertain significancers1554060181RCV000795000; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043202112043202AT5:g.112043202A>T-
NM_001127511.3(APC):c.-212G>A324APCUncertain significancers930090983RCV000543614; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043203112043203GA5:g.112043203G>AClinGen:CA124924783C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-210C>T324APCUncertain significance-1RCV001362162; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043205112043205CT112043205-
NM_001127511.3(APC):c.-208T>C324APCUncertain significancers1750568725RCV001307229; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043207112043207TC112043207-
NM_001127511.3(APC):c.-206C>T324APCUncertain significance-1RCV001372256; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043209112043209CT112043209-
NM_001127511.3(APC):c.-205C>T324APCUncertain significancers1750569011RCV001315985; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043210112043210CT112043210-
NM_001127511.3(APC):c.-205C>G324APCUncertain significancers1750569011RCV001340516; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043210112043210CG112043210-
NM_001127511.3(APC):c.-204A>G324APCConflicting interpretations of pathogenicityrs554351451RCV000535658|RCV000764556; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:C1851124,OMIM:135290, Orphanet:873; MONDO:MONDO:0002032,MedGen:C0699790; Human Phenotype Ontology:HP:0001402,Human Phenotype Ontology:HP:0002899,Human Phenotype Ontology:HP:0003007,Human Phenotype Onto5112043211112043211AGNC_000005.9:g.112043211A>GClinGen:CA124924789C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-203C>A324APCUncertain significance-1RCV001368327; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043212112043212CA112043212-
NM_001127511.3(APC):c.-203C>T324APCUncertain significance-1RCV001359292; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043212112043212CT112043212-
NM_001127511.3(APC):c.-201T>C324APCUncertain significancers1580995876RCV000818007; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043214112043214TC5:g.112043214T>C-
NM_001127511.3(APC):c.-200C>A324APCUncertain significancers1460379840RCV001323355; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043215112043215CA112043215-
NM_001127511.3(APC):c.-200C>T324APCUncertain significance-1RCV001372420; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043215112043215CT112043215-
NM_001127511.3(APC):c.-199C>G324APCUncertain significance-1RCV001361281; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043216112043216CG112043216-
NM_001127511.3(APC):c.-199C>T324APCLikely benign-1RCV001437739; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043216112043216CT112043216-
NM_001127511.3(APC):c.-197A>C324APCUncertain significancers1750570165RCV001302796; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043218112043218AC112043218-
NM_001127511.3(APC):c.-197A>T324APCUncertain significancers1750570165RCV001327548; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043218112043218AT112043218-
NM_001127511.3(APC):c.-197A>G324APCUncertain significance-1RCV001365772; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043218112043218AG112043218-
NM_001127511.3(APC):c.-196C>T324APCUncertain significance-1RCV001374016; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043219112043219CT112043219-
NM_001127511.3(APC):c.-193G>A324APCUncertain significancers1750570441RCV001180770|RCV001363069; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043222112043222GA5:g.112043222G>A-
NM_001127511.3(APC):c.-193G>C324APCUncertain significance-1RCV001362461; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043222112043222GC112043222-
NM_001127511.3(APC):c.-192A>G324APCLikely pathogenicrs879253784RCV000234977|RCV001290976|RCV001552789; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0017790,MedGen:C4749917,OMIM:619182, Orphanet:314022|MedGen:CN5172025112043223112043223AGNC_000005.9:g.112043223A>GClinGen:CA10584053,OMIM:611731.0055C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-192A>T324APCPathogenicrs879253784RCV000234988; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043223112043223ATNC_000005.9:g.112043223A>TClinGen:CA10584054,OMIM:611731.0056C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-192_-191delinsTAGCAAGGG324APCLikely pathogenicrs1580995904RCV000808449; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043223112043224ATTAGCAAGGG5:g.112043223_112043224insAGCAAGGG-
NM_001127511.3(APC):c.-191T>C324APCPathogenicrs879253783RCV000234996|RCV001013699|RCV001290975|RCV001559545; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0017790,MedGen:C4749917,OMIM:619182, Orphanet:314022|MedGen:CN5172025112043224112043224TCNC_000005.9:g.112043224T>CClinGen:CA10584052,OMIM:611731.0054C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-190G>A324APCPathogenicrs879253785RCV000234994; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043225112043225GANC_000005.9:g.112043225G>AClinGen:CA10584055,OMIM:611731.0057C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-189G>A324APCUncertain significance-1RCV002043144; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043226112043226GA112043226-
NM_001127511.3(APC):c.-188C>T324APCConflicting interpretations of pathogenicityrs761454123RCV000547204|RCV001524617; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112043227112043227CTNC_000005.9:g.112043227C>TClinGen:CA124924833C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-188C>A324APCUncertain significance-1RCV002048256; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043227112043227CA112043227-
NM_001127511.3(APC):c.-187G>A324APCUncertain significancers1554060186RCV000530192|RCV001185228; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112043228112043228GANC_000005.9:g.112043228G>AClinGen:CA658655883C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-186G>T324APCUncertain significancers1554060187RCV000646673; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043229112043229GT5:g.112043229G>TClinGen:CA658796605C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-186G>A324APCUncertain significancers1554060187RCV001345503; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043229112043229GA112043229-
NM_001127511.3(APC):c.-185A>C324APCUncertain significancers1433000483RCV001299896; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043230112043230AC112043230-
NM_001127511.3(APC):c.-184G>C324APCUncertain significancers575784409RCV000554174; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043231112043231GC5:g.112043231G>CClinGen:CA124924854C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-184G>A324APCUncertain significancers575784409RCV001303319; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043231112043231GA112043231-
NM_001127511.3(APC):c.-183G>A324APCUncertain significancers892252479RCV000806696; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043232112043232GA5:g.112043232G>A-
NM_001127511.3(APC):c.-182G>T324APCUncertain significancers1554060189RCV000529263; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043233112043233GTNC_000005.9:g.112043233G>TClinGen:CA658655884C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-182G>A324APCUncertain significance-1RCV001361723; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043233112043233GA112043233-
NM_001127511.3(APC):c.-181C>T324APCBenign/Likely benignrs115658307RCV000553273|RCV000614459|RCV001811056; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN169374|MedGen:CN5172025112043234112043234CTNC_000005.9:g.112043234C>TClinGen:CA124924856C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-180A>T324APCUncertain significance-1RCV001369380; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043235112043235AT112043235-
NM_001127511.3(APC):c.-179A>G324APCUncertain significance-1RCV001919358; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043236112043236AG112043236-
NM_001127511.3(APC):c.-178G>A324APCUncertain significancers1045323633RCV000646544; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043237112043237GA5:g.112043237G>AClinGen:CA124924858C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-178G>C324APCUncertain significance-1RCV001366624; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043237112043237GC112043237-
NM_001127511.3(APC):c.-177dup324APCUncertain significance-1RCV001367509; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043237112043238GGT112043237-
NM_001127511.3(APC):c.-177T>A324APCUncertain significancers1020491376RCV000540833; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043238112043238TA5:g.112043238T>AClinGen:CA658655885C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-177T>C324APCUncertain significancers1020491376RCV000646603; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043238112043238TCNC_000005.9:g.112043238T>CClinGen:CA658796606C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-175G>C324APCUncertain significancers1334013498RCV001324703; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043240112043240GC112043240-
NM_001127511.3(APC):c.-174C>A324APCUncertain significancers1580995974RCV000807200; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043241112043241CA5:g.112043241C>A-
NM_001127511.3(APC):c.-174C>T324APCUncertain significancers1580995974RCV001326635; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043241112043241CT112043241-
NM_001127511.3(APC):c.-173A>G324APCUncertain significancers1273775271RCV000528391; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043242112043242AGNC_000005.9:g.112043242A>GClinGen:CA658655886C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-172A>T324APCUncertain significancers1580995983RCV000792324; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043243112043243AT5:g.112043243A>T-
NM_001127511.3(APC):c.-167dup324APCBenign-1RCV001521009; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043243112043244AAG112043243-
NM_001127511.3(APC):c.-171G>C324APCUncertain significancers968943120RCV000646576; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043244112043244GC5:g.112043244G>CClinGen:CA124924868C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-171G>A324APCUncertain significancers968943120RCV000798515; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043244112043244GA5:g.112043244G>A-
NM_001127511.3(APC):c.-171G>T324APCUncertain significancers968943120RCV001302806; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043244112043244GT112043244-
NM_001127511.3(APC):c.-170G>C324APCUncertain significancers1000470082RCV000552392; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043245112043245GC5:g.112043245G>CClinGen:CA124924875C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-170G>T324APCUncertain significancers1000470082RCV001304929; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043245112043245GT112043245-
NM_001127511.3(APC):c.-170G>A324APCUncertain significance-1RCV001373613; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043245112043245GA112043245-
NM_001127511.3(APC):c.-169G>A324APCUncertain significancers1750575005RCV001324118; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043246112043246GA112043246-
NM_001127511.3(APC):c.-168G>A324APCUncertain significancers1554060194RCV000646596; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043247112043247GA5:g.112043247G>AClinGen:CA658796607C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-168G>T324APCUncertain significancers1554060194RCV001302234; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043247112043247GT112043247-
NM_001127511.3(APC):c.-167G>A324APCUncertain significancers1278244063RCV000539909; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043248112043248GANC_000005.9:g.112043248G>AClinGen:CA561890248C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-166C>G324APCUncertain significancers904001781RCV000551432; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043249112043249CGNC_000005.9:g.112043249C>GClinGen:CA658655887C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-166C>T324APCBenignrs904001781RCV000527458; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043249112043249CTNC_000005.9:g.112043249C>TClinGen:CA124924880C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-166C>A324APCUncertain significancers904001781RCV000534399; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043249112043249CA5:g.112043249C>AClinGen:CA658655888C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-165G>A324APCUncertain significancers1580996027RCV000809435; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043250112043250GA5:g.112043250G>A-
NM_001127511.3(APC):c.-165G>C324APCUncertain significancers1580996027RCV001321643; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043250112043250GC112043250-
NM_001127511.3(APC):c.-165G>T324APCUncertain significancers1580996027RCV001314742; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043250112043250GT112043250-
NM_001127511.3(APC):c.-164G>A324APCUncertain significancers1750576080RCV001320136; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043251112043251GA112043251-
NM_001127511.3(APC):c.-164G>C324APCUncertain significancers1750576080RCV001343771; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043251112043251GC112043251-
NM_001127511.3(APC):c.-163G>A324APCUncertain significancers558562104RCV000646539; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043252112043252GA5:g.112043252G>AClinGen:CA124924885C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-163G>C324APCUncertain significancers558562104RCV001318360; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043252112043252GC112043252-
NM_001127511.3(APC):c.-163G>T324APCUncertain significance-1RCV001918352; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043252112043252GT112043252-
NM_001127511.3(APC):c.-162G>A324APCUncertain significance-1RCV002009056; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043253112043253GA112043253-
NM_001127511.3(APC):c.-161T>A324APCUncertain significance-1RCV001991140; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043254112043254TA112043254-
NM_001127511.3(APC):c.-161T>C324APCUncertain significance-1RCV002013927; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043254112043254TC112043254-
NM_001127511.3(APC):c.-160G>A324APCUncertain significance-1RCV001361231; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043255112043255GA112043255-
NM_001127511.3(APC):c.-159T>C324APCUncertain significancers1750576513RCV001350673; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043256112043256TC112043256-
NM_001127511.3(APC):c.-158G>C324APCUncertain significancers1750576619RCV001320007; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043257112043257GC112043257-
NM_001127511.3(APC):c.-157G>A324APCUncertain significancers1554060197RCV000526505; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043258112043258GANC_000005.9:g.112043258G>AClinGen:CA658655889C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-156C>A324APCUncertain significancers1031181133RCV000646616; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043259112043259CANC_000005.9:g.112043259C>AClinGen:CA658796608C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-156C>T324APCUncertain significancers1031181133RCV000646625; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043259112043259CT5:g.112043259C>TClinGen:CA124924889C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-155C>A324APCUncertain significancers1750576936RCV001297397; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043260112043260CA112043260-
NM_001127511.3(APC):c.-155C>T324APCUncertain significancers1750576936RCV001323662; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043260112043260CT112043260-
NM_001127511.3(APC):c.-154G>C324APCUncertain significancers1750577100RCV001294634; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043261112043261GC112043261-
NM_001127511.3(APC):c.-154G>A324APCUncertain significancers1750577100RCV001325552; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043261112043261GA112043261-
NM_001127511.3(APC):c.-154G>T324APCUncertain significancers1750577100RCV001343031; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043261112043261GT112043261-
NM_001127511.3(APC):c.-153C>T324APCUncertain significancers956623923RCV000806610; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043262112043262CT5:g.112043262C>T-
NM_001127511.3(APC):c.-152C>T324APCBenignrs138386816RCV000550553|RCV000616769|RCV002060337; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN169374|MedGen:CN5172025112043263112043263CT5:g.112043263C>TClinGen:CA124924898C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-151G>C324APCLikely benignrs1029997545RCV000538059; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043264112043264GCNC_000005.9:g.112043264G>CClinGen:CA124924903C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-151G>A324APCUncertain significance-1RCV001365609; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043264112043264GA112043264-
NM_001127511.3(APC):c.-150G>A324APCUncertain significancers1459755551RCV000557474; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043265112043265GANC_000005.9:g.112043265G>AClinGen:CA658655890C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-150G>C324APCUncertain significancers1459755551RCV000816276; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043265112043265GC5:g.112043265G>C-
NM_001127511.3(APC):c.-149A>C324APCUncertain significancers922676017RCV000545084; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043266112043266ACNC_000005.9:g.112043266A>CClinGen:CA124924908C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-148A>C324APCUncertain significancers953056092RCV000819026; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043267112043267AC5:g.112043267A>C-
NM_001127511.3(APC):c.-148A>G324APCUncertain significancers953056092RCV001348151; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043267112043267AG112043267-
NM_001127511.3(APC):c.-148A>T324APCUncertain significancers953056092RCV001348176; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043267112043267AT112043267-
NM_001127511.3(APC):c.-147G>A324APCLikely benignrs1208195997RCV000793187; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043268112043268GA5:g.112043268G>A-
NM_001127511.3(APC):c.-147G>T324APCUncertain significance-1RCV001898946; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043268112043268GT112043268-
NM_001127511.3(APC):c.-146C>T324APCUncertain significancers1554060206RCV000537140; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043269112043269CT5:g.112043269C>TClinGen:CA658655891C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-146C>G324APCUncertain significancers1554060206RCV001346980; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043269112043269CG112043269-
NM_001127511.3(APC):c.-145C>G324APCUncertain significancers986030414RCV000646600; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043270112043270CG5:g.112043270C>GClinGen:CA124924910C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-145C>T324APCUncertain significancers986030414RCV000792927; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043270112043270CT5:g.112043270C>T-
NM_001127511.3(APC):c.-144T>G324APCUncertain significancers1717358972RCV001316485; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043271112043271TG112043271-
NM_001127511.3(APC):c.-144T>C324APCUncertain significancers1717358972RCV001340331; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043271112043271TC112043271-
NM_001127511.3(APC):c.-143A>G324APCUncertain significancers1750579345RCV001305624; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043272112043272AG112043272-
NM_001127511.3(APC):c.-142G>C324APCUncertain significancers951500465RCV000793786; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043273112043273GC5:g.112043273G>C-
NM_001127511.3(APC):c.-142G>A324APCUncertain significancers951500465RCV001347250; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043273112043273GA112043273-
NM_001127511.3(APC):c.-142G>T324APCUncertain significance-1RCV001371139; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043273112043273GT112043273-
NM_001127511.3(APC):c.-141C>T324APCUncertain significancers1750579738RCV001317237; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043274112043274CT112043274-
NM_001127511.3(APC):c.-141C>G324APCUncertain significancers1750579738RCV001342724; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043274112043274CG112043274-
NM_001127511.3(APC):c.-140C>G324APCConflicting interpretations of pathogenicityrs775297664RCV000556539|RCV000762155; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN5172025112043275112043275CGNC_000005.9:g.112043275C>GClinGen:CA124924916C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-140C>A324APCLikely benignrs775297664RCV000646695; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043275112043275CA5:g.112043275C>AClinGen:CA124924920C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-140C>T324APCUncertain significancers775297664RCV001347679; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043275112043275CT112043275-
NM_001127511.3(APC):c.-139G>C324APCUncertain significancers1554060208RCV000544155; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043276112043276GCNC_000005.9:g.112043276G>CClinGen:CA658655892C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-139G>A324APCUncertain significancers1554060208RCV001317238; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043276112043276GA112043276-
NM_001127511.3(APC):c.-138C>A324APCUncertain significancers1259973377RCV001304051; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043277112043277CA112043277-
NM_001127511.3(APC):c.-138C>G324APCUncertain significancers1259973377RCV001306956; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043277112043277CG112043277-
NM_001127511.3(APC):c.-138C>T324APCUncertain significance-1RCV001359776; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043277112043277CT112043277-
NM_001127511.3(APC):c.-137T>C324APCUncertain significancers1750580599RCV001351131; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043278112043278TC112043278-
NM_001127511.3(APC):c.-137T>G324APCUncertain significance-1RCV001891606; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043278112043278TG112043278-
NM_001127511.3(APC):c.-132_-114dup324APCUncertain significance-1RCV001985374; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043278112043279TTGCTCGGGGGGGACCTGCGG112043278-
NM_001127511.3(APC):c.-136G>C324APCUncertain significance-1RCV001371993; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043279112043279GC112043279-
NM_001127511.3(APC):c.-136G>A324APCUncertain significance-1RCV002045160; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043279112043279GA112043279-
NM_001127511.3(APC):c.-135C>T324APCUncertain significancers1311747020RCV000531681; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043280112043280CTNC_000005.9:g.112043280C>TClinGen:CA658655893C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-135C>G324APCUncertain significancers1311747020RCV000646534; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043280112043280CG5:g.112043280C>GClinGen:CA658796609C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-134T>C324APCUncertain significancers963346102RCV000646574; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043281112043281TC5:g.112043281T>CClinGen:CA124924933C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-134T>A324APCUncertain significancers963346102RCV000646644; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043281112043281TA5:g.112043281T>AClinGen:CA658796610C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-134_-133insGGG324APCLikely benignrs1561393341RCV000794578; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043281112043282TTGGG5:g.112043281_112043282insGGG-
NM_001127511.3(APC):c.-134_-133insGGGG324APCUncertain significancers1561393341RCV001306608; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043281112043282TTGGGG112043281-
NM_001127511.3(APC):c.-134_-133delinsCG324APCUncertain significancers1750581459RCV001321180; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043281112043282TCCG112043281-
NM_001127511.3(APC):c.-133dup324APCUncertain significance-1RCV001361945; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043281112043282TTC112043281-
NM_001127511.3(APC):c.-134_-133insG324APCBenign/Likely benign-1RCV001519124|RCV001562980; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN5172025112043281112043282TTG112043281-
NM_001127511.3(APC):c.-134_-133insGG324APCBenign-1RCV001516816; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043281112043282TTGG112043281-
NM_001127511.3(APC):c.-134_-133insGC324APCUncertain significance-1RCV001972938; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043281112043282TTGC112043281-
NM_001127511.3(APC):c.-133C>G324APCBenignrs79896135RCV000441233|RCV000646588; NMedGen:CN169374|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043282112043282CG5:g.112043282C>GClinGen:CA12132519C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-133C>T324APCLikely benignrs79896135RCV000555650; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043282112043282CT5:g.112043282C>TClinGen:CA124924944C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-133C>A324APCUncertain significancers79896135RCV000646624; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043282112043282CA5:g.112043282C>AClinGen:CA658796611C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-133_-132delinsGC324APCUncertain significancers1580996199RCV000824519; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043282112043283CGGCNC_000005.9:g.112043282_112043283delinsGC-
NM_001127511.3(APC):c.-133_-132insA324APCUncertain significancers1750582620RCV001307724; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043282112043283CCA112043282-
NM_001127511.3(APC):c.-133del324APCUncertain significancers371478422RCV001325809; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043282112043282TCT112043281-
NM_001127511.3(APC):c.-133_-132delinsGA324APCUncertain significance-1RCV001358953; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043282112043283CGGA112043282-
NM_001127511.3(APC):c.-133_-131delinsGTC324APCUncertain significance-1RCV001372328; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043282112043284CGGGTC112043282-
NM_001127511.3(APC):c.-133_-132delinsGT324APCBenign-1RCV001510747; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043282112043283CGGT112043282-
NM_001127511.3(APC):c.-127_-126dup324APCUncertain significance-1RCV001877904; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043282112043283CCGG112043282-
NM_001127511.3(APC):c.-132G>T324APCBenign/Likely benignrs182500056RCV000543232|RCV000611510; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN1693745112043283112043283GTNC_000005.9:g.112043283G>TClinGen:CA124924948C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-132G>C324APCLikely benignrs182500056RCV000530763; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043283112043283GC5:g.112043283G>CClinGen:CA124924947C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-132G>A324APCUncertain significancers182500056RCV000646608; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043283112043283GANC_000005.9:g.112043283G>AClinGen:CA658796612C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-132_-131insC324APCUncertain significance-1RCV001361356; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043283112043284GGC112043283-
NM_001127511.3(APC):c.-132_-131insT324APCLikely benign-1RCV001396129; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043283112043284GGT112043283-
NM_001127511.3(APC):c.-131G>A324APCBenignrs572582235RCV000525297; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043284112043284GANC_000005.9:g.112043284G>AClinGen:CA124924960C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-131G>C324APCLikely benignrs572582235RCV000542278; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043284112043284GCNC_000005.9:g.112043284G>CClinGen:CA124924962C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-131G>T324APCBenignrs572582235RCV000554731; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043284112043284GTNC_000005.9:g.112043284G>TClinGen:CA124924963C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-131_-130insT324APCUncertain significancers1750583446RCV001299755; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043284112043285GGT112043284-
NM_001127511.3(APC):c.-131_-130insC324APCUncertain significance-1RCV001363228; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043284112043285GGC112043284-
NM_001127511.3(APC):c.-130G>C324APCLikely benignrs1056513509RCV000541367; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043285112043285GCNC_000005.9:g.112043285G>CClinGen:CA124924964C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-130G>T324APCUncertain significancers1056513509RCV000553831; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043285112043285GTNC_000005.9:g.112043285G>TClinGen:CA124924965C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-130G>A324APCUncertain significancers1056513509RCV001304288; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043285112043285GA112043285-
NM_001127511.3(APC):c.-129G>A324APCUncertain significancers1750583768RCV001349247; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043286112043286GA112043286-
NM_001127511.3(APC):c.-124_-104dup324APCUncertain significance-1RCV001368749; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043286112043287GGGGGACCTGCGGGCTCAGGCCC112043286-
NM_001127511.3(APC):c.-128G>C324APCConflicting interpretations of pathogenicityrs543098847RCV000528919|RCV000764557; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:C1851124,OMIM:135290, Orphanet:873; MONDO:MONDO:0002032,MedGen:C0699790; Human Phenotype Ontology:HP:0001402,Human Phenotype Ontology:HP:0002899,Human Phenotype Ontology:HP:0003007,Human Phenotype Onto5112043287112043287GC5:g.112043287G>CClinGen:CA124924970C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-128G>A324APCUncertain significancers543098847RCV001342220; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043287112043287GA112043287-
NM_001127511.3(APC):c.-128G>T324APCUncertain significancers543098847RCV001348677; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043287112043287GT112043287-
NM_001127511.3(APC):c.-128_-127delinsTT324APCUncertain significance-1RCV001931280; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043287112043288GGTT112043287-
NM_001127511.3(APC):c.-127G>T324APCUncertain significancers1235543350RCV000818383; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043288112043288GT5:g.112043288G>T-
NM_001127511.3(APC):c.-127G>A324APCUncertain significance-1RCV001971955; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043288112043288GA112043288-
NM_001127511.3(APC):c.-127G>C324APCUncertain significance-1RCV001939053; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043288112043288GC112043288-
NM_001127511.3(APC):c.-126G>A324APCUncertain significancers948080320RCV000535873|RCV001805183; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112043289112043289GANC_000005.9:g.112043289G>AClinGen:CA124924998C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-126G>T324APCConflicting interpretations of pathogenicityrs948080320RCV000548369|RCV001183244|RCV001704678; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN5172025112043289112043289GTNC_000005.9:g.112043289G>TClinGen:CA124925003C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-126dup324APCBenign/Likely benignrs565045828RCV000861619|RCV001547554; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN5172025112043289112043289CCG5:g.112043282_112043283insGClinGen:CA124924946CN169374 not specified;
NM_001127511.3(APC):c.-126G>C324APCUncertain significancers948080320RCV000646530|RCV001561386; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN5172025112043289112043289GC5:g.112043289G>CClinGen:CA124925002C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-126del324APCUncertain significancers565045828RCV000807787; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043289112043289CGC5:g.112043283_112043283del-
NM_001127511.3(APC):c.-126_-125insT324APCUncertain significancers1750584693RCV001300520; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043289112043290GGT112043289-
NM_001127511.3(APC):c.-125A>T324APCUncertain significancers1045063324RCV000646651; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043290112043290AT5:g.112043290A>TClinGen:CA124925009C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-125A>C324APCUncertain significancers1045063324RCV001303581|RCV001751583; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN5172025112043290112043290AC112043290-
NM_001127511.3(APC):c.-124C>G324APCBenignrs964366695RCV000528009; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043291112043291CGNC_000005.9:g.112043291C>GClinGen:CA658655894C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-124C>T324APCUncertain significancers964366695RCV000646661; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043291112043291CT5:g.112043291C>TClinGen:CA124925012C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-123C>T324APCUncertain significancers185346146RCV000646663; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043292112043292CTNC_000005.9:g.112043292C>TClinGen:CA124925015C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-123C>G324APCUncertain significance-1RCV001984128; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043292112043292CG112043292-
NM_001127511.3(APC):c.-122T>G324APCUncertain significance-1RCV001910879; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043293112043293TG112043293-
NM_001127511.3(APC):c.-121G>C324APCUncertain significancers1173776603RCV000551717; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043294112043294GCNC_000005.9:g.112043294G>CClinGen:CA658655895C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-120C>T324APCUncertain significancers904073379RCV000536831; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043295112043295CTNC_000005.9:g.112043295C>TClinGen:CA124925018C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-119G>A324APCUncertain significancers1460028540RCV000558365; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043296112043296GANC_000005.9:g.112043296G>AClinGen:CA658655896C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-119G>C324APCUncertain significancers1460028540RCV000813148; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043296112043296GC5:g.112043296G>C-
NM_001127511.3(APC):c.-118G>T324APCUncertain significancers1372371966RCV000646541; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043297112043297GT5:g.112043297G>TClinGen:CA658796613C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-117_-97del324APCUncertain significancers1433763412RCV000810346; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043298112043318CCTGCGGGCTCAGGCCCGGGAGC5:g.112043292_112043312del-
NM_001127511.3(APC):c.-116C>T324APCUncertain significancers1750586844RCV001315146; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043299112043299CT112043299-
NM_001127511.3(APC):c.-116C>G324APCUncertain significancers1750586844RCV001342073; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043299112043299CG112043299-
NM_001127511.3(APC):c.-115T>C324APCUncertain significancers1580996349RCV000793940; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043300112043300TC5:g.112043300T>C-
NM_001127511.3(APC):c.-114C>G324APCUncertain significancers1452815000RCV000800259; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043301112043301CG5:g.112043301C>G-
NM_001127511.3(APC):c.-114C>A324APCUncertain significancers1452815000RCV001326051; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043301112043301CA112043301-
NM_001127511.3(APC):c.-113A>G324APCUncertain significancers1052992527RCV000548108; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043302112043302AG5:g.112043302A>GClinGen:CA124925024C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-113A>C324APCUncertain significance-1RCV001368818; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043302112043302AC112043302-
NM_001127511.3(APC):c.-112G>A324APCUncertain significancers1750587562RCV001317414; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043303112043303GA112043303-
NM_001127511.3(APC):c.-111G>A324APCUncertain significancers1750587691RCV001338654; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043304112043304GA112043304-
NM_001127511.3(APC):c.-110C>T324APCUncertain significancers1029692674RCV000646561; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043305112043305CT5:g.112043305C>TClinGen:CA124925027C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-109C>G324APCBenignrs761634030RCV000537737; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043306112043306CGNC_000005.9:g.112043306C>GClinGen:CA124925030C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-109C>A324APCUncertain significancers761634030RCV000804732; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043306112043306CA5:g.112043306C>A-
NM_001127511.3(APC):c.-109_-108delinsTG324APCUncertain significancers1750588164RCV001297588; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043306112043307CCTG112043306-
NM_001127511.3(APC):c.-109C>T324APCUncertain significance-1RCV001943010; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043306112043306CT112043306-
NM_001127511.3(APC):c.-108C>G324APCUncertain significancers561513597RCV000559288; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043307112043307CGNC_000005.9:g.112043307C>GClinGen:CA124925037C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-108C>T324APCUncertain significancers561513597RCV000646599; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043307112043307CT5:g.112043307C>TClinGen:CA658796614C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-108C>A324APCUncertain significancers561513597RCV000799022; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043307112043307CA5:g.112043307C>A-
NM_001127511.3(APC):c.-107G>A324APCUncertain significance-1RCV002009026; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043308112043308GA112043308-
NM_001127511.3(APC):c.-105G>C324APCUncertain significancers1337548978RCV000807170; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043310112043310GC5:g.112043310G>C-
NM_001127511.3(APC):c.-105G>A324APCUncertain significance-1RCV001373507; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043310112043310GA112043310-
NM_001127511.3(APC):c.-104A>T324APCUncertain significancers909684637RCV001318275; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043311112043311AT112043311-
NM_001127511.3(APC):c.-103G>C324APCUncertain significance-1RCV001372232; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043312112043312GC112043312-
NM_001127511.3(APC):c.-102C>T324APCUncertain significance-1RCV001365106; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043313112043313CT112043313-
NM_001127511.3(APC):c.-101T>G324APCUncertain significance-1RCV001904287; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043314112043314TG112043314-
NM_001127511.3(APC):c.-100G>A324APCUncertain significance-1RCV002026601; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043315112043315GA112043315-
NM_001127511.3(APC):c.-98G>A324APCUncertain significancers997256982RCV000544478; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043317112043317GANC_000005.9:g.112043317G>AClinGen:CA124925040C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-96A>C324APCUncertain significancers1411710258RCV000529573; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043319112043319AC5:g.112043319A>CClinGen:CA658655897C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-95C>T324APCUncertain significance-1RCV001901772; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043320112043320CT112043320-
NM_001127511.3(APC):c.-95C>G324APCUncertain significance-1RCV002024847; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043320112043320CG112043320-
NM_001127511.3(APC):c.-94C>A324APCUncertain significancers1219858068RCV001296621; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043321112043321CA112043321-
NM_001127511.3(APC):c.-94C>T324APCUncertain significance-1RCV001366878; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043321112043321CT112043321-
NM_001127511.3(APC):c.-93G>A324APCUncertain significance-1RCV002014115; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043322112043322GA112043322-
NM_001127511.3(APC):c.-92A>G324APCUncertain significancers1750589682RCV001295883; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043323112043323AG112043323-
NM_001127511.3(APC):c.-92A>T324APCUncertain significancers1750589682RCV001302403; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043323112043323AT112043323-
NM_001127511.3(APC):c.-91G>C324APCUncertain significancers1400212160RCV000818339; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043324112043324GC5:g.112043324G>C-
NM_001127511.3(APC):c.-91G>A324APCUncertain significance-1RCV001361389; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043324112043324GA112043324-
NM_001127511.3(APC):c.-90G>T324APCUncertain significancers1750590013RCV001300036; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043325112043325GT112043325-
NM_001127511.3(APC):c.-90G>A324APCUncertain significancers1750590013RCV001320645; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043325112043325GA112043325-
NM_001127511.3(APC):c.-89T>G324APCUncertain significancers1030112006RCV001347202; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043326112043326TG112043326-
NM_001127511.3(APC):c.-88T>G324APCUncertain significancers531931776RCV001308460; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043327112043327TG112043327-
NM_001127511.3(APC):c.-87G>A324APCUncertain significance-1RCV001359543; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043328112043328GA112043328-
NM_001127511.3(APC):c.-86G>C324APCUncertain significancers926522652RCV000646691; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043329112043329GC5:g.112043329G>CClinGen:CA561890258C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-86G>A324APCUncertain significance-1RCV001363517; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043329112043329GA112043329-
NM_001127511.3(APC):c.-85C>T324APCUncertain significancers1750590870RCV001317680; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043330112043330CT112043330-
NM_001127511.3(APC):c.-85C>A324APCUncertain significance-1RCV002005917; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043330112043330CA112043330-
NM_001127511.3(APC):c.-84T>C324APCUncertain significancers1340630542RCV000646611; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043331112043331TCNC_000005.9:g.112043331T>CClinGen:CA561890259C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-83C>A324APCUncertain significancers1306105402RCV000545384; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043332112043332CANC_000005.9:g.112043332C>AClinGen:CA658655898C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-83C>T324APCUncertain significancers1306105402RCV000560201; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043332112043332CTNC_000005.9:g.112043332C>TClinGen:CA561890261C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-83del324APCLikely benignrs1561393532RCV000804757; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043332112043332TCT5:g.112043332_112043332del-
NM_001127511.3(APC):c.-83C>G324APCUncertain significancers1306105402RCV000807582; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043332112043332CG5:g.112043332C>G-
NM_001127511.3(APC):c.-82G>T324APCUncertain significancers1750591561RCV001308901; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043333112043333GT112043333-
NM_001127511.3(APC):c.-82G>A324APCUncertain significancers1750591561RCV001347553; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043333112043333GA112043333-
NM_001127511.3(APC):c.-81A>G324APCUncertain significancers1395227226RCV001294381; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043334112043334AG112043334-
NM_001127511.3(APC):c.-79G>A324APCUncertain significancers1369181601RCV000530496; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043336112043336GANC_000005.9:g.112043336G>AClinGen:CA561890262C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-79G>T324APCUncertain significancers1369181601RCV001300865; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043336112043336GT112043336-
NM_001127511.3(APC):c.-78C>T324APCLikely benignrs953008592RCV000552073; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043337112043337CT5:g.112043337C>TClinGen:CA124925056C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-78C>G324APCUncertain significancers953008592RCV001349602; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043337112043337CG112043337-
NM_001127511.3(APC):c.-77T>C324APCUncertain significance-1RCV001372301; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043338112043338TC112043338-
NM_001127511.3(APC):c.-76G>T324APCUncertain significancers1750592062RCV001348932; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043339112043339GT112043339-
NM_001127511.3(APC):c.-74T>C324APCUncertain significancers1554060234RCV000541706; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043341112043341TC5:g.112043341T>CClinGen:CA658655899C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-73C>G324APCUncertain significancers1415610352RCV000531395; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043342112043342CGNC_000005.9:g.112043342C>GClinGen:CA658655900C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-71del324APCUncertain significancers1750592547RCV001347736; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043342112043342TCT112043341-
NM_001127511.3(APC):c.-72C>A324APCUncertain significance-1RCV001363372; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043343112043343CA112043343-
NM_001127511.3(APC):c.-71C>T324APCUncertain significancers544132569RCV000552986; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043344112043344CT5:g.112043344C>TClinGen:CA124925059C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-70A>C324APCUncertain significancers1580996503RCV000823709; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043345112043345AC5:g.112043345A>C-
NM_001127511.3(APC):c.-70A>G324APCUncertain significance-1RCV001372522; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043345112043345AG112043345-
NM_001127511.3(APC):c.-69G>C324APCUncertain significance-1RCV001945727; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043346112043346GC112043346-
NM_001127511.3(APC):c.-69G>A324APCUncertain significance-1RCV002015926; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043346112043346GA112043346-
NM_001127511.3(APC):c.-68G>A324APCUncertain significancers1163893701RCV000542632; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043347112043347GA5:g.112043347G>AClinGen:CA658655901C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-68G>C324APCUncertain significancers1163893701RCV000794432; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043347112043347GC5:g.112043347G>C-
NM_001127511.3(APC):c.-65C>T324APCUncertain significancers1473007055RCV000527765; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043350112043350CTNC_000005.9:g.112043350C>TClinGen:CA658655902C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-65_-64del324APCUncertain significancers1580996531RCV000801098; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043350112043351ACTA5:g.112043350_112043351del-
NM_001127511.3(APC):c.-64T>C324APCUncertain significancers1554060239RCV000549372; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043351112043351TCNC_000005.9:g.112043351T>CClinGen:CA658655903C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-62TTG[1]324APCUncertain significancers1750593628RCV001304629; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043351112043353CTGTC112043350-
NM_001127511.3(APC):c.-63G>A324APCUncertain significancers1369215546RCV001300279; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043352112043352GA112043352-
NM_001127511.3(APC):c.-63G>C324APCUncertain significance-1RCV001362239; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043352112043352GC112043352-
NM_001127511.3(APC):c.-61T>C324APCUncertain significancers1554060241RCV000646610; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043354112043354TCNC_000005.9:g.112043354T>CClinGen:CA658796615C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-61T>A324APCUncertain significance-1RCV002041983; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043354112043354TA112043354-
NM_001127511.3(APC):c.-60G>A324APCUncertain significancers1580996554RCV000794015; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043355112043355GA5:g.112043355G>A-
NM_001127511.3(APC):c.-60G>C324APCUncertain significance-1RCV001359942; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043355112043355GC112043355-
NM_001127511.3(APC):c.-59T>C324APCUncertain significancers1554060243RCV000646593; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043356112043356TC5:g.112043356T>CClinGen:CA658796616C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-59T>A324APCUncertain significancers1554060243RCV001304436; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043356112043356TA112043356-
NM_001127511.3(APC):c.-56_-47dup324APCUncertain significancers1750594271RCV001307715; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043356112043357TTTGGCTGTTGG112043356-
NM_001127511.3(APC):c.-58T>C324APCUncertain significance-1RCV002001173; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043357112043357TC112043357-
NM_001127511.3(APC):c.-57G>A324APCUncertain significancers1580996569RCV000810825; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043358112043358GA5:g.112043358G>A-
NM_001127511.3(APC):c.-56G>C324APCUncertain significance-1RCV001359222; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043359112043359GC112043359-
NM_001127511.3(APC):c.-55C>T324APCLikely benignrs1189950358RCV000538998; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043360112043360CTNC_000005.9:g.112043360C>TClinGen:CA658655904C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-53G>A324APCUncertain significancers1750595145RCV001326446; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043362112043362GA112043362-
NM_001127511.3(APC):c.-50G>C324APCUncertain significancers778974265RCV001312951; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043365112043365GC112043365-
NM_001127511.3(APC):c.-47G>A324APCUncertain significancers1750595339RCV001305396; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043368112043368GA112043368-
NM_001127511.3(APC):c.-46A>G324APCUncertain significancers1750595463RCV001307591; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043369112043369AG112043369-
NM_001127511.3(APC):c.-44G>A324APCUncertain significancers1162218041RCV001337953; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043371112043371GA112043371-
NM_001127511.3(APC):c.-41G>T324APCLikely benignrs748454058RCV000528691; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043374112043374GT5:g.112043374G>TClinGen:CA058285C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-41G>A324APCUncertain significance-1RCV001365080; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043374112043374GA112043374-
NM_001127511.3(APC):c.-41G>C324APCUncertain significance-1RCV001970789; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043374112043374GC112043374-
NM_001127511.3(APC):c.-40G>A324APCUncertain significancers1750595782RCV001299226; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043375112043375GA112043375-
NM_001127511.3(APC):c.-39T>A324APCUncertain significancers1466692709RCV000646667; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043376112043376TANC_000005.9:g.112043376T>AClinGen:CA561890264C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-39T>C324APCUncertain significancers1466692709RCV001349272; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043376112043376TC112043376-
NM_001127511.3(APC):c.-36dup324APCUncertain significance-1RCV001945110; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043377112043378GGA112043377-
NM_001127511.3(APC):c.-36A>G324APCUncertain significance-1RCV001371997; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043379112043379AG112043379-
NM_001127511.3(APC):c.-35G>C324APCUncertain significance-1RCV001371765; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043380112043380GC112043380-
NM_001127511.3(APC):c.-34C>T324APCUncertain significancers1376128351RCV000550248; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043381112043381CT5:g.112043381C>TClinGen:CA561890266C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-33A>T324APCUncertain significancers758576717RCV001344900; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043382112043382AT112043382-
NM_001127511.3(APC):c.-32C>T324APCUncertain significancers1015952631RCV000646660; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043383112043383CTNC_000005.9:g.112043383C>TClinGen:CA124925068C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-32del324APCUncertain significancers1750596841RCV001303567; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043383112043383ACA112043382-
NM_001127511.3(APC):c.-31T>G324APCBenignrs78429131RCV000507288|RCV001512459|RCV001712464; NMedGen:CN169374|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN5172025112043384112043384TG5:g.112043384T>GClinGen:CA057801CN169374 not specified;
NM_001127511.3(APC):c.-29_-24dup324APCUncertain significance-1RCV001875470; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043384112043385TTCAGTTG112043384-
NM_001127511.3(APC):c.-31T>C324APCUncertain significance-1RCV001996804; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043384112043384TC112043384-
NM_001127511.3(APC):c.-29A>G324APCUncertain significancers1750597287RCV001350726; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043386112043386AG112043386-
NM_001127511.3(APC):c.-28G>A324APCUncertain significancers1580996638RCV000801587; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043387112043387GA5:g.112043387G>A-
NM_001127511.3(APC):c.-28G>T324APCUncertain significancers1580996638RCV001297784; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043387112043387GT112043387-
NM_001127511.3(APC):c.-25G>A324APCUncertain significance-1RCV001918589; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043390112043390GA112043390-
NM_001127511.3(APC):c.-22T>G324APCUncertain significancers765199134RCV000808549; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043393112043393TG5:g.112043393T>G-
NM_001127511.3(APC):c.-21T>G324APCUncertain significancers1750597924RCV001299510; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043394112043394TG112043394-
NM_001127511.3(APC):c.-20C>A324APCUncertain significance-1RCV001988817; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043395112043395CA112043395-
NM_001127511.3(APC):c.-18C>G324APCUncertain significancers1357561329RCV000646640; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043397112043397CG5:g.112043397C>GClinGen:CA658796617C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-18C>A324APCUncertain significancers1357561329RCV000698295; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043397112043397CA5:g.112043397C>A-C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-18C>T324APCUncertain significance-1RCV002045681; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043397112043397CT112043397-
NM_001127511.3(APC):c.-17G>C324APCUncertain significancers1750598442RCV001342526; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043398112043398GC112043398-
NM_001127511.3(APC):c.-14C>T324APCUncertain significancers1554060248RCV000662369; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043401112043401CT5:g.112043401C>T-C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-13C>G324APCUncertain significancers1257473862RCV001339984; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043402112043402CG112043402-
NM_001127511.3(APC):c.-13C>T324APCUncertain significancers1257473862RCV001345625; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043402112043402CT112043402-
NM_001127511.3(APC):c.-12T>C324APCUncertain significancers1057517554RCV000409373; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043403112043403TC5:g.112043403T>CClinGen:CA16042075C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-11C>G324APCUncertain significancers1750599043RCV001313538; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043404112043404CG112043404-
NM_001127511.3(APC):c.-11C>T324APCUncertain significancers1750599043RCV001322123; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043404112043404CT112043404-
NM_001127511.3(APC):c.-10G>T324APCUncertain significancers1184095408RCV001352064; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043405112043405GT112043405-
NM_001127511.3(APC):c.-10G>A324APCUncertain significance-1RCV001360857; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043405112043405GA112043405-
NM_001127511.3(APC):c.-9G>A324APCUncertain significance-1RCV002027795; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043406112043406GA112043406-
NM_001127511.3(APC):c.-8C>G324APCUncertain significancers1750599549RCV001318053; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043407112043407CG112043407-
NM_001127511.3(APC):c.-8C>T324APCUncertain significancers1750599549RCV001324238; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043407112043407CT112043407-
NM_001127511.3(APC):c.-7_-6delinsAA324APCUncertain significancers1750599736RCV001307254; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043408112043409GCAA112043408-
NM_001127511.3(APC):c.-7G>A324APCUncertain significance-1RCV002042108; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043408112043408GA112043408-
NM_001127511.3(APC):c.-2del324APCUncertain significancers1257317812RCV001303681; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043409112043409GCG112043408-
NM_001127511.3(APC):c.-5C>T324APCUncertain significancers972010514RCV000646533; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043410112043410CT5:g.112043410C>TClinGen:CA124925090C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-5C>A324APCUncertain significancers972010514RCV000662776|RCV001855406; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043410112043410CA5:g.112043410C>A-C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-4C>G324APCUncertain significancers1750600295RCV001312824; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043411112043411CG112043411-
NM_001127511.3(APC):c.-3C>A324APCConflicting interpretations of pathogenicityrs771410311RCV000679420|RCV001308695; NMedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043412112043412CA5:g.112043412C>A-CN517202 not provided;
NM_001127511.3(APC):c.-3C>G324APCUncertain significance-1RCV001362143; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043412112043412CG112043412-
NM_001127511.3(APC):c.-3C>T324APCUncertain significance-1RCV002042922; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043412112043412CT112043412-
NM_001127511.3(APC):c.-2C>T324APCUncertain significancers1395970563RCV000556891; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043413112043413CTNC_000005.9:g.112043413C>TClinGen:CA561890274C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.-1T>A324APCUncertain significancers1750600817RCV001313214; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043414112043414TA112043414-
NM_001127511.3(APC):c.-1T>C324APCUncertain significancers1750600817RCV001348826; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043414112043414TC112043414-
NM_001127511.3(APC):c.-1T>G324APCUncertain significancers1750600817RCV001351327; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043414112043414TG112043414-
NM_001127511.3(APC):c.1A>G (p.Met1Val)324APCUncertain significancers189807660RCV000551159|RCV000764558|RCV001092762; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:C1851124,OMIM:135290, Orphanet:873; MONDO:MONDO:0002032,MedGen:C0699790; Human Phenotype Ontology:HP:0001402,Human Phenotype Ontology:HP:0002899,Human Phenotype Ontology:HP:0003007,Human Phenotype Onto5112043415112043415AG5:g.112043415A>GClinGen:CA124925094C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.1A>T (p.Met1Leu)324APCUncertain significancers189807660RCV000662980; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043415112043415AT5:g.112043415A>T-C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.2T>C (p.Met1Thr)324APCUncertain significance-1RCV001365459; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043416112043416TC112043416-
NM_001127511.3(APC):c.3G>A (p.Met1Ile)324APCUncertain significancers1057517567RCV000411262; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043417112043417GANC_000005.9:g.112043417G>AClinGen:CA16042076C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.7G>A (p.Ala3Thr)324APCUncertain significancers1170818329RCV001321219; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043421112043421GA112043421-
NM_001127511.3(APC):c.9C>T (p.Ala3=)324APCUncertain significancers1750602563RCV001307338; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043423112043423CT112043423-
NM_001127511.3(APC):c.10T>C (p.Ser4Pro)324APCUncertain significancers959934876RCV001300753; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043424112043424TC112043424-
NM_001127511.3(APC):c.10T>A (p.Ser4Thr)324APCUncertain significance-1RCV001373776; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043424112043424TA112043424-
NM_001127511.3(APC):c.12C>T (p.Ser4=)324APCUncertain significancers1554060261RCV000646609; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043426112043426CT5:g.112043426C>TClinGen:CA658796618C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.13C>G (p.Leu5Val)324APCUncertain significance-1RCV002025542; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043427112043427CG112043427-
NM_001127511.3(APC):c.16G>A (p.Gly6Ser)324APCConflicting interpretations of pathogenicityrs1043505718RCV000679422|RCV001079538; NMedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043430112043430GANC_000005.9:g.112043430G>AClinGen:CA124925107C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.17G>A (p.Gly6Asp)324APCUncertain significancers1304453341RCV000646592; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043431112043431GA5:g.112043431G>AClinGen:CA360611615C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.18C>T (p.Gly6=)324APCUncertain significance-1RCV002025525; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043432112043432CT112043432-
NM_001127511.3(APC):c.20C>T (p.Ser7Leu)324APCUncertain significancers1402688776RCV001295744; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043434112043434CT112043434-
NM_001127511.3(APC):c.22G>A (p.Gly8Ser)324APCLikely benignrs777188684RCV000646529; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043436112043436GA5:g.112043436G>AClinGen:CA056309C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.23G>A (p.Gly8Asp)324APCUncertain significance-1RCV001989696; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043437112043437GA112043437-
NM_001127511.3(APC):c.25C>A (p.Pro9Thr)324APCUncertain significancers1291188034RCV000646633; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043439112043439CANC_000005.9:g.112043439C>AClinGen:CA360611647C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.25C>T (p.Pro9Ser)324APCUncertain significancers1291188034RCV001298883; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043439112043439CT112043439-
NM_001127511.3(APC):c.25C>G (p.Pro9Ala)324APCUncertain significance-1RCV001368330; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043439112043439CG112043439-
NM_001127511.3(APC):c.26C>A (p.Pro9Gln)324APCUncertain significancers1342657032RCV001340890; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043440112043440CA112043440-
NM_001127511.3(APC):c.27G>C (p.Pro9=)324APCUncertain significancers761592349RCV000820364; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043441112043441GC5:g.112043441G>C-
NM_001127511.3(APC):c.27G>A (p.Pro9=)324APCUncertain significance-1RCV001889832; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043441112043441GA112043441-
NM_001127511.3(APC):c.28G>T (p.Val10Phe)324APCUncertain significancers1397116635RCV000646627; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043442112043442GTNC_000005.9:g.112043442G>TClinGen:CA360611672C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.30C>A (p.Val10=)324APCLikely benignrs917976853RCV000557808; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043444112043444CANC_000005.9:g.112043444C>AClinGen:CA124925115C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.30C>T (p.Val10=)324APCUncertain significancers917976853RCV001343440; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043444112043444CT112043444-
NM_001127511.3(APC):c.31G>A (p.Ala11Thr)324APCUncertain significancers1750604515RCV001314308; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043445112043445GA112043445-
NM_001127511.3(APC):c.35dup (p.Leu13fs)324APCUncertain significancers1750604836RCV001320124; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043445112043446GGC112043445-
NM_001127511.3(APC):c.32C>A (p.Ala11Asp)324APCUncertain significance-1RCV001359328; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043446112043446CA112043446-
NM_001127511.3(APC):c.32C>T (p.Ala11Val)324APCUncertain significance-1RCV001360638; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043446112043446CT112043446-
NM_001127511.3(APC):c.32C>G (p.Ala11Gly)324APCUncertain significance-1RCV002028779; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043446112043446CG112043446-
NM_001127511.3(APC):c.33C>G (p.Ala11=)324APCUncertain significancers1750604976RCV001302917; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043447112043447CG112043447-
NM_001127511.3(APC):c.34C>T (p.Pro12Ser)324APCUncertain significancers1316080865RCV000813925; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043448112043448CT5:g.112043448C>T-
NM_001127511.3(APC):c.36T>C (p.Pro12=)324APCUncertain significance-1RCV001988028; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043450112043450TC112043450-
NM_001127511.3(APC):c.40_49del (p.Pro14fs)324APCUncertain significance-1RCV001361077; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043452112043461TTGCCCGCTTCT112043451-
NM_001127511.3(APC):c.39G>C (p.Leu13Phe)324APCUncertain significancers772953367RCV000542972; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043453112043453GCNC_000005.9:g.112043453G>CClinGen:CA124925119C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.39G>A (p.Leu13=)324APCUncertain significancers772953367RCV000646647; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043453112043453GANC_000005.9:g.112043453G>AClinGen:CA650199572C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.39G>T (p.Leu13Phe)324APCUncertain significancers772953367RCV000799480; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043453112043453GT5:g.112043453G>T-
NM_001127511.3(APC):c.40C>T (p.Pro14Ser)324APCUncertain significancers1750605530RCV001345066; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043454112043454CT112043454-
NM_001127511.3(APC):c.41C>T (p.Pro14Leu)324APCUncertain significance-1RCV001366084; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043455112043455CT112043455-
NM_001127511.3(APC):c.42C>T (p.Pro14=)324APCUncertain significance-1RCV001366379; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043456112043456CT112043456-
NM_001127511.3(APC):c.42C>G (p.Pro14=)324APCUncertain significance-1RCV001894914; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043456112043456CG112043456-
NM_001127511.3(APC):c.45T>C (p.Ala15=)324APCUncertain significance-1RCV002006552; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043459112043459TC112043459-
NM_001127511.3(APC):c.46T>C (p.Ser16Pro)324APCUncertain significancers1554060278RCV000532648; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043460112043460TCNC_000005.9:g.112043460T>CClinGen:CA360611747C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.46T>G (p.Ser16Ala)324APCUncertain significancers1554060278RCV001347246; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043460112043460TG112043460-
NM_001127511.3(APC):c.47C>G (p.Ser16Cys)324APCUncertain significance-1RCV002004660; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043461112043461CG112043461-
NM_001127511.3(APC):c.47C>A (p.Ser16Tyr)324APCUncertain significance-1RCV001968713; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043461112043461CA112043461-
NM_001127511.3(APC):c.48T>C (p.Ser16=)324APCLikely benignrs980704771RCV000409172; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043462112043462TCNC_000005.9:g.112043462T>CClinGen:CA16042077C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.48T>G (p.Ser16=)324APCUncertain significancers980704771RCV000558748; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043462112043462TG5:g.112043462T>GClinGen:CA124925134C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.49G>A (p.Val17Ile)324APCUncertain significancers1750606571RCV001296677; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043463112043463GA112043463-
NM_001127511.3(APC):c.52C>G (p.Pro18Ala)324APCUncertain significance-1RCV001915419; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043466112043466CG112043466-
NM_001127511.3(APC):c.53C>T (p.Pro18Leu)324APCUncertain significancers1265754890RCV000799808; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043467112043467CT5:g.112043467C>T-
NM_001127511.3(APC):c.53C>G (p.Pro18Arg)324APCUncertain significancers1265754890RCV001321460; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043467112043467CG112043467-
NM_001127511.3(APC):c.57dup (p.Ser20fs)324APCUncertain significance-1RCV001364603; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043468112043469AAC112043468-
NM_001127511.3(APC):c.55C>T (p.Pro19Ser)324APCUncertain significance-1RCV002009293; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043469112043469CT112043469-
NM_001127511.3(APC):c.56C>T (p.Pro19Leu)324APCUncertain significancers1349659337RCV000805483; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043470112043470CT5:g.112043470C>T-
NM_001127511.3(APC):c.57C>T (p.Pro19=)324APCUncertain significance-1RCV001365700; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043471112043471CT112043471-
NM_001127511.3(APC):c.59C>G (p.Ser20Ter)324APCUncertain significance-1RCV001363958; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043473112043473CG112043473-
NM_001127511.3(APC):c.60A>T (p.Ser20=)324APCUncertain significance-1RCV001908601; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043474112043474AT112043474-
NM_001127511.3(APC):c.61G>T (p.Val21Phe)324APCUncertain significancers1750607281RCV001318783; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043475112043475GT112043475-
NM_001127511.3(APC):c.61G>C (p.Val21Leu)324APCUncertain significance-1RCV001917991; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043475112043475GC112043475-
NM_001127511.3(APC):c.63T>G (p.Val21=)324APCUncertain significance-1RCV001363036; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043477112043477TG112043477-
NM_001127511.3(APC):c.64C>T (p.Leu22Phe)324APCUncertain significancers1554060282RCV000533593; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043478112043478CT5:g.112043478C>TClinGen:CA360611829C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.64C>G (p.Leu22Val)324APCUncertain significance-1RCV001890980; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043478112043478CG112043478-
NM_001127511.3(APC):c.65T>C (p.Leu22Pro)324APCUncertain significancers1750607611RCV001345013; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043479112043479TC112043479-
NM_001127511.3(APC):c.66C>T (p.Leu22=)324APCUncertain significancers1422300065RCV000646639; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043480112043480CT5:g.112043480C>TClinGen:CA561890281C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.66C>A (p.Leu22=)324APCUncertain significancers1422300065RCV001313917; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043480112043480CA112043480-
NM_001127511.3(APC):c.67G>A (p.Gly23Arg)324APCUncertain significancers762748481RCV000555150; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043481112043481GANC_000005.9:g.112043481G>AClinGen:CA124925142C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.67G>C (p.Gly23Arg)324APCUncertain significance-1RCV001899561; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043481112043481GC112043481-
NM_001127511.3(APC):c.69G>T (p.Gly23=)324APCLikely benign-1RCV001414825; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043483112043483GT112043483-
NM_001127511.3(APC):c.71C>T (p.Ser24Phe)324APCConflicting interpretations of pathogenicityrs770241997RCV000410042; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043485112043485CTNC_000005.9:g.112043485C>TClinGen:CA059369C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.71C>G (p.Ser24Cys)324APCUncertain significancers770241997RCV000802312; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043485112043485CG5:g.112043485C>G-
NM_001127511.3(APC):c.73T>G (p.Trp25Gly)324APCUncertain significance-1RCV002026809; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043487112043487TG112043487-
NM_001127511.3(APC):c.74G>A (p.Trp25Ter)324APCUncertain significancers1554060285RCV000529960; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043488112043488GA5:g.112043488G>AClinGen:CA360611862C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.74G>C (p.Trp25Ser)324APCUncertain significance-1RCV001983990; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043488112043488GC112043488-
NM_001127511.3(APC):c.77G>T (p.Ser26Ile)324APCUncertain significancers775738268RCV000805826|RCV001766678; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0005575,MedGen:C0346629,OMIM:1145005112043491112043491GT5:g.112043491G>T-
NM_001127511.3(APC):c.77G>A (p.Ser26Asn)324APCUncertain significancers775738268RCV001307154; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043491112043491GA112043491-
NM_001127511.3(APC):c.78C>A (p.Ser26Arg)324APCBenignrs113782655RCV000120009|RCV000123676|RCV000238598|RCV000410035; NMedGen:CN169374|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021055,MedGen:C0032580,OMIM:PS175100, Orphanet:733|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043492112043492CA5:g.112043492C>AClinGen:CA025425C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.78C>T (p.Ser26=)324APCUncertain significancers113782655RCV001319105; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043492112043492CT112043492-
NM_001127511.3(APC):c.78C>G (p.Ser26Arg)324APCUncertain significance-1RCV001364958; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043492112043492CG112043492-
NM_001127511.3(APC):c.80C>T (p.Thr27Ile)324APCUncertain significancers1400852847RCV000541191; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043494112043494CTNC_000005.9:g.112043494C>TClinGen:CA360611897C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.80C>G (p.Thr27Ser)324APCUncertain significancers1400852847RCV001315192; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043494112043494CG112043494-
NM_001127511.3(APC):c.82G>C (p.Gly28Arg)324APCUncertain significancers1297745273RCV001318655; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043496112043496GC112043496-
NM_001127511.3(APC):c.82G>A (p.Gly28Ser)324APCUncertain significancers1297745273RCV001342926; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043496112043496GA112043496-
NM_001127511.3(APC):c.83G>A (p.Gly28Asp)324APCUncertain significancers1057517606RCV000409724; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043497112043497GANC_000005.9:g.112043497G>AClinGen:CA16042078C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.84C>A (p.Gly28=)324APCUncertain significancers1750609849RCV001302104; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043498112043498CA112043498-
NM_001127511.3(APC):c.85G>T (p.Gly29Cys)324APCUncertain significancers1580996980RCV000804524; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043499112043499GT5:g.112043499G>T-
NM_001127511.3(APC):c.85G>A (p.Gly29Ser)324APCUncertain significance-1RCV001361199; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043499112043499GA112043499-
NM_001127511.3(APC):c.86G>A (p.Gly29Asp)324APCUncertain significancers1337289014RCV000526272; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043500112043500GA5:g.112043500G>AClinGen:CA360611917C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.87C>T (p.Gly29=)324APCUncertain significancers1750610368RCV001317755; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043501112043501CT112043501-
NM_001127511.3(APC):c.88A>T (p.Ser30Cys)324APCUncertain significance-1RCV002004278; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043502112043502AT112043502-
NM_001127511.3(APC):c.90C>T (p.Ser30=)324APCUncertain significance-1RCV001360332; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043504112043504CT112043504-
NM_001127511.3(APC):c.91A>C (p.Arg31=)324APCUncertain significancers1302045127RCV000646558; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043505112043505AC5:g.112043505A>CClinGen:CA561890291C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.92G>A (p.Arg31Lys)324APCUncertain significancers1750610701RCV001297134; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043506112043506GA112043506-
NM_001127511.3(APC):c.93G>T (p.Arg31Ser)324APCUncertain significance-1RCV001972922; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043507112043507GT112043507-
NM_001127511.3(APC):c.96C>G (p.Ser32Arg)324APCUncertain significancers1446044641RCV001307352; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043510112043510CG112043510-
NM_001127511.3(APC):c.97_112del (p.Cys33fs)324APCUncertain significance-1RCV001362821; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043511112043526CTGCGTCCGGCAGGAGAC112043510-
NM_001127511.3(APC):c.98_99delinsTT (p.Cys33Phe)324APCUncertain significancers1750611037RCV001324127; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043512112043513GCTT112043512-
NM_001127511.3(APC):c.99C>T (p.Cys33=)324APCUncertain significancers1312161630RCV000646563; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043513112043513CT5:g.112043513C>TClinGen:CA561890293C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.100G>A (p.Val34Ile)324APCUncertain significancers1232734822RCV000646556; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043514112043514GANC_000005.9:g.112043514G>AClinGen:CA360611986C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.100_101del (p.Val34fs)324APCUncertain significancers1750611348RCV001342562; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043514112043515CGTC112043513-
NM_001127511.3(APC):c.100G>T (p.Val34Phe)324APCUncertain significance-1RCV002010435; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043514112043514GT112043514-
NM_001127511.3(APC):c.102C>T (p.Val34=)324APCUncertain significancers763659488RCV001305362; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043516112043516CT112043516-
NM_001127511.3(APC):c.102C>G (p.Val34=)324APCUncertain significancers763659488RCV001348304; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043516112043516CG112043516-
NM_001127511.3(APC):c.103C>T (p.Arg35Trp)324APCUncertain significancers1554060293RCV000646590; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043517112043517CT5:g.112043517C>TClinGen:CA360611991C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.103C>G (p.Arg35Gly)324APCUncertain significancers1554060293RCV001320476; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043517112043517CG112043517-
NM_001127511.3(APC):c.104G>T (p.Arg35Leu)324APCUncertain significance-1RCV001925304; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043518112043518GT112043518-
NM_001127511.3(APC):c.104G>C (p.Arg35Pro)324APCUncertain significance-1RCV002040349; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043518112043518GC112043518-
NM_001127511.3(APC):c.106C>A (p.Gln36Lys)324APCUncertain significancers773941688RCV001352607; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043520112043520CA112043520-
NM_001127511.3(APC):c.106C>T (p.Gln36Ter)324APCUncertain significance-1RCV001897387; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043520112043520CT112043520-
NM_001127511.3(APC):c.107A>G (p.Gln36Arg)324APCUncertain significancers1580997050RCV000815945; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043521112043521AG5:g.112043521A>G-
NM_001127511.3(APC):c.109G>A (p.Glu37Lys)324APCUncertain significance-1RCV001366905; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043523112043523GA112043523-
NM_001127511.3(APC):c.113C>T (p.Thr38Met)324APCUncertain significancers1484678720RCV000803846; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043527112043527CT5:g.112043527C>T-
NM_001127511.3(APC):c.114G>A (p.Thr38=)324APCUncertain significancers761467156RCV000547842; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043528112043528GANC_000005.9:g.112043528G>AClinGen:CA561890299C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.114G>C (p.Thr38=)324APCUncertain significancers761467156RCV001298123; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043528112043528GC112043528-
NM_001127511.3(APC):c.114G>T (p.Thr38=)324APCUncertain significance-1RCV001368273; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043528112043528GT112043528-
NM_001127511.3(APC):c.116A>G (p.Lys39Arg)324APCUncertain significancers1750612690RCV001306059; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043530112043530AG112043530-
NM_001127511.3(APC):c.117G>C (p.Lys39Asn)324APCUncertain significancers1750612789RCV001322125; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043531112043531GC112043531-
NM_001127511.3(APC):c.118A>T (p.Ser40Cys)324APCUncertain significance-1RCV001365647; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043532112043532AT112043532-
NM_001127511.3(APC):c.119G>C (p.Ser40Thr)324APCConflicting interpretations of pathogenicityrs587778028RCV000120010|RCV000542057|RCV001705881; NMedGen:CN169374|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN5172025112043533112043533GC5:g.112043533G>CClinGen:CA023283C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.119G>A (p.Ser40Asn)324APCUncertain significancers587778028RCV000646658; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043533112043533GA5:g.112043533G>AClinGen:CA360612041C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.119G>T (p.Ser40Ile)324APCUncertain significancers587778028RCV001317084; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043533112043533GT112043533-
NM_001127511.3(APC):c.120C>A (p.Ser40Arg)324APCUncertain significancers1750613117RCV001295321; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043534112043534CA112043534-
NM_001127511.3(APC):c.120C>T (p.Ser40=)324APCUncertain significance-1RCV001869874; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043534112043534CT112043534-
NM_001127511.3(APC):c.121C>G (p.Pro41Ala)324APCUncertain significancers1248809012RCV000646688; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043535112043535CGNC_000005.9:g.112043535C>GClinGen:CA360612047C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.122C>T (p.Pro41Leu)324APCConflicting interpretations of pathogenicityrs1057517584RCV000410173; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043536112043536CT5:g.112043536C>TClinGen:CA16042079C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.122C>G (p.Pro41Arg)324APCUncertain significancers1057517584RCV001337376; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043536112043536CG112043536-
NM_001127511.3(APC):c.123G>A (p.Pro41=)324APCUncertain significancers1189155420RCV000646641; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043537112043537GA5:g.112043537G>AClinGen:CA650199593C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.123G>T (p.Pro41=)324APCUncertain significancers1189155420RCV000646559; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043537112043537GT5:g.112043537G>TClinGen:CA561890306C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.123G>C (p.Pro41=)324APCUncertain significancers1189155420RCV001301877; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043537112043537GC112043537-
NM_001127511.3(APC):c.123_124insTACTTCT (p.Gly42fs)324APCUncertain significance-1RCV001996465; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043537112043538GGTACTTCT112043537-
NM_001127511.3(APC):c.124G>A (p.Gly42Ser)324APCUncertain significancers1057517582RCV000411411; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043538112043538GANC_000005.9:g.112043538G>AClinGen:CA16042080C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.125G>A (p.Gly42Asp)324APCConflicting interpretations of pathogenicityrs1057517570RCV000409742|RCV000679421; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN5172025112043539112043539GANC_000005.9:g.112043539G>AClinGen:CA16042081C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.125G>C (p.Gly42Ala)324APCUncertain significancers1057517570RCV001326936; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043539112043539GC112043539-
NM_001127511.3(APC):c.127G>A (p.Gly43Ser)324APCUncertain significancers1171615515RCV000814998; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043541112043541GA5:g.112043541G>A-
NM_001127511.3(APC):c.129C>T (p.Gly43=)324APCUncertain significancers1750614449RCV001345014; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043543112043543CT112043543-
NM_001127511.3(APC):c.130G>A (p.Ala44Thr)324APCConflicting interpretations of pathogenicityrs367773779RCV000412427; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043544112043544GANC_000005.9:g.112043544G>AClinGen:CA053928C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.130G>C (p.Ala44Pro)324APCUncertain significancers367773779RCV000533875; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043544112043544GCNC_000005.9:g.112043544G>CClinGen:CA360612075C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.131C>G (p.Ala44Gly)324APCUncertain significancers1750614704RCV001305391; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043545112043545CG112043545-
NM_001127511.3(APC):c.133C>T (p.Arg45Cys)324APCUncertain significancers755954869RCV000549716; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043547112043547CTNC_000005.9:g.112043547C>TClinGen:CA053936C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.133C>A (p.Arg45Ser)324APCUncertain significance-1RCV001364644; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043547112043547CA112043547-
NM_001127511.3(APC):c.133C>G (p.Arg45Gly)324APCUncertain significance-1RCV001366854; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043547112043547CG112043547-
NM_001127511.3(APC):c.134G>C (p.Arg45Pro)324APCUncertain significancers1004213568RCV000646679; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043548112043548GC5:g.112043548G>CClinGen:CA124925217C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.134G>A (p.Arg45His)324APCUncertain significancers1004213568RCV000662997; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043548112043548GA5:g.112043548G>A-C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.136A>C (p.Thr46Pro)324APCUncertain significancers766151900RCV000646578; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043550112043550ACNC_000005.9:g.112043550A>CClinGen:CA054190C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.136A>G (p.Thr46Ala)324APCUncertain significance-1RCV002025495; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043550112043550AG112043550-
NM_001127511.3(APC):c.137C>T (p.Thr46Ile)324APCUncertain significancers1016971418RCV000614706|RCV001309343; NMedGen:CN169374|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043551112043551CT5:g.112043551C>TClinGen:CA360612118CN169374 not specified;
NM_001127511.3(APC):c.140C>G (p.Ser47Cys)324APCUncertain significancers1750615769RCV001324696; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043554112043554CG112043554-
NM_001127511.3(APC):c.140C>T (p.Ser47Phe)324APCUncertain significance-1RCV001946127; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043554112043554CT112043554-
NM_001127511.3(APC):c.141T>G (p.Ser47=)324APCUncertain significance-1RCV001373746; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043555112043555TG112043555-
NM_001127511.3(APC):c.141T>A (p.Ser47=)324APCUncertain significance-1RCV002030933; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043555112043555TA112043555-
NM_001127511.3(APC):c.145C>T (p.His49Tyr)324APCUncertain significancers933496509RCV001346981; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043559112043559CT112043559-
NM_001127511.3(APC):c.146del (p.His49fs)324APCUncertain significancers1750616412RCV001309908; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043560112043560CAC112043559-
NM_001127511.3(APC):c.146A>G (p.His49Arg)324APCUncertain significancers1191401517RCV001306050; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043560112043560AG112043560-
NM_001127511.3(APC):c.148T>C (p.Trp50Arg)324APCUncertain significancers1488176769RCV000646675; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043562112043562TC5:g.112043562T>CClinGen:CA360612160C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.148T>G (p.Trp50Gly)324APCUncertain significance-1RCV001363263; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043562112043562TG112043562-
NM_001127511.3(APC):c.149G>C (p.Trp50Ser)324APCUncertain significancers1366978080RCV000662474; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043563112043563GC5:g.112043563G>C-C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.150G>A (p.Trp50Ter)324APCUncertain significancers1163442131RCV000534823; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043564112043564GA5:g.112043564G>AClinGen:CA360612168C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.150G>C (p.Trp50Cys)324APCUncertain significance-1RCV001936523; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043564112043564GC112043564-
NM_001127511.3(APC):c.151G>A (p.Ala51Thr)324APCUncertain significancers1750617136RCV001342161; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043565112043565GA112043565-
NM_001127511.3(APC):c.151G>C (p.Ala51Pro)324APCUncertain significance-1RCV001892189; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043565112043565GC112043565-
NM_001127511.3(APC):c.152C>T (p.Ala51Val)324APCUncertain significance-1RCV001371893; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043566112043566CT112043566-
NM_001127511.3(APC):c.153G>T (p.Ala51=)324APCUncertain significancers1750617341RCV001321462; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043567112043567GT112043567-
NM_001127511.3(APC):c.153G>A (p.Ala51=)324APCUncertain significance-1RCV001932427; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043567112043567GA112043567-
NM_001127511.3(APC):c.154A>G (p.Ser52Gly)324APCUncertain significancers1554060315RCV000646564; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043568112043568AG5:g.112043568A>GClinGen:CA360612183C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.155G>C (p.Ser52Thr)324APCUncertain significancers1554060317RCV000646549; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043569112043569GC5:g.112043569G>CClinGen:CA360612189C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.156C>T (p.Ser52=)324APCUncertain significancers1051954601RCV001319834; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043570112043570CT112043570-
NM_001127511.3(APC):c.156C>A (p.Ser52Arg)324APCUncertain significance-1RCV001370584; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043570112043570CA112043570-
NM_001127511.3(APC):c.157G>C (p.Val53Leu)324APCUncertain significancers888841371RCV000560864; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043571112043571GCNC_000005.9:g.112043571G>CClinGen:CA124925269C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.159C>T (p.Val53=)324APCUncertain significancers1277365767RCV001303660; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043573112043573CT112043573-
NM_001127511.3(APC):c.159C>G (p.Val53=)324APCUncertain significance-1RCV001970881; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043573112043573CG112043573-
NM_001127511.3(APC):c.160T>C (p.Trp54Arg)324APCUncertain significance-1RCV001932337; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043574112043574TC112043574-
NM_001127511.3(APC):c.161G>A (p.Trp54Ter)324APCUncertain significancers1750617951RCV001310027; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043575112043575GA112043575-
NM_001127511.3(APC):c.161G>C (p.Trp54Ser)324APCUncertain significance-1RCV001872758; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043575112043575GC112043575-
NM_001127511.3(APC):c.163C>A (p.Gln55Lys)324APCUncertain significancers1312050427RCV000646582; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043577112043577CANC_000005.9:g.112043577C>AClinGen:CA360612224C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.163C>T (p.Gln55Ter)324APCUncertain significancers1312050427RCV001346504; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043577112043577CT112043577-
NM_001127511.3(APC):c.164A>G (p.Gln55Arg)324APCUncertain significance-1RCV002028124; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043578112043578AG112043578-
NM_001127511.3(APC):c.165G>C (p.Gln55His)324APCUncertain significancers1369553472RCV001346693; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043579112043579GC112043579-
NM_001127511.3(APC):c.165+1G>A324APCUncertain significancers1239946140RCV000646550; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043580112043580GANC_000005.9:g.112043580G>AClinGen:CA360612237C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.165+6_165+9del324APCUncertain significance-1RCV001919883; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043580112043583GGTGAG112043579-
NM_001127511.3(APC):c.165+3G>T324APCUncertain significancers765384591RCV000646606; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043582112043582GT5:g.112043582G>TClinGen:CA124925282C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.165+4A>G324APCUncertain significancers1750618752RCV001327098; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043583112043583AG112043583-
NM_001127511.3(APC):c.165+9G>A324APCUncertain significance-1RCV001978200; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043588112043588GA112043588-
NM_001127511.3(APC):c.165+10G>T324APCUncertain significancers1296416614RCV000646620; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043589112043589GTNC_000005.9:g.112043589G>TClinGen:CA561890341C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.165+10_165+18del324APCUncertain significancers1750619239RCV001351067; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043589112043597GGCTGCAGGCG112043588-
NM_001127511.3(APC):c.165+13G>A324APCUncertain significance-1RCV001932623; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043592112043592GA112043592-
NM_001127511.3(APC):c.165+15A>G324APCUncertain significancers1750619444RCV001326407; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043594112043594AG112043594-
NM_001127511.3(APC):c.165+16G>C324APCBenignrs1223298182RCV000646649; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043595112043595GCNC_000005.9:g.112043595G>CClinGen:CA658796620C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.165+16G>A324APCUncertain significancers1223298182RCV001324244; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043595112043595GA112043595-
NM_001127511.3(APC):c.165+17G>T324APCUncertain significancers1057517556RCV000410745|RCV001861405; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043596112043596GTNC_000005.9:g.112043596G>TClinGen:CA16042082C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.165+17G>A324APCUncertain significancers1057517556RCV000546057; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043596112043596GANC_000005.9:g.112043596G>AClinGen:CA658655905C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.165+19A>G324APCUncertain significancers1487833679RCV000535698; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043598112043598AG5:g.112043598A>GClinGen:CA561890344C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.165+20T>C324APCUncertain significancers1191699028RCV000557239; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043599112043599TC5:g.112043599T>CClinGen:CA658655906C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.165+20T>A324APCUncertain significance-1RCV001962394; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112043599112043599TA112043599-
NC_000005.10:g.(?_112737024)_(112844132_?)del324APCPathogenic-1RCV000560788; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112072721112179829nana-C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.9:g.(?_112072721)_(112111440_?)dup324APCLikely pathogenic-1RCV000550240|RCV001858057; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112072721112111440nana-C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.10:g.(?_112737024)_(112766416_?)del324APCPathogenic-1RCV000646697; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112072721112102113nana-C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.9:g.(?_112072721)_(112090728_?)dup324APCLikely pathogenic-1RCV000708496; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112072721112090728nana-C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.10:g.(?_112737024)_(112844136_?)del324APCPathogenic-1RCV000813966|RCV001869257; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112072721112179833nana-
NC_000005.10:g.(?_112737024)_(112737888_?)dup324APCUncertain significance-1RCV001032266|RCV001862450; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112072721112073585nana-1-
NC_000005.9:g.(?_112072721)_(112090732_?)dup324APCLikely pathogenic-1RCV001378397; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112072721112090732nana-1-
NC_000005.9:g.(?_112072721)_(112179823_?)del324APCPathogenic-1RCV001385949; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112072721112179823nana-1-
NC_000005.9:g.(?_112072721)_(112073585_?)del324APCUncertain significance-1RCV001864645; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112072721112073585nana-1-
NC_000005.9:g.(?_112072721)_(112116610_?)dup324APCLikely pathogenic-1RCV002042776; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112072721112116610nana-1-
NM_001127511.3(APC):c.166-29015A>T324APCBenignrs75581138RCV000602321|RCV000663007; NMedGen:CN169374|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112073008112073008AT5:g.112073008A>TClinGen:CA124948485C2713442 175100 Familial adenomatous polyposis 1;
NM_001127511.3(APC):c.166-28546T>C324APCBenign/Likely benignrs113017087RCV000208994|RCV000615963|RCV001519059; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN169374|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112073477112073477TC5:g.112073477T>CClinGen:CA351238C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.5(APC):c.-85_*2113del324APCPathogenic-1RCV000232813; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112073556112181936nana-C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.10:g.(?_112737859)_(112815593_?)del324APCPathogenic-1RCV000470226; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112073556112151290nana-C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.-43A>C324APCUncertain significancers879254014RCV000235958|RCV000708948; NMedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112073598112073598ACNC_000005.9:g.112073598A>CClinGen:CA10584232C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.-19+45G>A324APCLikely benignrs370011472RCV000829439|RCV000987547; NMedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112073667112073667GA5:g.112073667G>A-
NM_000038.6(APC):c.-19+416C>T324APCLikely benignrs976627265RCV000987548; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112074038112074038CT5:g.112074038C>T-
NC_000005.9:g.(?_112090570)_(112157688_?)dup324APCLikely pathogenic-1RCV000469367; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090570112157688nana-C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.9:g.(?_112090578)_(112111444_?)dup324APCUncertain significance-1RCV000813971; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090578112111444nana-
NC_000005.9:g.(?_112090582)_(112111440_?)dup324APCUncertain significance-1RCV000549344; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090582112111440nana-C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.9:g.(?_112090582)_(112137086_?)dup324APCLikely pathogenic-1RCV001378396; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090582112137086nana-1-
NC_000005.9:g.(?_112090582)_(112157694_?)dup324APCLikely pathogenic-1RCV001378245; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090582112157694nana-1-
NM_000038.6(APC):c.-2_135+1274del324APCPathogenic-1RCV001355291; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090586112091996AGGATGGCTGCAGCTTCATATGATCAGTTGTTAAAGCAAGTTGAGGCACTGAAGATGGAGAACTCAAATCTTCGACAAGAGCTAGAAGATAATTCCAATCATCTTACAAAA112090585-
NC_000005.10:g.(?_112754891)_(112767400_?)del324APCPathogenic-1RCV001033106|RCV001873435; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090588112103097nana-1-
NC_000005.10:g.(?_112754891)_(112767400_?)dup324APCLikely pathogenic-1RCV001031137|RCV001862441; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090588112103097nana-1-
NC_000005.10:g.(?_112754891)_(112775747_?)dup324APCUncertain significance-1RCV001032858|RCV001862454; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090588112111444nana-1-
NC_000005.9:g.(?_112090588)_(112179823_?)del324APCPathogenic-1RCV001385948; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090588112179823nana-1-
NC_000005.9:g.(?_112090588)_(112179823_?)dup324APCUncertain significance-1RCV001899670; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090588112179823nana-1-
NM_000038.6(APC):c.4G>A (p.Ala2Thr)324APCUncertain significancers569523442RCV001321032; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090591112090591GA112090591-
NM_000038.6(APC):c.6T>C (p.Ala2=)324APCLikely benign-1RCV001404403; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090593112090593TC112090593-
NM_000038.6(APC):c.10G>C (p.Ala4Pro)324APCUncertain significancers774219012RCV000466564|RCV000677758|RCV001017299|RCV001753908; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0002032,MedGen:C0699790|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN5172025112090597112090597GCNC_000005.9:g.112090597G>CClinGen:CA026700C0699790 114500 Carcinoma of colon;
NM_000038.6(APC):c.10G>T (p.Ala4Ser)324APCUncertain significancers774219012RCV000562185|RCV001042928; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090597112090597GT5:g.112090597G>TClinGen:CA16021356C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.14C>T (p.Ser5Leu)324APCUncertain significancers373718658RCV000229070|RCV000589294|RCV000775115; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN517202|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112090601112090601CTNC_000005.9:g.112090601C>TClinGen:CA028004C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.14C>A (p.Ser5Ter)324APCConflicting interpretations of pathogenicityrs373718658RCV000474392|RCV001011888; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112090601112090601CANC_000005.9:g.112090601C>AClinGen:CA16021363C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.14del (p.Ser5fs)324APCPathogenicrs1554067104RCV000646367; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090601112090601TCTNC_000005.9:g.112090601delClinGen:CA658796564C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.15A>G (p.Ser5=)324APCConflicting interpretations of pathogenicityrs1554067106RCV000561552|RCV001039653; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090602112090602AGNC_000005.9:g.112090602A>GClinGen:CA445752302C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.15A>C (p.Ser5=)324APCLikely benign-1RCV001458844; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090602112090602AC112090602-
NM_000038.6(APC):c.18T>C (p.Tyr6=)324APCLikely benignrs786202301RCV000165043|RCV000646687|RCV001435876; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090605112090605TC5:g.112090605T>CClinGen:CA006281C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.20A>G (p.Asp7Gly)324APCUncertain significancers1060503296RCV000471396; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090607112090607AGNC_000005.9:g.112090607A>GClinGen:CA16021377C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.23A>G (p.Gln8Arg)324APCUncertain significancers1754782964RCV001037599; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090610112090610AG5:g.112090610A>G-
NM_000038.6(APC):c.32dup (p.Gln12fs)324APCPathogenicrs1561444620RCV000772573|RCV000808751; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090616112090617TTANC_000005.9:g.112090619dup-
NM_000038.6(APC):c.35A>G (p.Gln12Arg)324APCUncertain significancers1754783765RCV001208336; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090622112090622AG5:g.112090622A>G-
NM_000038.6(APC):c.36A>G (p.Gln12=)324APCLikely benignrs864622288RCV000204299|RCV000433481|RCV000566559; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN169374|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112090623112090623AG5:g.112090623A>GClinGen:CA348545C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.42G>A (p.Glu14=)324APCLikely benignrs1554067113RCV000565251|RCV002060538; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090629112090629GANC_000005.9:g.112090629G>AClinGen:CA445752364C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.45A>C (p.Ala15=)324APCLikely benign-1RCV001406866; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090632112090632AC112090632-
NM_000038.6(APC):c.46C>T (p.Leu16=)324APCLikely benignrs1057520603RCV000428439|RCV000775897|RCV001423153; NMedGen:CN169374|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090633112090633CT5:g.112090633C>TClinGen:CA16604756CN169374 not specified;
NM_000038.6(APC):c.46C>G (p.Leu16Val)324APCUncertain significance-1RCV001948724; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090633112090633CG112090633-
NM_000038.6(APC):c.47T>C (p.Leu16Pro)324APCUncertain significancers1581121721RCV000806064; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090634112090634TC5:g.112090634T>C-
NM_000038.6(APC):c.48G>A (p.Leu16=)324APCLikely benign-1RCV001501998; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090635112090635GA112090635-
NM_000038.6(APC):c.52A>G (p.Met18Val)324APCUncertain significancers587782402RCV000131435|RCV000502641|RCV001350823; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0002032,MedGen:C0699790|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090639112090639AG5:g.112090639A>GClinGen:CA010033C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.53T>A (p.Met18Lys)324APCUncertain significancers200960071RCV000034418|RCV000130887|RCV000701375; NMedGen:CN517202|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090640112090640TA5:g.112090640T>AClinGen:CA010386C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.54G>A (p.Met18Ile)324APCUncertain significancers772873692RCV000465022|RCV000581033; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112090641112090641GANC_000005.9:g.112090641G>AClinGen:CA042134C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.55G>T (p.Glu19Ter)324APCPathogenicrs1754786861RCV001245830; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090642112090642GT5:g.112090642G>T-
NM_000038.6(APC):c.56A>C (p.Glu19Ala)324APCUncertain significancers1754787233RCV001060545; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090643112090643AC5:g.112090643A>C-
NM_000038.6(APC):c.57G>C (p.Glu19Asp)324APCUncertain significancers1754787495RCV001065510; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090644112090644GC5:g.112090644G>C-
NM_000038.6(APC):c.57G>T (p.Glu19Asp)324APCUncertain significancers1754787495RCV001235616; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090644112090644GT5:g.112090644G>T-
NM_000038.6(APC):c.59A>C (p.Asn20Thr)324APCUncertain significance-1RCV001997526; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090646112090646AC112090646-
NM_000038.6(APC):c.60C>T (p.Asn20=)324APCLikely benignrs780155240RCV000166303|RCV000197299|RCV001697159|RCV001844061; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN517202|MedGen:CN1693745112090647112090647CT5:g.112090647C>TClinGen:CA010920C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.62C>G (p.Ser21Ter)324APCPathogenic-1RCV001889840; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090649112090649CG112090649-
NM_000038.6(APC):c.64A>G (p.Asn22Asp)324APCUncertain significancers1415062077RCV000562861|RCV000758737|RCV001211866; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090651112090651AGNC_000005.9:g.112090651A>GClinGen:CA16021480C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.64A>C (p.Asn22His)324APCUncertain significancers1415062077RCV001039985; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090651112090651AC5:g.112090651A>C-
NM_000038.6(APC):c.67C>G (p.Leu23Val)324APCUncertain significancers372367350RCV000575621|RCV000646454|RCV001797110; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN5172025112090654112090654CGNC_000005.9:g.112090654C>GClinGen:CA046202C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.70C>T (p.Arg24Ter)324APCPathogenic/Likely pathogenicrs145945630RCV000164002|RCV000227124|RCV000482864|RCV000508297|RCV000763534|RCV000844605|RCV001353710; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN517202|MedGen:CN169374|Human Phenotype Ontology:HP:0006753,MONDO:MONDO:0021085,MedGen:C0038356; MedGen:C1851124,OMIM:135290, Orphanet5112090657112090657CTNC_000005.9:g.112090657C>TClinGen:CA012843CN240755 Familial adenomatous polyposis;
NM_000038.6(APC):c.71G>A (p.Arg24Gln)324APCUncertain significancers878853469RCV000230342|RCV001854825; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090658112090658GANC_000005.9:g.112090658G>AClinGen:CA10582272C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.71G>T (p.Arg24Leu)324APCUncertain significancers878853469RCV000707464|RCV001026152; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112090658112090658GTNC_000005.9:g.112090658G>T-C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.74_75del (p.Gln25fs)324APCPathogenicrs1554067124RCV000536195|RCV000657188; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN5172025112090661112090662CAACNC_000005.9:g.112090661_112090662delClinGen:CA658657468C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.74A>C (p.Gln25Pro)324APCUncertain significance-1RCV002031453; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090661112090661AC112090661-
NM_000038.6(APC):c.75A>G (p.Gln25=)324APCLikely benignrs876659361RCV000222595|RCV000233328|RCV000433787; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN1693745112090662112090662AG5:g.112090662A>GClinGen:CA10578282C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.76G>C (p.Glu26Gln)324APCUncertain significancers1554067127RCV000566833|RCV001039073; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090663112090663GC5:g.112090663G>CClinGen:CA16021503C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.78G>A (p.Glu26=)324APCLikely benignrs1561444861RCV000773727|RCV000921715|RCV001488910; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090665112090665GANC_000005.9:g.112090665G>A-
NM_000038.6(APC):c.79C>T (p.Leu27=)324APCLikely benignrs786202128RCV000164787|RCV002053969; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090666112090666CT5:g.112090666C>TClinGen:CA014234C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.81A>C (p.Leu27=)324APCLikely benignrs759312196RCV001186757|RCV001499003; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090668112090668AC5:g.112090668A>C-
NM_000038.6(APC):c.81A>G (p.Leu27=)324APCLikely benignrs759312196RCV001187111|RCV002068459; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090668112090668AG5:g.112090668A>G-
NM_000038.6(APC):c.82G>A (p.Glu28Lys)324APCUncertain significancers1754792844RCV001340165; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090669112090669GA112090669-
NM_000038.6(APC):c.83A>G (p.Glu28Gly)324APCUncertain significancers1754793089RCV001059335; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090670112090670AG5:g.112090670A>G-
NM_000038.6(APC):c.84A>G (p.Glu28=)324APCLikely benignrs1581121956RCV000944825|RCV001437301; NMedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090671112090671AG5:g.112090671A>G-
NM_000038.6(APC):c.85G>T (p.Asp29Tyr)324APCUncertain significancers1195191600RCV001071255; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090672112090672GT5:g.112090672G>T-
NM_000038.6(APC):c.86A>T (p.Asp29Val)324APCUncertain significancers1754793886RCV001046575; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090673112090673AT5:g.112090673A>T-
NM_000038.6(APC):c.86A>C (p.Asp29Ala)324APCUncertain significancers1754793886RCV001215830; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090673112090673AC5:g.112090673A>C-
NM_000038.6(APC):c.86A>G (p.Asp29Gly)324APCUncertain significancers1754793886RCV001294673; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090673112090673AG112090673-
NM_000038.6(APC):c.87T>G (p.Asp29Glu)324APCUncertain significancers1561444926RCV000693074; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090674112090674TG5:g.112090674T>G-C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.88A>G (p.Asn30Asp)324APCUncertain significancers1754795045RCV001053884; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090675112090675AG5:g.112090675A>G-
NM_000038.6(APC):c.94A>G (p.Asn32Asp)324APCUncertain significancers587781972RCV000130360|RCV000474411; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090681112090681AG5:g.112090681A>GClinGen:CA016000C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.94A>T (p.Asn32Tyr)324APCUncertain significancers587781972RCV000562593|RCV001213289; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090681112090681AT5:g.112090681A>TClinGen:CA16021546C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.95A>G (p.Asn32Ser)324APCConflicting interpretations of pathogenicityrs539108537RCV000202147|RCV000204603|RCV000569857|RCV000677775|RCV000656743|RCV001762426; NMedGen:CN169374|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|Human Phenotype Ontology:HP:0006753,MONDO:MONDO:0021085,MedGen:C0038356|MedGen:CN517202|MONDO:MONDO:0005575,MedGen:C0346629,5112090682112090682AG5:g.112090682A>GClinGen:CA051346C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.95A>T (p.Asn32Ile)324APCUncertain significancers539108537RCV001343537; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090682112090682AT112090682-
NM_000038.6(APC):c.102T>C (p.Leu34=)324APCLikely benignrs1581122045RCV000941456|RCV001438173; NMedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090689112090689TC5:g.112090689T>C-
NM_000038.6(APC):c.104C>A (p.Thr35Lys)324APCUncertain significancers1581122062RCV000817688; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090691112090691CA5:g.112090691C>A-
NM_000038.6(APC):c.108del (p.Lys36fs)324APCPathogenicrs1554067141RCV000646412; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090692112090692CAC5:g.112090692_112090692delClinGen:CA658796565C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.105A>C (p.Thr35=)324APCLikely benignrs1581122087RCV000977323|RCV001491498; NMedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090692112090692AC5:g.112090692A>C-
NM_000038.6(APC):c.111G>T (p.Leu37=)324APCLikely benignrs1554067149RCV000977864|RCV001395008; NMedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090698112090698GT5:g.112090698G>T-
NM_000038.6(APC):c.113A>C (p.Glu38Ala)324APCUncertain significancers1754800670RCV001216196; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090700112090700AC5:g.112090700A>C-
NM_000038.6(APC):c.115A>G (p.Thr39Ala)324APCUncertain significancers1581122131RCV000817243; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090702112090702AG5:g.112090702A>G-
NM_000038.6(APC):c.116C>G (p.Thr39Ser)324APCUncertain significancers1561445008RCV000776690|RCV001345805; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090703112090703CGNC_000005.9:g.112090703C>G-
NM_000038.6(APC):c.116C>A (p.Thr39Asn)324APCUncertain significance-1RCV002040303; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090703112090703CA112090703-
NM_000038.6(APC):c.119A>G (p.Glu40Gly)324APCUncertain significance-1RCV001899933; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090706112090706AG112090706-
NM_000038.6(APC):c.120G>A (p.Glu40=)324APCBenign/Likely benignrs142720069RCV000123674|RCV000201994|RCV000340295|RCV000589882|RCV001082954; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN169374|MedGen:CN239210|MedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090707112090707GANC_000005.9:g.112090707G>AClinGen:CA004090CN239210 APC-Associated Polyposis Disorders;
NM_000038.6(APC):c.121G>A (p.Ala41Thr)324APCUncertain significancers1554067157RCV000583824|RCV000689611; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090708112090708GA5:g.112090708G>AClinGen:CA16021606C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.121G>T (p.Ala41Ser)324APCUncertain significancers1554067157RCV000809176; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090708112090708GT5:g.112090708G>T-
NM_000038.6(APC):c.123A>G (p.Ala41=)324APCLikely benignrs1561445056RCV000777406|RCV000978212; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090710112090710AGNC_000005.9:g.112090710A>G-
NM_000038.6(APC):c.124T>G (p.Ser42Ala)324APCUncertain significancers1754803343RCV001068849|RCV001806012; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112090711112090711TG5:g.112090711T>G-
NM_000038.6(APC):c.125C>A (p.Ser42Tyr)324APCUncertain significancers781207121RCV001318051; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090712112090712CA112090712-
NM_000038.6(APC):c.130A>G (p.Met44Val)324APCUncertain significancers1424437002RCV001063169; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090717112090717AG5:g.112090717A>G-
NM_000038.6(APC):c.132dup (p.Lys45fs)324APCPathogenicrs1561445097RCV000703121; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090718112090719TTG5:g.112090718_112090719insG-C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.135G>A (p.Lys45=)324APCUncertain significancers1754804397RCV001064744; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090722112090722GA5:g.112090722G>A-
NM_000038.6(APC):c.135+1G>T324APCLikely pathogenicrs750508765RCV000570470|RCV000646409|RCV000758720; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN5172025112090723112090723GTNC_000005.9:g.112090723G>TClinGen:CA360617454C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.135+3A>T324APCUncertain significancers1754805091RCV001303519; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090725112090725AT112090725-
NM_000038.6(APC):c.135+7A>G324APCLikely benign-1RCV001464353; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090729112090729AG112090729-
NM_000038.6(APC):c.135+8G>C324APCConflicting interpretations of pathogenicityrs1554067166RCV000581428|RCV000646568; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090730112090730GCNC_000005.9:g.112090730G>CClinGen:CA658683397C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.135+12G>T324APCLikely benignrs1057524184RCV000440035|RCV000775921|RCV002063608; NMedGen:CN169374|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112090734112090734GT5:g.112090734G>TClinGen:CA16604641CN169374 not specified;
NM_000038.6(APC):c.136-20T>C324APCLikely benignrs1219730982RCV000581295|RCV002060556; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102003112102003TC5:g.112102003T>CClinGen:CA561903216C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.136-19A>G324APCLikely benignrs778690797RCV000583413|RCV002060555; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102004112102004AG5:g.112102004A>GClinGen:CA027282C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.136-18T>C324APCLikely benignrs1261769588RCV000583883|RCV002061963; NMedGen:CN169374|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102005112102005TC5:g.112102005T>CClinGen:CA561903217CN169374 not specified;
NM_000038.6(APC):c.136-16G>T324APCLikely benign-1RCV002152249; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102007112102007GT112102007-
NM_000038.6(APC):c.136-12T>C324APCLikely benignrs1554069478RCV000582406|RCV001637091|RCV002060554; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102011112102011TCNC_000005.9:g.112102011T>CClinGen:CA658683398C0027672 Hereditary cancer-predisposing syndrome;
NC_000005.10:g.(?_112766316)_(112844136_?)del324APCPathogenic-1RCV000801359; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102013112179833nana-
NC_000005.10:g.(?_112766316)_(112844136_?)dup324APCUncertain significance-1RCV001032267; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102013112179833nana-1-
NC_000005.9:g.(?_112102013)_(112179823_?)dup324APCUncertain significance-1RCV002018025; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102013112179823nana-1-
NC_000005.9:g.(?_112102013)_(112103097_?)del324APCPathogenic-1RCV001903135; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102013112103097nana-1-
NC_000005.9:g.(?_112102013)_(112179823_?)del324APCPathogenic-1RCV001964649; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102013112179823nana-1-
NM_000038.6(APC):c.136-7T>C324APCLikely benign-1RCV002095782; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102016112102016TC112102016-
NM_000038.6(APC):c.136-5A>G324APCConflicting interpretations of pathogenicityrs1581159924RCV000981511|RCV001011054; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112102018112102018AG5:g.112102018A>G-
NM_000038.6(APC):c.136-4A>G324APCUncertain significancers1297141781RCV001187846|RCV001296916; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102019112102019AG5:g.112102019A>G-
NM_000038.6(APC):c.136-3C>T324APCConflicting interpretations of pathogenicityrs1060503361RCV000466444|RCV001179769|RCV001577551; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN5172025112102020112102020CTNC_000005.9:g.112102020C>TClinGen:CA16611599C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.136-3C>A324APCUncertain significancers1060503361RCV001216758; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102020112102020CA5:g.112102020C>A-
NM_000038.6(APC):c.136-2A>G324APCPathogenic/Likely pathogenicrs886039625RCV000254746|RCV001064575; NMedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102021112102021AG5:g.112102021A>GClinGen:CA10588375CN517202 not provided;
NM_000038.6(APC):c.136-1G>A324APCLikely pathogenicrs1554069481RCV000574643|RCV000646364; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102022112102022GA5:g.112102022G>AClinGen:CA360617462C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.137_139del (p.Glu46del)324APCUncertain significance-1RCV001884763; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102023112102025GGAAG112102022-
NM_000038.6(APC):c.138A>C (p.Glu46Asp)324APCUncertain significancers1429803547RCV000823330; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102025112102025AC5:g.112102025A>C-
NM_000038.6(APC):c.138A>G (p.Glu46=)324APCConflicting interpretations of pathogenicityrs1429803547RCV001011330|RCV001862777; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102025112102025AG5:g.112102025A>G-
NM_000038.6(APC):c.139G>A (p.Val47Ile)324APCUncertain significancers969611536RCV000462825|RCV000775730; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112102026112102026GANC_000005.9:g.112102026G>AClinGen:CA16021649C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.147_150del (p.Lys49fs)324APCPathogenicrs587781694RCV000129859|RCV000502854|RCV000497263|RCV000552842|RCV001778749; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0002032,MedGen:C0699790|MedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0021055,MedGen:C0032580,OMIM:PS175100, Orphanet:7335112102032112102035TAAACT5:g.112102032_112102035delClinGen:CA005200CN240755 Familial adenomatous polyposis;
NM_000038.6(APC):c.146A>C (p.Lys49Thr)324APCUncertain significancers587781587RCV000563070|RCV000693872|RCV001260373; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN1693745112102033112102033ACNC_000005.9:g.112102033A>CClinGen:CA16021664C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.148_149del (p.Gln50fs)324APCPathogenic-1RCV001936572; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102034112102035AACA112102033-
NM_000038.6(APC):c.147A>G (p.Lys49=)324APCLikely benign-1RCV002162058; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102034112102034AG112102034-
NM_000038.6(APC):c.148C>G (p.Gln50Glu)324APCUncertain significance-1RCV001359485; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102035112102035CG112102035-
NM_000038.6(APC):c.148C>T (p.Gln50Ter)324APCPathogenic-1RCV001387446; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102035112102035CT112102035-
NM_000038.6(APC):c.150A>G (p.Gln50=)324APCLikely benign-1RCV002095466; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102037112102037AG112102037-
NM_000038.6(APC):c.151C>T (p.Leu51=)324APCLikely benignrs1554069497RCV000563260|RCV001455213; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102038112102038CT5:g.112102038C>TClinGen:CA445752982C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.151C>G (p.Leu51Val)324APCUncertain significancers1554069497RCV001233617; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102038112102038CG5:g.112102038C>G-
NM_000038.6(APC):c.152T>A (p.Leu51Gln)324APCUncertain significancers1756317618RCV001037451; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102039112102039TA5:g.112102039T>A-
NM_000038.6(APC):c.152T>C (p.Leu51Pro)324APCUncertain significance-1RCV002047433; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102039112102039TC112102039-
NM_000038.6(APC):c.153A>G (p.Leu51=)324APCLikely benignrs1554069500RCV000569850|RCV000978940; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102040112102040AGNC_000005.9:g.112102040A>GClinGen:CA445752984C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.156del (p.Gly53fs)324APCPathogenicrs1581160123RCV000810917|RCV001356443; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN5172025112102042112102042CAC5:g.112102042_112102042del-
NM_000038.6(APC):c.156A>C (p.Gln52His)324APCUncertain significance-1RCV001368150; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102043112102043AC112102043-
NM_000038.6(APC):c.156A>G (p.Gln52=)324APCUncertain significance-1RCV001894506; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102043112102043AG112102043-
NM_000038.6(APC):c.158G>T (p.Gly53Val)324APCUncertain significancers772787939RCV001041181; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102045112102045GT5:g.112102045G>T-
NM_000038.6(APC):c.161G>A (p.Ser54Asn)324APCUncertain significancers1756321078RCV001063732; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102048112102048GA5:g.112102048G>A-
NM_000038.6(APC):c.163A>G (p.Ile55Val)324APCUncertain significancers760158426RCV000564524|RCV000690193; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102050112102050AGNC_000005.9:g.112102050A>GClinGen:CA028920C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.163_164insG (p.Ile55fs)324APCPathogenicrs1554069524RCV000571383|RCV001060106; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102050112102051AAGNC_000005.9:g.112102050_112102051insGClinGen:CA658657469C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.164T>C (p.Ile55Thr)324APCUncertain significancers1554069530RCV000646419; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102051112102051TC5:g.112102051T>CClinGen:CA16021704C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.170_175del (p.Asp57_Glu58del)324APCUncertain significancers1167769425RCV000773868|RCV001856071; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102052112102057TTGAAGATNC_000005.9:g.112102057_112102062del-
NM_000038.6(APC):c.165T>A (p.Ile55=)324APCLikely benign-1RCV002203853; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102052112102052TA112102052-
NM_000038.6(APC):c.168A>G (p.Glu56=)324APCLikely benignrs1554069532RCV000568160|RCV002060444; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102055112102055AGNC_000005.9:g.112102055A>GClinGen:CA445752995C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.168A>C (p.Glu56Asp)324APCUncertain significance-1RCV001981738; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102055112102055AC112102055-
NM_000038.6(APC):c.170A>T (p.Asp57Val)324APCUncertain significancers794729227RCV000184048|RCV000232299; NMONDO:MONDO:0016419,MedGen:C0346153,OMIM:114480, Orphanet:227535|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102057112102057ATNC_000005.9:g.112102057A>TClinGen:CA005471C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.171T>C (p.Asp57=)324APCLikely benignrs770894012RCV000205156|RCV000443847|RCV000567696; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN169374|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112102058112102058TC5:g.112102058T>CClinGen:CA029139C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.172G>A (p.Glu58Lys)324APCUncertain significance-1RCV001891011; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102059112102059GA112102059-
NM_000038.6(APC):c.175G>A (p.Ala59Thr)324APCUncertain significancers1554069536RCV000573197|RCV001853820; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102062112102062GANC_000005.9:g.112102062G>AClinGen:CA16021729C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.176C>G (p.Ala59Gly)324APCUncertain significance-1RCV002027269; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102063112102063CG112102063-
NM_000038.6(APC):c.178A>G (p.Met60Val)324APCUncertain significancers1421856417RCV001187098|RCV001223712; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102065112102065AG5:g.112102065A>G-
NM_000038.6(APC):c.180G>A (p.Met60Ile)324APCUncertain significancers980662480RCV000646347; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102067112102067GANC_000005.9:g.112102067G>AClinGen:CA16021741C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.181G>A (p.Ala61Thr)324APCConflicting interpretations of pathogenicityrs786201989RCV000164557|RCV000646277|RCV001697165; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN5172025112102068112102068GA5:g.112102068G>AClinGen:CA006037C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.181G>C (p.Ala61Pro)324APCUncertain significancers786201989RCV001013304|RCV001299090; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102068112102068GC5:g.112102068G>C-
NM_000038.6(APC):c.181G>T (p.Ala61Ser)324APCUncertain significancers786201989RCV001201837; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102068112102068GT5:g.112102068G>T-
NM_000038.6(APC):c.184TCT[1] (p.Ser63del)324APCUncertain significancers876660575RCV000220184|RCV000646470|RCV001753679; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN5172025112102069112102071GCTTG5:g.112102069_112102071delClinGen:CA10578283C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.184T>C (p.Ser62Pro)324APCUncertain significance-1RCV001967395; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102071112102071TC112102071-
NM_000038.6(APC):c.191G>A (p.Gly64Glu)324APCUncertain significancers878853421RCV000229258|RCV001854806; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102078112102078GA5:g.112102078G>AClinGen:CA10582273C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.193C>A (p.Gln65Lys)324APCUncertain significancers863225320RCV000202251|RCV000587903|RCV001857742; NMedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102080112102080CANC_000005.9:g.112102080C>AClinGen:CA279799CN517202 not provided;
NM_000038.6(APC):c.194A>G (p.Gln65Arg)324APCUncertain significance-1RCV001993673; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102081112102081AG112102081-
NM_000038.6(APC):c.195G>C (p.Gln65His)324APCUncertain significancers1554069548RCV000590138|RCV001853964; NMedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102082112102082GCNC_000005.9:g.112102082G>CClinGen:CA16021768CN517202 not provided;
NM_000038.6(APC):c.195G>A (p.Gln65=)324APCLikely benign-1RCV001506948; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102082112102082GA112102082-
NM_000038.6(APC):c.196A>G (p.Ile66Val)324APCUncertain significancers764962781RCV001050298; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102083112102083AG5:g.112102083A>G-
NM_000038.6(APC):c.196del (p.Ile66fs)324APCPathogenic-1RCV002007386; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102083112102083GAG112102082-
NM_000038.6(APC):c.197T>C (p.Ile66Thr)324APCUncertain significancers1581160506RCV000797898|RCV001013942; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112102084112102084TC5:g.112102084T>C-
NM_000038.6(APC):c.200A>C (p.Asp67Ala)324APCUncertain significance-1RCV001882265; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102087112102087AC112102087-
NM_000038.6(APC):c.203del (p.Leu68fs)324APCPathogenicrs1756331894RCV001203172; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102088112102088ATA5:g.112102088_112102088del-
NM_000038.6(APC):c.202T>A (p.Leu68Ile)324APCUncertain significancers1756332227RCV001223915; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102089112102089TA5:g.112102089T>A-
NM_000038.6(APC):c.203T>G (p.Leu68Ter)324APCPathogenicrs1554069549RCV000501918|RCV001851394; NMONDO:MONDO:0002032,MedGen:C0699790|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102090112102090TGNC_000005.9:g.112102090T>GClinGen:CA16021788CN240755 Familial adenomatous polyposis;
NM_000038.6(APC):c.206T>C (p.Leu69Ser)324APCUncertain significance-1RCV001366798|RCV001776229; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN5172025112102093112102093TC112102093-
NM_000038.6(APC):c.206T>A (p.Leu69Ter)324APCPathogenic-1RCV001946495; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102093112102093TA112102093-
NM_000038.6(APC):c.207A>G (p.Leu69=)324APCLikely benignrs1554069552RCV000646623; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102094112102094AG5:g.112102094A>GClinGen:CA445753043C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.209A>G (p.Glu70Gly)324APCUncertain significancers863224539RCV000197071; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102096112102096AGNC_000005.9:g.112102096A>GClinGen:CA336960C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.210G>A (p.Glu70=)324APCLikely benignrs761957941RCV000881851|RCV001014463|RCV001454184; NMedGen:CN517202|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102097112102097GA5:g.112102097G>A-
NM_000038.6(APC):c.211C>A (p.Arg71Ser)324APCUncertain significancers767741687RCV000467870|RCV000569830|RCV000759423|RCV000779735; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MedGen:CN1693745112102098112102098CANC_000005.9:g.112102098C>AClinGen:CA030831C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.211C>T (p.Arg71Cys)324APCUncertain significancers767741687RCV000588634|RCV000823066; NMedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102098112102098CTNC_000005.9:g.112102098C>TClinGen:CA16021805CN517202 not provided;
NM_000038.6(APC):c.212G>A (p.Arg71His)324APCUncertain significancers750503329RCV000474741|RCV000479660|RCV000571928|RCV001192982; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN517202|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN1693745112102099112102099GANC_000005.9:g.112102099G>AClinGen:CA030877C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.212G>T (p.Arg71Leu)324APCUncertain significance-1RCV002000780; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102099112102099GT112102099-
NM_000038.6(APC):c.216T>C (p.Leu72=)324APCLikely benignrs1580324752RCV000871827|RCV001014635; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112102103112102103TC5:g.112102103T>C-
NM_000038.6(APC):c.219del (p.Glu74fs)324APCPathogenicrs1756336297RCV001246797|RCV001800975; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN5172025112102104112102104TAT5:g.112102104_112102104del-
NM_000038.6(APC):c.217A>G (p.Lys73Glu)324APCUncertain significance-1RCV001937306; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102104112102104AG112102104-
NM_000038.6(APC):c.219A>G (p.Lys73=)324APCUncertain significance-1RCV001759213|RCV001868711; NMedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102106112102106AG112102106-
NM_000038.6(APC):c.220G>T (p.Glu74Ter)324APCPathogenic/Likely pathogenicrs876658941RCV000215333|RCV000254875|RCV000459175|RCV000501460; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0002032,MedGen:C06997905112102107112102107GT5:g.112102107G>TClinGen:CA10578284CN240755 Familial adenomatous polyposis;
NM_000038.6(APC):c.220G>C (p.Glu74Gln)324APCUncertain significancers876658941RCV000555556|RCV001290660; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN1693745112102107112102107GC5:g.112102107G>CClinGen:CA16021823C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.220G>A (p.Glu74Lys)324APCUncertain significancers876658941RCV000568191|RCV001858222; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102107112102107GA5:g.112102107G>AClinGen:CA16021822C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.220+1G>A324APCPathogenicrs1554069570RCV000499663; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102108112102108GANC_000005.9:g.112102108G>AClinGen:CA360617465CN240755 Familial adenomatous polyposis;
NM_000038.6(APC):c.220+2T>A324APCPathogenic/Likely pathogenicrs587781809RCV000130080|RCV000202191|RCV000231290|RCV000503701; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0002032,MedGen:C06997905112102109112102109TA5:g.112102109T>AClinGen:CA007244CN240755 Familial adenomatous polyposis;
NM_000038.6(APC):c.220+4G>A324APCConflicting interpretations of pathogenicityrs973491846RCV000582451|RCV000806431; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102111112102111GANC_000005.9:g.112102111G>AClinGen:CA124975086C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.220+5A>G324APCUncertain significancers1554069584RCV000540822; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102112112102112AGNC_000005.9:g.112102112A>GClinGen:CA658657471C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.220+5A>T324APCUncertain significance-1RCV002007069; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102112112102112AT112102112-
NM_000038.6(APC):c.220+6T>C324APCUncertain significancers1756339861RCV001346766; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102113112102113TC112102113-
NM_000038.6(APC):c.220+12_220+14del324APCLikely benignrs864622493RCV000206367|RCV001503643; NMedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102117112102119TAAATNC_000005.9:g.112102119_112102121delClinGen:CA350411C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.220+13A>T324APCLikely benign-1RCV002162897; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102120112102120AT112102120-
NM_000038.6(APC):c.220+16G>T324APCLikely benignrs756214797RCV000776385|RCV002067328; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102123112102123GTNC_000005.9:g.112102123G>T-
NM_000038.6(APC):c.220+16G>C324APCLikely benign-1RCV002151073; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102123112102123GC112102123-
NM_000038.6(APC):c.220+18G>A324APCConflicting interpretations of pathogenicityrs927125994RCV001178648|RCV002067892; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102125112102125GA5:g.112102125G>A-
NM_000038.6(APC):c.220+19T>C324APCLikely benignrs754354718RCV000583115|RCV002060565; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102126112102126TC5:g.112102126T>CClinGen:CA031007C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.221-16T>C324APCLikely benignrs1046591128RCV000410932|RCV001183272; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112102870112102870TCNC_000005.9:g.112102870T>CClinGen:CA16042083C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.221-11A>G324APCLikely benignrs531060253RCV000775116|RCV001720139|RCV002062485; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102875112102875AG5:g.112102875A>GClinGen:CA16604757CN169374 not specified;
NM_000038.6(APC):c.221-11A>T324APCLikely benignrs531060253RCV000583455|RCV002060566; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102875112102875AT5:g.112102875A>TClinGen:CA124975587C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.221-5T>C324APCConflicting interpretations of pathogenicityrs1057524155RCV000438575|RCV000588735|RCV001078711|RCV001805053; NMedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112102881112102881TC5:g.112102881T>CClinGen:CA16604759CN517202 not provided;
NM_000038.6(APC):c.221-5T>G324APCUncertain significancers1057524155RCV000529587; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102881112102881TG5:g.112102881T>GClinGen:CA658657472C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.221-2A>G324APCPathogenic/Likely pathogenicrs786201291RCV000163246|RCV000476651|RCV000480238; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN5172025112102884112102884AG5:g.112102884A>GClinGen:CA007277C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.221-2A>T324APCLikely pathogenic-1RCV002027646; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102884112102884AT112102884-
NM_000038.6(APC):c.221-1G>A324APCLikely pathogenicrs863225327RCV000201979|RCV000491712|RCV001237158; NMedGen:CN517202|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102885112102885GANC_000005.9:g.112102885G>AClinGen:CA279668C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.221-1G>C324APCPathogenic/Likely pathogenicrs863225327RCV000213314|RCV000468960; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102885112102885GC5:g.112102885G>CClinGen:CA10578285C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.221A>C (p.Glu74Ala)324APCConflicting interpretations of pathogenicityrs773347338RCV000484103|RCV000776474|RCV001079472; NMedGen:CN517202|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102886112102886AC5:g.112102886A>CClinGen:CA031365C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.222G>C (p.Glu74Asp)324APCUncertain significancers1561463688RCV000701528; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102887112102887GC5:g.112102887G>C-C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.222G>T (p.Glu74Asp)324APCUncertain significance-1RCV001968365; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102887112102887GT112102887-
NM_000038.6(APC):c.223C>T (p.Leu75Phe)324APCUncertain significancers760790156RCV000772849|RCV001856031; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102888112102888CTNC_000005.9:g.112102888C>T-
NM_000038.6(APC):c.223C>G (p.Leu75Val)324APCUncertain significancers760790156RCV000798088; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102888112102888CG5:g.112102888C>G-
NM_000038.6(APC):c.224T>C (p.Leu75Pro)324APCUncertain significancers995081817RCV000532341|RCV001014931; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112102889112102889TCNC_000005.9:g.112102889T>CClinGen:CA16021831C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.226A>C (p.Asn76His)324APCUncertain significancers1756428709RCV001207321; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102891112102891AC5:g.112102891A>C-
NM_000038.6(APC):c.228C>T (p.Asn76=)324APCLikely benignrs766325173RCV000198292|RCV000571232|RCV001705142|RCV001824678; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MedGen:CN1693745112102893112102893CTNC_000005.9:g.112102893C>TClinGen:CA031634C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.229T>G (p.Leu77Val)324APCUncertain significancers1756429303RCV001345588; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102894112102894TG112102894-
NM_000038.6(APC):c.233_236del (p.Asp78fs)324APCPathogenicrs1064793020RCV000481173|RCV000492026|RCV000535814|RCV001778973; NMedGen:CN517202|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0021055,MedGen:C0032580,OMIM:PS175100, Orphanet:7335112102895112102898TTAGATNC_000005.9:g.112102898_112102901delClinGen:CA16618066C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.230T>A (p.Leu77Ter)324APCPathogenic-1RCV001358256; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102895112102895TA112102895-
NM_000038.6(APC):c.231A>G (p.Leu77=)324APCLikely benign-1RCV001403077; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102896112102896AG112102896-
NM_000038.6(APC):c.232G>A (p.Asp78Asn)324APCUncertain significancers1253209514RCV001015210|RCV001224283; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102897112102897GA5:g.112102897G>A-
NM_000038.6(APC):c.233A>C (p.Asp78Ala)324APCUncertain significancers562833260RCV000573725|RCV000646512; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102898112102898AC5:g.112102898A>CClinGen:CA031709C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.235A>G (p.Ser79Gly)324APCUncertain significancers1001856924RCV000773537|RCV001223504; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102900112102900AGNC_000005.9:g.112102900A>G-
NM_000038.6(APC):c.235A>C (p.Ser79Arg)324APCUncertain significance-1RCV002046640; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102900112102900AC112102900-
NM_000038.6(APC):c.236G>A (p.Ser79Asn)324APCUncertain significancers1554069689RCV000646481; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102901112102901GA5:g.112102901G>AClinGen:CA16021858C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.239G>C (p.Ser80Thr)324APCUncertain significancers876659390RCV000222538|RCV001294854; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102904112102904GC5:g.112102904G>CClinGen:CA10578286C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.239G>A (p.Ser80Asn)324APCUncertain significancers876659390RCV000807142; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102904112102904GA5:g.112102904G>A-
NM_000038.6(APC):c.244T>A (p.Phe82Ile)324APCUncertain significancers863225329RCV000201969|RCV001853249; NMedGen:CN169374|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102909112102909TANC_000005.9:g.112102909T>AClinGen:CA279662CN169374 not specified;
NM_000038.6(APC):c.244T>C (p.Phe82Leu)324APCUncertain significancers863225329RCV001323108; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102909112102909TC112102909-
NM_000038.6(APC):c.245T>C (p.Phe82Ser)324APCUncertain significancers1179254201RCV000569708|RCV000700319|RCV001293968; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:C1851124,OMIM:135290, Orphanet:8735112102910112102910TC5:g.112102910T>CClinGen:CA16021881C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.246C>T (p.Phe82=)324APCLikely benign-1RCV002078374; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102911112102911CT112102911-
NM_000038.6(APC):c.248C>T (p.Pro83Leu)324APCUncertain significancers1163661746RCV001044495; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102913112102913CT5:g.112102913C>T-
NM_000038.6(APC):c.248C>G (p.Pro83Arg)324APCUncertain significance-1RCV001989256; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102913112102913CG112102913-
NM_000038.6(APC):c.249del (p.Gly84fs)324APCPathogenicrs878853428RCV000232213|RCV000657492; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN5172025112102914112102914CTCNC_000005.9:g.112102914delClinGen:CA10582274C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.249T>G (p.Pro83=)324APCLikely benign-1RCV002217592; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102914112102914TG112102914-
NM_000038.6(APC):c.250G>C (p.Gly84Arg)324APCUncertain significance-1RCV001974318; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102915112102915GC112102915-
NM_000038.6(APC):c.251G>T (p.Gly84Val)324APCUncertain significancers143145868RCV000220182|RCV000823918; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102916112102916GTNC_000005.9:g.112102916G>TClinGen:CA032367C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.252A>G (p.Gly84=)324APCLikely benignrs375051600RCV001015846|RCV002068921; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102917112102917AG5:g.112102917A>G-
NM_000038.6(APC):c.254del (p.Val85fs)324APCPathogenic-1RCV001949573; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102919112102919GTG112102918-
NM_000038.6(APC):c.259C>T (p.Leu87=)324APCBenign/Likely benignrs569640184RCV000122765|RCV000163523|RCV001079418; NMedGen:CN517202|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102924112102924CTNC_000005.9:g.112102924C>TClinGen:CA007647C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.260T>C (p.Leu87Pro)324APCUncertain significancers777456713RCV000558893; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102925112102925TC5:g.112102925T>CClinGen:CA16021913C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.260T>G (p.Leu87Arg)324APCUncertain significancers777456713RCV001045894; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102925112102925TG5:g.112102925T>G-
NM_000038.6(APC):c.262C>T (p.Arg88Trp)324APCUncertain significancers746592911RCV000484135|RCV000574492|RCV000646444|RCV000766533; NMONDO:MONDO:0002032,MedGen:C0699790|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN5172025112102927112102927CT5:g.112102927C>TClinGen:CA032840C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.263G>A (p.Arg88Gln)324APCUncertain significancers587780592RCV000122766|RCV000413883|RCV000566722; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN517202|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112102928112102928GANC_000005.9:g.112102928G>AClinGen:CA007680C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.263G>T (p.Arg88Leu)324APCUncertain significancers587780592RCV001016167|RCV001057069; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102928112102928GT5:g.112102928G>T-
NM_000038.6(APC):c.264G>A (p.Arg88=)324APCLikely benignrs1554069706RCV000646591|RCV001016208; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112102929112102929GA5:g.112102929G>AClinGen:CA445753164C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.266C>G (p.Ser89Ter)324APCPathogenicrs876658846RCV000221332|RCV000767384; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102931112102931CG5:g.112102931C>GClinGen:CA10578287C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.266C>A (p.Ser89Ter)324APCPathogenicrs876658846RCV000686347|RCV001016260; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112102931112102931CA5:g.112102931C>A-C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.280_281insTGGAGGAAATTGGACACCATCATTCTCAGTAAACTATCGCACGAACAAAAAACCAAACACCGCATCGTCTC324APCPathogenic-1RCV001951264; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102931112102932CCAAAAATGTCCCTCCTGGAGGAAATTGGACACCATCATTCTCAGTAAACTATCGCACGAACAAAAAACCAAACACCGCATCGTCTCAGTCNNNNNNNNNNAAAAAAAAAA112102931-
NM_000038.6(APC):c.268A>G (p.Lys90Glu)324APCUncertain significancers763184444RCV000201975|RCV000528829|RCV000580141|RCV001550070; NMedGen:CN169374|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN5172025112102933112102933AGNC_000005.9:g.112102933A>GClinGen:CA033035C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.272T>C (p.Met91Thr)324APCUncertain significance-1RCV001888347; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102937112102937TC112102937-
NM_000038.6(APC):c.273G>A (p.Met91Ile)324APCUncertain significancers745394881RCV000775117|RCV000819063; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102938112102938GANC_000005.9:g.112102938G>A-
NM_000038.6(APC):c.274T>G (p.Ser92Ala)324APCUncertain significancers1554069716RCV000646366|RCV001016496; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112102939112102939TGNC_000005.9:g.112102939T>GClinGen:CA16021939C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.275C>G (p.Ser92Cys)324APCUncertain significancers769708176RCV000685926|RCV001016520; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112102940112102940CG5:g.112102940C>G-C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.276C>T (p.Ser92=)324APCLikely benignrs369238363RCV000200217|RCV000569741|RCV001532995; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN1693745112102941112102941CTNC_000005.9:g.112102941C>TClinGen:CA033380C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.276C>G (p.Ser92=)324APCLikely benign-1RCV001453240; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102941112102941CG112102941-
NM_000038.6(APC):c.277C>G (p.Leu93Val)324APCConflicting interpretations of pathogenicityrs201567345RCV000233150|RCV000491761|RCV000657055|RCV001818550; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MedGen:CN1693745112102942112102942CGNC_000005.9:g.112102942C>GClinGen:CA033407C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.277C>T (p.Leu93Phe)324APCUncertain significancers201567345RCV001016583|RCV001067244; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102942112102942CT5:g.112102942C>T-
NM_000038.6(APC):c.278T>A (p.Leu93His)324APCUncertain significancers876658977RCV000217948|RCV000700668; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102943112102943TA5:g.112102943T>AClinGen:CA10578288C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.279C>T (p.Leu93=)324APCLikely benignrs768492450RCV000565354|RCV001483090; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102944112102944CT5:g.112102944C>TClinGen:CA445753227C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.280C>G (p.Arg94Gly)324APCUncertain significancers550945533RCV000221637|RCV000700669; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102945112102945CG5:g.112102945C>GClinGen:CA10578289C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.280C>A (p.Arg94Ser)324APCUncertain significancers550945533RCV000409081|RCV001016652|RCV001775785; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN5172025112102945112102945CANC_000005.9:g.112102945C>AClinGen:CA16021946C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.280C>T (p.Arg94Cys)324APCUncertain significancers550945533RCV000563719|RCV001364425; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102945112102945CT5:g.112102945C>TClinGen:CA16021947C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.281G>A (p.Arg94His)324APCUncertain significancers774229223RCV000581085|RCV000646341; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102946112102946GA5:g.112102946G>AClinGen:CA033585C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.281_282del (p.Arg94fs)324APCLikely pathogenicrs1561464190RCV000755038; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102946112102947CGTCNC_000005.9:g.112102946_112102947del-
NM_000038.6(APC):c.281G>C (p.Arg94Pro)324APCUncertain significance-1RCV002019142; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102946112102946GC112102946-
NM_000038.6(APC):c.282T>C (p.Arg94=)324APCLikely benignrs1485825595RCV000776852|RCV002061110; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102947112102947TCNC_000005.9:g.112102947T>C-
NM_000038.6(APC):c.284C>T (p.Ser95Phe)324APCUncertain significancers146221748RCV000574779|RCV000797167|RCV001764656; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN5172025112102949112102949CTNC_000005.9:g.112102949C>TClinGen:CA16021955C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.287A>G (p.Tyr96Cys)324APCUncertain significancers760770847RCV000580580|RCV001860022; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102952112102952AG5:g.112102952A>GClinGen:CA033841C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.287A>T (p.Tyr96Phe)324APCUncertain significancers760770847RCV000694205|RCV001016872; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112102952112102952AT5:g.112102952A>T-C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.288T>A (p.Tyr96Ter)324APCPathogenicrs376213437RCV000159585|RCV000540671|RCV001016886; NMedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112102953112102953TANC_000005.9:g.112102953T>AClinGen:CA007872CN240755 Familial adenomatous polyposis;
NM_000038.6(APC):c.288T>C (p.Tyr96=)324APCBenign/Likely benignrs376213437RCV000165334|RCV000205434|RCV000427257|RCV001704202; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN169374|MedGen:CN5172025112102953112102953TC5:g.112102953T>CClinGen:CA007882C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.288T>G (p.Tyr96Ter)324APCPathogenicrs376213437RCV000202141|RCV000491545|RCV000555518; NMedGen:CN517202|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102953112102953TGNC_000005.9:g.112102953T>GClinGen:CA248534C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.295C>T (p.Arg99Trp)324APCConflicting interpretations of pathogenicityrs139196838RCV000122769|RCV000129141|RCV000200967|RCV000210128|RCV000589216|RCV001353757|RCV001762272; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN169374|MedGen:C1858438|MedGen:CN517202|MONDO:MONDO:0002032,MedGen:C0699790|MONDO:MONDO:0005575,MedGen:C0346629,OMIM:1145005112102960112102960CTNC_000005.9:g.112102960C>TClinGen:CA007948,UniProtKB:P25054#VAR_009613C1858438 Colorectal cancer, susceptibility to;
NM_000038.6(APC):c.295C>A (p.Arg99=)324APCUncertain significancers139196838RCV000553655; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102960112102960CANC_000005.9:g.112102960C>AClinGen:CA445753285C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.296G>A (p.Arg99Gln)324APCUncertain significancers199842850RCV000197478|RCV000491566|RCV000585993; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN5172025112102961112102961GANC_000005.9:g.112102961G>AClinGen:CA007959C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.298del (p.Glu100fs)324APCPathogenic/Likely pathogenicrs1064794224RCV000486524|RCV000646505; NMedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102961112102961CGCNC_000005.9:g.112102963delClinGen:CA16618067C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.297G>T (p.Arg99=)324APCLikely benignrs765804855RCV000935972|RCV001187112|RCV001500145; NMedGen:CN517202|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102962112102962GT5:g.112102962G>T-
NM_000038.6(APC):c.298G>A (p.Glu100Lys)324APCUncertain significancers1561464319RCV000707121; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102963112102963GANC_000005.9:g.112102963G>A-C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.301_303dup (p.Gly101dup)324APCUncertain significance-1RCV001865028; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102964112102965AAAGG112102964-
NM_000038.6(APC):c.300A>G (p.Glu100=)324APCLikely benignrs1060504888RCV000473825; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102965112102965AGNC_000005.9:g.112102965A>GClinGen:CA16611637C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.301G>T (p.Gly101Ter)324APCPathogenicrs863225335RCV000202070|RCV000570097|RCV001853250; NMedGen:CN517202|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102966112102966GTNC_000005.9:g.112102966G>TClinGen:CA279710C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.302G>A (p.Gly101Glu)324APCUncertain significancers954713888RCV000708949; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102967112102967GANC_000005.9:g.112102967G>A-C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.302G>C (p.Gly101Ala)324APCUncertain significancers954713888RCV001018186|RCV001035615; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102967112102967GC5:g.112102967G>C-
NM_000038.6(APC):c.303A>G (p.Gly101=)324APCUncertain significancers1756452016RCV001203136; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102968112102968AG5:g.112102968A>G-
NM_000038.6(APC):c.304T>C (p.Ser102Pro)324APCUncertain significancers753302494RCV000561562|RCV001215583; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102969112102969TC5:g.112102969T>CClinGen:CA034347C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.305C>G (p.Ser102Cys)324APCUncertain significance-1RCV001883382; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102970112102970CG112102970-
NM_000038.6(APC):c.307G>C (p.Val103Leu)324APCUncertain significancers758995578RCV000469391; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102972112102972GCNC_000005.9:g.112102972G>CClinGen:CA16021996C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.307G>T (p.Val103Leu)324APCUncertain significancers758995578RCV000571583|RCV001867873; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102972112102972GT5:g.112102972G>TClinGen:CA16021997C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.309A>G (p.Val103=)324APCLikely benignrs863224279RCV000195995|RCV001018605|RCV001500054; NMedGen:CN517202|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102974112102974AG5:g.112102974A>GClinGen:CA336102C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.311C>G (p.Ser104Ter)324APCPathogenic/Likely pathogenicrs74953290RCV000213087|RCV000506152|RCV000519665|RCV001254064|RCV001853550; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102976112102976CG5:g.112102976C>GClinGen:CA10578290C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.311C>T (p.Ser104Leu)324APCUncertain significancers74953290RCV000691711; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102976112102976CT5:g.112102976C>T-C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.313A>G (p.Ser105Gly)324APCUncertain significancers776242276RCV000562645|RCV000646333; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102978112102978AG5:g.112102978A>GClinGen:CA16022006C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.314G>A (p.Ser105Asn)324APCUncertain significancers1580328726RCV000815337|RCV001796248; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN5172025112102979112102979GA5:g.112102979G>A-
NM_000038.6(APC):c.316C>T (p.Arg106Cys)324APCUncertain significancers1554069763RCV000555181|RCV001018945; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112102981112102981CTNC_000005.9:g.112102981C>TClinGen:CA16022015C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.317G>A (p.Arg106His)324APCUncertain significancers201764637RCV000034409|RCV000410470|RCV000455267|RCV000565565|RCV000659270; NMedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN169374|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021055,MedGen:C0032580,OMIM:PS175100, Orphanet:7335112102982112102982GA5:g.112102982G>AClinGen:CA008128CN240755 Familial adenomatous polyposis;
NM_000038.6(APC):c.317G>T (p.Arg106Leu)324APCUncertain significancers201764637RCV001019017|RCV001035384; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102982112102982GT5:g.112102982G>T-
NM_000038.6(APC):c.319T>G (p.Ser107Ala)324APCUncertain significancers1485866385RCV000821613|RCV001019146; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112102984112102984TGNC_000005.9:g.112102984T>G-
NM_000038.6(APC):c.320C>G (p.Ser107Cys)324APCUncertain significancers774416950RCV000777304|RCV001873166; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102985112102985CGNC_000005.9:g.112102985C>G-
NM_000038.6(APC):c.321T>C (p.Ser107=)324APCLikely benign-1RCV001484474; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102986112102986TC112102986-
NM_000038.6(APC):c.322G>T (p.Gly108Ter)324APCPathogenic-1RCV001930377; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102987112102987GT112102987-
NM_000038.6(APC):c.323G>A (p.Gly108Glu)324APCConflicting interpretations of pathogenicityrs1114167456RCV000491472|RCV000775971|RCV001051832; NMedGen:C1858438|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102988112102988GANC_000005.9:g.112102988G>AClinGen:CA16022027C1858438 Colorectal cancer, susceptibility to;
NM_000038.6(APC):c.326A>G (p.Glu109Gly)324APCUncertain significancers1756458773RCV001239077; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102991112102991AG5:g.112102991A>G-
NM_000038.6(APC):c.328T>C (p.Cys110Arg)324APCUncertain significancers751956779RCV000692270; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102993112102993TCNC_000005.9:g.112102993T>C-C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.330C>T (p.Cys110=)324APCLikely benignrs1060504887RCV000463523|RCV000568079; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112102995112102995CTNC_000005.9:g.112102995C>TClinGen:CA16611601C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.331A>G (p.Ser111Gly)324APCUncertain significancers1580328938RCV000987549|RCV001184638; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112102996112102996AG5:g.112102996A>G-
NM_000038.6(APC):c.332G>A (p.Ser111Asn)324APCUncertain significancers786202322RCV000165072|RCV000233865|RCV001582652; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN5172025112102997112102997GA5:g.112102997G>AClinGen:CA008281C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.334C>A (p.Pro112Thr)324APCUncertain significancers1392982680RCV000813105|RCV001805888; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112102999112102999CA5:g.112102999C>A-
NM_000038.6(APC):c.334C>T (p.Pro112Ser)324APCUncertain significancers1392982680RCV001338998; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112102999112102999CT112102999-
NM_000038.6(APC):c.335C>G (p.Pro112Arg)324APCUncertain significancers1060503357RCV000461562|RCV001020080|RCV001770356; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN5172025112103000112103000CGNC_000005.9:g.112103000C>GClinGen:CA16022055C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.338T>C (p.Val113Ala)324APCUncertain significancers863224542RCV000200174; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103003112103003TCNC_000005.9:g.112103003T>CClinGen:CA339132C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.340C>A (p.Pro114Thr)324APCUncertain significancers1580329044RCV001020227|RCV001860976; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103005112103005CA5:g.112103005C>A-
NM_000038.6(APC):c.340C>T (p.Pro114Ser)324APCUncertain significance-1RCV001916640; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103005112103005CT112103005-
NM_000038.6(APC):c.341C>G (p.Pro114Arg)324APCUncertain significancers200117298RCV001056165|RCV001796358; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN5172025112103006112103006CG5:g.112103006C>G-
NM_000038.6(APC):c.341C>T (p.Pro114Leu)324APCUncertain significancers200117298RCV001182823|RCV001344828; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103006112103006CT5:g.112103006C>T-
NM_000038.6(APC):c.343A>G (p.Met115Val)324APCUncertain significancers1060503276RCV000471223|RCV000566474|RCV000985295; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN5172025112103008112103008AG5:g.112103008A>GClinGen:CA16022069C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.344T>A (p.Met115Lys)324APCUncertain significancers1756462909RCV001341029; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103009112103009TA112103009-
NM_000038.6(APC):c.346G>C (p.Gly116Arg)324APCUncertain significancers142637152RCV001039243; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103011112103011GC5:g.112103011G>C-
NM_000038.6(APC):c.347G>A (p.Gly116Asp)324APCUncertain significancers369999291RCV000581664|RCV000646298; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103012112103012GANC_000005.9:g.112103012G>AClinGen:CA16022080C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.350C>A (p.Ser117Ter)324APCPathogenicrs1064793535RCV000482015|RCV000561431|RCV000646504|RCV001824795; NMedGen:CN517202|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0021055,MedGen:C0032580,OMIM:PS175100, Orphanet:7335112103015112103015CA5:g.112103015C>AClinGen:CA16022086C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.351A>C (p.Ser117=)324APCLikely benignrs1294902871RCV000982897|RCV001431511; NMedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103016112103016AC5:g.112103016A>C-
NM_000038.6(APC):c.353T>G (p.Phe118Cys)324APCUncertain significancers1756464913RCV001323140; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103018112103018TG112103018-
NM_000038.6(APC):c.356C>T (p.Pro119Leu)324APCUncertain significance-1RCV001979394; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103021112103021CT112103021-
NM_000038.6(APC):c.357A>G (p.Pro119=)324APCLikely benignrs1306334779RCV001020648|RCV001394163; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103022112103022AG5:g.112103022A>G-
NM_000038.6(APC):c.358A>G (p.Arg120Gly)324APCUncertain significancers876659470RCV000561323|RCV000679056|RCV001192979|RCV001304515; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MedGen:CN169374|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103023112103023AG5:g.112103023A>GClinGen:CA16022103C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.362G>T (p.Arg121Ile)324APCUncertain significancers193049694RCV000205797|RCV000570345; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112103027112103027GTNC_000005.9:g.112103027G>TClinGen:CA036020C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.362G>A (p.Arg121Lys)324APCUncertain significancers193049694RCV001065793|RCV001186320; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112103027112103027GA5:g.112103027G>A-
NM_000038.6(APC):c.362G>C (p.Arg121Thr)324APCUncertain significance-1RCV001366825; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103027112103027GC112103027-
NM_000038.6(APC):c.366del (p.Phe123fs)324APCPathogenicrs1580329260RCV000815470; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103029112103029AGA5:g.112103029_112103029del-
NM_000038.6(APC):c.364G>A (p.Gly122Arg)324APCUncertain significance-1RCV001887567; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103029112103029GA112103029-
NM_000038.6(APC):c.365G>T (p.Gly122Val)324APCUncertain significancers755660899RCV000575451|RCV000802382|RCV001815415; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN5172025112103030112103030GTNC_000005.9:g.112103030G>TClinGen:CA036174C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.365G>C (p.Gly122Ala)324APCUncertain significancers755660899RCV000803977|RCV001020823; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112103030112103030GC5:g.112103030G>C-
NM_000038.6(APC):c.367T>A (p.Phe123Ile)324APCUncertain significancers1756467769RCV001226859; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103032112103032TA5:g.112103032T>A-
NM_000038.6(APC):c.369_422+44delinsG324APCLikely pathogenic-1RCV002005193; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103034112103131TGTAAATGGAAGCAGAGAAAGTACTGGATATTTAGAAGAACTTGAGAAAGAGAGGTAACTTTTCTTCATATAGTAAACATTGCCTTGTGTACTCCAGTG112103034-
NM_000038.6(APC):c.370G>A (p.Val124Ile)324APCUncertain significancers779945112RCV000464404; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103035112103035GANC_000005.9:g.112103035G>AClinGen:CA16022128C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.370G>C (p.Val124Leu)324APCUncertain significance-1RCV002028242; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103035112103035GC112103035-
NM_000038.6(APC):c.372A>G (p.Val124=)324APCLikely benignrs749179034RCV000166670|RCV000555868|RCV000608108|RCV001800502; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN169374|MedGen:CN5172025112103037112103037AG5:g.112103037A>GClinGen:CA008642C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.374A>G (p.Asn125Ser)324APCUncertain significance-1RCV001366438; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103039112103039AG112103039-
NM_000038.6(APC):c.375T>C (p.Asn125=)324APCLikely benignrs768615558RCV001021070|RCV001420042; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103040112103040TC5:g.112103040T>C-
NM_000038.6(APC):c.381_406del (p.Ser127fs)324APCPathogenic-1RCV001913691; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103042112103067GGAAGCAGAGAAAGTACTGGATATTTAG112103041-
NM_000038.6(APC):c.378A>G (p.Gly126=)324APCLikely benign-1RCV002158496; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103043112103043AG112103043-
NM_000038.6(APC):c.379A>G (p.Ser127Gly)324APCUncertain significancers200089324RCV000034386|RCV000167102|RCV000410052; NMedGen:CN517202|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103044112103044AG5:g.112103044A>GClinGen:CA008675C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.380G>A (p.Ser127Asn)324APCUncertain significancers1414642619RCV000688983|RCV001021205; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112103045112103045GA5:g.112103045G>A-C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.383G>C (p.Arg128Thr)324APCUncertain significancers1756470431RCV001313625; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103048112103048GC112103048-
NM_000038.6(APC):c.384A>G (p.Arg128=)324APCConflicting interpretations of pathogenicityrs876659284RCV000213500|RCV000484255|RCV001454760; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103049112103049AG5:g.112103049A>GClinGen:CA10578292C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.385G>C (p.Glu129Gln)324APCConflicting interpretations of pathogenicityrs376628500RCV000120050|RCV000196705|RCV000216893|RCV000589545; NMedGen:CN169374|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN5172025112103050112103050GC5:g.112103050G>CClinGen:CA008713C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.388del (p.Ser130fs)324APCLikely pathogenicrs1554069828RCV000662861; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103051112103051GAG5:g.112103051_112103051del-C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.386A>G (p.Glu129Gly)324APCUncertain significancers759662717RCV000817746|RCV001191301; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112103051112103051AG5:g.112103051A>G-
NM_000038.6(APC):c.386A>T (p.Glu129Val)324APCUncertain significance-1RCV001969388; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103051112103051AT112103051-
NM_000038.6(APC):c.387A>G (p.Glu129=)324APCLikely benignrs1554069832RCV000573413|RCV000924570|RCV001453390; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103052112103052AG5:g.112103052A>GClinGen:CA445753410C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.387A>C (p.Glu129Asp)324APCUncertain significance-1RCV001937657; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103052112103052AC112103052-
NM_000038.6(APC):c.388A>G (p.Ser130Gly)324APCConflicting interpretations of pathogenicityrs150973053RCV000034387|RCV000122775|RCV000129715|RCV000211891|RCV000417265|RCV001155264|RCV001762081; NMedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN169374|MONDO:MONDO:0021055,MedGen:C0032580,OMIM:PS175100, Orphanet:733|MedGen:CN239210|MONDO:MONDO:0005575,MedGen:C05112103053112103053AG5:g.112103053A>GClinGen:CA008731CN240755 Familial adenomatous polyposis;
NM_000038.6(APC):c.392C>G (p.Thr131Ser)324APCUncertain significancers1387998721RCV000571547|RCV000646355; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103057112103057CG5:g.112103057C>GClinGen:CA16022176C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.392C>T (p.Thr131Ile)324APCUncertain significancers1387998721RCV001301535; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103057112103057CT112103057-
NM_000038.6(APC):c.393T>C (p.Thr131=)324APCLikely benignrs775742850RCV000163863|RCV000548080; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103058112103058TC5:g.112103058T>CClinGen:CA008809C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.394G>A (p.Gly132Arg)324APCUncertain significancers1580329638RCV001021500|RCV001050218; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103059112103059GA5:g.112103059G>A-
NM_000038.6(APC):c.396A>C (p.Gly132=)324APCLikely benignrs1060504884RCV000475145|RCV001402755; NMedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103061112103061ACNC_000005.9:g.112103061A>CClinGen:CA16611554C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.397T>G (p.Tyr133Asp)324APCUncertain significancers763487503RCV000415652; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103062112103062TG5:g.112103062T>GClinGen:CA037250C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.398A>G (p.Tyr133Cys)324APCUncertain significancers1561465075RCV000774003|RCV001856075; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103063112103063AGNC_000005.9:g.112103063A>G-
NM_000038.6(APC):c.403GAA[1] (p.Glu136del)324APCUncertain significance-1RCV001976118; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103067112103069TAGAT112103066-
NM_000038.6(APC):c.403_404insTT (p.Glu135fs)324APCPathogenicrs1756475997RCV001244359; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103068112103069GGTT5:g.112103068_112103069insTT-
NM_000038.6(APC):c.405A>G (p.Glu135=)324APCLikely benignrs1554069842RCV000524997; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103070112103070AGNC_000005.9:g.112103070A>GClinGen:CA445753429C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.410T>G (p.Leu137Arg)324APCUncertain significancers1756476556RCV001234899; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103075112103075TG5:g.112103075T>G-
NM_000038.6(APC):c.413A>C (p.Glu138Ala)324APCUncertain significance-1RCV001933097; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103078112103078AC112103078-
NM_000038.6(APC):c.414G>A (p.Glu138=)324APCLikely benignrs1554069845RCV000563602|RCV000933345|RCV001466729; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103079112103079GA5:g.112103079G>AClinGen:CA445753437C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.421_422del (p.Arg141fs)324APCPathogenicrs1554069850RCV000534073|RCV000657261|RCV001022064; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN517202|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112103082112103083AAGANC_000005.9:g.112103082AG[2]ClinGen:CA645546024C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.417A>G (p.Lys139=)324APCLikely benignrs1554069848RCV000561844|RCV000875392|RCV001392168|RCV001420741; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN1693745112103082112103082AG5:g.112103082A>GClinGen:CA445753442C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.419A>C (p.Glu140Ala)324APCUncertain significance-1RCV001367542; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103084112103084AC112103084-
NM_000038.6(APC):c.420G>C (p.Glu140Asp)324APCUncertain significancers202161017RCV000034414|RCV000409727|RCV000579781; NMedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112103085112103085GC5:g.112103085G>CClinGen:CA008951C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.421A>C (p.Arg141=)324APCUncertain significancers1561465195RCV000798848|RCV001177511; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112103086112103086AC5:g.112103086A>C-
NM_000038.6(APC):c.421A>G (p.Arg141Gly)324APCUncertain significancers1561465195RCV001068104; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103086112103086AG5:g.112103086A>G-
NM_000038.6(APC):c.422G>C (p.Arg141Thr)324APCUncertain significance-1RCV001365090; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103087112103087GC112103087-
NM_000038.6(APC):c.422+1G>C324APCLikely pathogenic-1RCV001378009; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103088112103088GC112103088-
NM_000038.6(APC):c.422+2T>C324APCLikely pathogenicrs879254169RCV000235994|RCV000411017; NMedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103089112103089TCNC_000005.9:g.112103089T>CClinGen:CA10584235C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.422+2T>G324APCLikely pathogenicrs879254169RCV000494112|RCV000812496; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103089112103089TGNC_000005.9:g.112103089T>GClinGen:CA360617477C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.422+3A>G324APCUncertain significancers1561465237RCV000773149|RCV001348775; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103090112103090AGNC_000005.9:g.112103090A>G-
NM_000038.6(APC):c.422+6T>C324APCUncertain significancers864622442RCV000205347; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103093112103093TCNC_000005.9:g.112103093T>CClinGen:CA349506C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.422+6T>G324APCUncertain significancers864622442RCV001223905; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103093112103093TG5:g.112103093T>G-
NM_000038.6(APC):c.422+10C>T324APCLikely benignrs899376835RCV000583391|RCV000865896; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103097112103097CT5:g.112103097C>TClinGen:CA124975734C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.422+10C>G324APCLikely benign-1RCV002150930; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103097112103097CG112103097-
NM_000038.6(APC):c.422+11T>C324APCLikely benign-1RCV002169146; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103098112103098TC112103098-
NM_000038.6(APC):c.422+14A>G324APCLikely benign-1RCV002125367; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103101112103101AG112103101-
NM_000038.6(APC):c.422+18A>G324APCLikely benign-1RCV002129338; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112103105112103105AG112103105-
NM_000038.6(APC):c.422+19G>C324APCLikely benignrs767046355RCV000411339|RCV000442743|RCV000775119; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN169374|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112103106112103106GCNC_000005.9:g.112103106G>CClinGen:CA038094C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.423-28G>T324APCLikely benignrs570467572RCV000410109; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111298112111298GTNC_000005.9:g.112111298G>TClinGen:CA16042084C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.423-17T>A324APCBenign/Likely benignrs534684461RCV000202107|RCV000582266|RCV000987551|RCV001640304; NMedGen:CN169374|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN5172025112111309112111309TA5:g.112111309T>AClinGen:CA210397C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.423-4dup324APCBenignrs730881230RCV000987550|RCV001579624; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN1693745112111309112111310TTA5:g.112111309_112111310insA-
NM_000038.6(APC):c.423-4del324APCBenign/Likely benignrs730881230RCV000159526|RCV000202236|RCV001353891|RCV001520354|RCV001762340; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0005575,MedGen:C0346629,OMIM:1145005112111310112111310TATNC_000005.9:g.112111322delClinGen:CA009327C0027672 Hereditary cancer-predisposing syndrome;
NC_000005.10:g.(?_112775617)_(112780913_?)del324APCPathogenic-1RCV001033570|RCV001862458; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111314112116610nana-1-
NC_000005.9:g.(?_112111314)_(112111444_?)del324APCPathogenic-1RCV001380904; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111314112111444nana-1-
NC_000005.9:g.(?_112111314)_(112179823_?)dup324APCUncertain significance-1RCV002038955; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111314112179823nana-1-
NC_000005.9:g.(?_112111314)_(112137090_?)del324APCPathogenic-1RCV001972495; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111314112137090nana-1-
NC_000005.10:g.(?_112775619)_(112801393_?)del324APCPathogenic-1RCV000796140; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111316112137090nana-
NM_000038.6(APC):c.423-9A>G324APCPathogenicrs1554071494RCV000551256; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111317112111317AGNC_000005.9:g.112111317A>GClinGen:CA658657473C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.423-9A>T324APCLikely benign-1RCV001481567; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111317112111317AT112111317-
NM_000038.6(APC):c.423-8A>T324APCLikely benign-1RCV001444720; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111318112111318AT112111318-
NC_000005.10:g.(?_112775623)_(112844132_?)del324APCPathogenic-1RCV000527737|RCV001853710; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111320112179829nana-C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.423-6A>G324APCUncertain significance-1RCV001366684; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111320112111320AG112111320-
NM_000038.6(APC):c.423-3_423-2del324APCConflicting interpretations of pathogenicityrs863225354RCV000201990|RCV000467938|RCV000775120|RCV001705159; NMedGen:CN169374|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN5172025112111322112111323AATA5:g.112111322_112111323delClinGen:CA038361C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.423-4_423-2del324APCUncertain significancers876657408RCV000185617|RCV000471040; NMedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111322112111324AAATANC_000005.9:g.112111322_112111324delClinGen:CA10575731,OMIM:611731.0052
NM_000038.6(APC):c.423-4A>G324APCUncertain significancers1561477594RCV000702026|RCV001022105; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112111322112111322AGNC_000005.9:g.112111322A>G-C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.423-4A>T324APCLikely benign-1RCV001489493; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111322112111322AT112111322-
NM_000038.6(APC):c.423-3T>A324APCConflicting interpretations of pathogenicityrs587782293RCV000131175|RCV000202091|RCV000686573|RCV001353717; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN169374|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN5172025112111323112111323TA5:g.112111323T>AClinGen:CA009307C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.423-3T>C324APCUncertain significancers587782293RCV000568909|RCV001853754; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111323112111323TCNC_000005.9:g.112111323T>CClinGen:CA658657474C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.423-2A>T324APCPathogenicrs879254087RCV000235486|RCV001857812; NMedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111324112111324AT5:g.112111324A>TClinGen:CA10584236CN517202 not provided;
NM_000038.6(APC):c.423-2A>C324APCPathogenic-1RCV001384461; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111324112111324AC112111324-
NM_000038.6(APC):c.423-2A>G324APCPathogenic-1RCV001949653; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111324112111324AG112111324-
NM_000038.6(APC):c.423-1G>A324APCPathogenicrs397514031RCV000000878|RCV000491238|RCV000502154|RCV001762028|RCV001851518; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MONDO:MONDO:0005575,MedGen:C0346629,OMIM:114500|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111325112111325GA5:g.112111325G>AClinGen:CA009189,OMIM:611731.0043CN240755 Familial adenomatous polyposis;
NM_000038.6(APC):c.423-1G>C324APCPathogenicrs397514031RCV000202202|RCV001065895; NMedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111325112111325GCNC_000005.9:g.112111325G>CClinGen:CA009194CN517202 not provided;
NM_000038.6(APC):c.423G>T (p.Arg141Ser)324APCPathogenicrs863224458RCV000199388|RCV000501209|RCV001270008|RCV001853212; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0002032,MedGen:C0699790|MedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111326112111326GT5:g.112111326G>TClinGen:CA338613CN240755 Familial adenomatous polyposis;
NM_000038.6(APC):c.424_531+69dup324APCLikely pathogenicrs1561477658RCV000691575; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111326112111327GGTCATTGCTTCTTGCTGATCTTGACAAAGAAGAAAAGGAAAAAGACTGGTATTACGCTCAACTTCAGAATCTCACTAAAAGAATAGATAGTCTTCCTTTAACTGAAAATG5:g.112111326_112111327insTCATTGCTTCTTGCTGATCTTGACAAAGAAGAAAAGGAAAAAGACTGGTATTACGCTCAACTTCAGAATCTCACTAAAAGAATAGATAGTCTTCCTTTA-C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.423G>A (p.Arg141=)324APCUncertain significance-1RCV001967976; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111326112111326GA112111326-
NM_000038.6(APC):c.424T>A (p.Ser142Thr)324APCUncertain significancers1311934641RCV000708950; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111327112111327TA5:g.112111327T>A-C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.426_427del (p.Leu143fs)324APCPathogenicrs587782557RCV000131775|RCV000144571|RCV000202026|RCV000504124|RCV000506761|RCV001353612; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN517202|MONDO:MONDO:0021055,MedGen:C0032580,OMIM:PS175100, Orphanet:733|MedGen:CN169374|MONDO:MONDO:0002032,MedGen:C06997905112111329112111330CATC5:g.112111329_112111330delClinGen:CA009418CN240755 Familial adenomatous polyposis;
NM_000038.6(APC):c.432T>A (p.Leu144=)324APCLikely benign-1RCV002193838; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111335112111335TA112111335-
NM_000038.6(APC):c.436G>A (p.Ala146Thr)324APCUncertain significancers763181290RCV001022370|RCV001244840; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111339112111339GA5:g.112111339G>A-
NM_000038.6(APC):c.436G>T (p.Ala146Ser)324APCUncertain significancers763181290RCV001327305; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111339112111339GT112111339-
NM_000038.6(APC):c.436G>C (p.Ala146Pro)324APCUncertain significance-1RCV001970469; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111339112111339GC112111339-
NM_000038.6(APC):c.437C>T (p.Ala146Val)324APCUncertain significancers1305794169RCV000566219|RCV000780845|RCV000700936; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN169374|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111340112111340CT5:g.112111340C>TClinGen:CA16022277C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.437C>G (p.Ala146Gly)324APCUncertain significancers1305794169RCV001241978; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111340112111340CG5:g.112111340C>G-
NM_000038.6(APC):c.438T>C (p.Ala146=)324APCLikely benign-1RCV001433025; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111341112111341TC112111341-
NM_000038.6(APC):c.440dup (p.Asp147fs)324APCPathogenic-1RCV001996956; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111342112111343GGA112111342-
NM_000038.6(APC):c.440A>G (p.Asp147Gly)324APCUncertain significancers769039873RCV000235657|RCV001022439|RCV001338815; NMedGen:CN517202|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111343112111343AGNC_000005.9:g.112111343A>GClinGen:CA038999CN169374 not specified;
NM_000038.6(APC):c.440A>C (p.Asp147Ala)324APCUncertain significance-1RCV001966451; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111343112111343AC112111343-
NM_000038.6(APC):c.442C>A (p.Leu148Ile)324APCUncertain significancers774964663RCV000568928|RCV001055952; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111345112111345CANC_000005.9:g.112111345C>AClinGen:CA039051C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.442del (p.Asp149fs)324APCPathogenic-1RCV001354880; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111345112111345TCT112111344-
NM_000038.6(APC):c.443T>A (p.Leu148His)324APCUncertain significancers762062860RCV000220750|RCV000689183; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111346112111346TA5:g.112111346T>AClinGen:CA039077C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.443T>G (p.Leu148Arg)324APCUncertain significancers762062860RCV000819978; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111346112111346TG5:g.112111346T>G-
NM_000038.6(APC):c.445G>C (p.Asp149His)324APCUncertain significancers767875993RCV000563918|RCV000794048; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111348112111348GCNC_000005.9:g.112111348G>CClinGen:CA039127C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.445G>A (p.Asp149Asn)324APCUncertain significancers767875993RCV001022514|RCV001352466; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111348112111348GA5:g.112111348G>A-
NM_000038.6(APC):c.447C>A (p.Asp149Glu)324APCUncertain significancers750821213RCV000461374|RCV000561667; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112111350112111350CANC_000005.9:g.112111350C>AClinGen:CA039179C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.447C>G (p.Asp149Glu)324APCUncertain significancers750821213RCV001206047; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111350112111350CG5:g.112111350C>G-
NM_000038.6(APC):c.450_453del (p.Glu151fs)324APCPathogenicrs863225355RCV000202178|RCV001384462; NMedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111351112111354CAAAGCNC_000005.9:g.112111353_112111356delClinGen:CA279775CN517202 not provided;
NM_000038.6(APC):c.448A>T (p.Lys150Ter)324APCPathogenicrs878853444RCV000231021|RCV000657600|RCV001854815; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111351112111351ATNC_000005.9:g.112111351A>TClinGen:CA10582275C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.449A>G (p.Lys150Arg)324APCUncertain significancers371085910RCV000130643|RCV000148370|RCV000206082|RCV000211892|RCV000656744; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0005484,MedGen:C1302401|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN169374|MedGen:CN5172025112111352112111352AG5:g.112111352A>GClinGen:CA009591C1302401 Colorectal adenoma;
NM_000038.6(APC):c.450A>G (p.Lys150=)324APCConflicting interpretations of pathogenicityrs116020626RCV000159527|RCV000199795|RCV000211893|RCV000759433|RCV001156933|RCV001353868; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN169374|MedGen:CN517202|MedGen:CN239210|MONDO:MONDO:0002032,MedGen:C06997905112111353112111353AGNC_000005.9:g.112111353A>GClinGen:CA009598C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.453del (p.Glu152fs)324APCPathogenicrs863224820RCV000202272|RCV000200847|RCV000491770|RCV001356072; NMedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0002032,MedGen:C06997905112111355112111355GAGNC_000005.9:g.112111356delClinGen:CA279814C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.454G>C (p.Glu152Gln)324APCUncertain significance-1RCV002045348; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111357112111357GC112111357-
NM_000038.6(APC):c.458del (p.Lys153fs)324APCPathogenicrs1554071521RCV000503185|RCV001385183; NMONDO:MONDO:0002032,MedGen:C0699790|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111358112111358GAGNC_000005.9:g.112111361delClinGen:CA645372773CN240755 Familial adenomatous polyposis;
NM_000038.6(APC):c.457A>G (p.Lys153Glu)324APCUncertain significancers1561477861RCV000704385; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111360112111360AG5:g.112111360A>G-C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.457A>T (p.Lys153Ter)324APCPathogenic-1RCV001951273; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111360112111360AT112111360-
NM_000038.6(APC):c.458A>G (p.Lys153Arg)324APCUncertain significancers754553913RCV000561950|RCV000700039; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111361112111361AGNC_000005.9:g.112111361A>GClinGen:CA039423C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.460dup (p.Glu154fs)324APCPathogenic-1RCV001726722; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111361112111362AAG112111361-
NM_000038.6(APC):c.459G>A (p.Lys153=)324APCLikely benignrs864622482RCV000205338|RCV000570963|RCV000614961; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN1693745112111362112111362GANC_000005.9:g.112111362G>AClinGen:CA349496C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.460G>A (p.Glu154Lys)324APCUncertain significancers786202822RCV000165838|RCV000479967|RCV000708951; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111363112111363GA5:g.112111363G>AClinGen:CA009636C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.465del (p.Asp156fs)324APCPathogenicrs1554071529RCV000562556|RCV001055575; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111364112111364GAG5:g.112111364_112111364delClinGen:CA658657475C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.461A>G (p.Glu154Gly)324APCUncertain significancers1561477912RCV000697285; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111364112111364AG5:g.112111364A>G-C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.465A>G (p.Lys155=)324APCLikely benignrs778691867RCV000461064|RCV000776475|RCV001721463; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN5172025112111368112111368AG5:g.112111368A>GClinGen:CA039516C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.466G>C (p.Asp156His)324APCUncertain significancers1554071538RCV000584639|RCV001853892; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111369112111369GC5:g.112111369G>CClinGen:CA16022340C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.466G>T (p.Asp156Tyr)324APCUncertain significancers1554071538RCV000807496; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111369112111369GT5:g.112111369G>T-
NM_000038.6(APC):c.466G>A (p.Asp156Asn)324APCUncertain significancers1554071538RCV001245359; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111369112111369GA5:g.112111369G>A-
NM_000038.6(APC):c.468C>T (p.Asp156=)324APCLikely benignrs752627126RCV000234653|RCV001022898; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112111371112111371CT5:g.112111371C>TClinGen:CA10582276C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.468C>G (p.Asp156Glu)324APCUncertain significancers752627126RCV000540160|RCV000567343|RCV001193497; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN1693745112111371112111371CGNC_000005.9:g.112111371C>GClinGen:CA039593C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.468C>A (p.Asp156Glu)324APCUncertain significance-1RCV002013016; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111371112111371CA112111371-
NM_000038.6(APC):c.470G>A (p.Trp157Ter)324APCPathogenicrs137854576RCV000000852; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111373112111373GA5:g.112111373G>AClinGen:CA009701,OMIM:611731.0021C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.471G>A (p.Trp157Ter)324APCPathogenicrs1060503328RCV000458690|RCV000583237; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN5172025112111374112111374GANC_000005.9:g.112111374G>AClinGen:CA16022351C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.471G>C (p.Trp157Cys)324APCUncertain significancers1060503328RCV001308703; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111374112111374GC112111374-
NM_000038.6(APC):c.473A>T (p.Tyr158Phe)324APCUncertain significancers587782477RCV000131591|RCV000457825; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111376112111376AT5:g.112111376A>TClinGen:CA009722C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.475dup (p.Tyr159fs)324APCPathogenicrs863225361RCV000202290|RCV000568959|RCV000694158; NMedGen:CN517202|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111376112111377AATNC_000005.9:g.112111378dupClinGen:CA279827C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.474T>C (p.Tyr158=)324APCLikely benignrs1060504891RCV000475351|RCV001424228; NMedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111377112111377TCNC_000005.9:g.112111377T>CClinGen:CA16611641C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.474T>A (p.Tyr158Ter)324APCPathogenic-1RCV001993320; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111377112111377TA112111377-
NM_000038.6(APC):c.476dup (p.Tyr159Ter)324APCPathogenic/Likely pathogenicrs878853451RCV000229992|RCV000486696; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN5172025112111378112111379TTA5:g.112111378_112111379insAClinGen:CA10582277C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.475T>C (p.Tyr159His)324APCUncertain significance-1RCV001959538; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111378112111378TC112111378-
NM_000038.6(APC):c.476_488del (p.Tyr158_Tyr159insTer)324APCPathogenic-1RCV001384864; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111379112111391TACGCTCAACTTCAT112111378-
NM_000038.6(APC):c.477del (p.Tyr158_Tyr159insTer)324APCPathogenicrs730880250RCV000157585|RCV000657827; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN5172025112111380112111380ACA5:g.112111380_112111380delClinGen:CA009748C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.477C>T (p.Tyr159=)324APCLikely benignrs863224281RCV000198065|RCV000438858|RCV000564772; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN169374|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112111380112111380CTNC_000005.9:g.112111380C>TClinGen:CA337609C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.477C>G (p.Tyr159Ter)324APCPathogenicrs863224281RCV000236674|RCV000646369|RCV001023029|RCV001844100; NMedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021055,MedGen:C0032580,OMIM:PS175100, Orphanet:7335112111380112111380CGNC_000005.9:g.112111380C>GClinGen:CA10584237C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.478G>A (p.Ala160Thr)324APCUncertain significancers1114167556RCV000490878|RCV000529546|RCV001550818; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN5172025112111381112111381GANC_000005.9:g.112111381G>AClinGen:CA16022368C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.481C>T (p.Gln161Ter)324APCPathogenicrs876658325RCV000221156|RCV000467000|RCV001269625; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN5172025112111384112111384CT5:g.112111384C>TClinGen:CA10578293C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.483A>G (p.Gln161=)324APCLikely benignrs1554071578RCV000581424|RCV000975503; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111386112111386AGNC_000005.9:g.112111386A>GClinGen:CA445753054C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.484C>A (p.Leu162Ile)324APCUncertain significance-1RCV001884093; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111387112111387CA112111387-
NM_000038.6(APC):c.487C>T (p.Gln163Ter)324APCPathogenicrs863225362RCV000202083|RCV000500940|RCV000548404|RCV001023190; NMedGen:CN517202|MONDO:MONDO:0021055,MedGen:C0032580,OMIM:PS175100, Orphanet:733|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112111390112111390CTNC_000005.9:g.112111390C>TClinGen:CA279721CN240755 Familial adenomatous polyposis;
NM_000038.6(APC):c.489G>A (p.Gln163=)324APCLikely benignrs876660717RCV000942020|RCV001483427; NMedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111392112111392GA5:g.112111392G>A-
NM_000038.6(APC):c.490A>G (p.Asn164Asp)324APCUncertain significance-1RCV001932871; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111393112111393AG112111393-
NM_000038.6(APC):c.492T>C (p.Asn164=)324APCLikely benign-1RCV001420068; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111395112111395TC112111395-
NM_000038.6(APC):c.495C>T (p.Leu165=)324APCLikely benignrs1554071591RCV000646570; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111398112111398CT5:g.112111398C>TClinGen:CA445753062C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.496A>G (p.Thr166Ala)324APCUncertain significancers889134189RCV000699460|RCV001023341; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112111399112111399AG5:g.112111399A>G-C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.496A>T (p.Thr166Ser)324APCUncertain significancers889134189RCV000695295; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111399112111399AT5:g.112111399A>T-C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.497_499delinsTT (p.Thr166fs)324APCPathogenicrs1114167588RCV000491467|RCV000694736; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111400112111402CTATTNC_000005.9:g.112111400_112111402delinsTTClinGen:CA645369351C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.497C>T (p.Thr166Ile)324APCUncertain significance-1RCV002012112; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111400112111400CT112111400-
NM_000038.6(APC):c.499A>G (p.Lys167Glu)324APCUncertain significancers1310352139RCV000646309|RCV001524942; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112111402112111402AGNC_000005.9:g.112111402A>GClinGen:CA16022414C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.500A>G (p.Lys167Arg)324APCUncertain significance-1RCV001931523; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111403112111403AG112111403-
NM_000038.6(APC):c.503G>A (p.Arg168Lys)324APCUncertain significancers1554071604RCV000539330|RCV001178548; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112111406112111406GANC_000005.9:g.112111406G>AClinGen:CA16022423C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.505_507del (p.Ile169del)324APCUncertain significance-1RCV002018058; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111407112111409GAATG112111406-
NM_000038.6(APC):c.509_512del (p.Asp170fs)324APCPathogenicrs387906231RCV000000841|RCV000201968|RCV000491548|RCV001797583; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN517202|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021055,MedGen:C0032580,OMIM:PS175100, Orphanet:7335112111408112111411AATAGA5:g.112111408_112111411delClinGen:CA009858,OMIM:611731.0012C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.505A>G (p.Ile169Val)324APCUncertain significancers878853455RCV000227519|RCV000562601|RCV001854819; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111408112111408AGNC_000005.9:g.112111408A>GClinGen:CA10582278C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.506T>C (p.Ile169Thr)324APCUncertain significancers1757567981RCV001201299|RCV001859218; NMedGen:CN169374|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111409112111409TC5:g.112111409T>C-
NM_000038.6(APC):c.508_509del (p.Ile169_Asp170insTer)324APCPathogenic/Likely pathogenicrs886039642RCV000255777|RCV000694331; NMedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111410112111411TAGT5:g.112111410_112111411delClinGen:CA10588376C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.512G>A (p.Ser171Asn)324APCUncertain significancers1157254183RCV000775321|RCV001215219; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111415112111415GANC_000005.9:g.112111415G>A-
NM_000038.6(APC):c.516dup (p.Pro173fs)324APCPathogenicrs1580359575RCV000805446; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111417112111418CCT5:g.112111417_112111418insT-
NM_000038.6(APC):c.514C>A (p.Leu172Ile)324APCUncertain significance-1RCV001974367; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111417112111417CA112111417-
NM_000038.6(APC):c.516del (p.Pro173fs)324APCPathogenic-1RCV001383961; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111418112111418CTC112111417-
NM_000038.6(APC):c.516T>C (p.Leu172=)324APCLikely benignrs777643585RCV000461763|RCV000580075; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112111419112111419TCNC_000005.9:g.112111419T>CClinGen:CA040814C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.520T>C (p.Leu174=)324APCLikely benign-1RCV001473524; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111423112111423TC112111423-
NM_000038.6(APC):c.524_531+4del324APCPathogenic/Likely pathogenicrs863225364RCV000202212|RCV000568686|RCV000707133; NMedGen:CN517202|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111424112111435TTAACTGAAAATGTNC_000005.9:g.112111427_112111438delClinGen:CA279786C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.521T>G (p.Leu174Ter)324APCPathogenicrs1757571583RCV001052876; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111424112111424TG5:g.112111424T>G-
NM_000038.6(APC):c.522_523del (p.Leu174fs)324APCPathogenicrs1757572270RCV001055879; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111425112111426TAAT5:g.112111425_112111426del-
NM_000038.6(APC):c.524C>G (p.Thr175Ser)324APCUncertain significancers1554071616RCV000646477; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111427112111427CG5:g.112111427C>GClinGen:CA16022473C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.526G>C (p.Glu176Gln)324APCUncertain significance-1RCV002026921; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111429112111429GC112111429-
NM_000038.6(APC):c.527A>C (p.Glu176Ala)324APCUncertain significancers1580359661RCV001023849|RCV001320814; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111430112111430AC5:g.112111430A>C-
NM_000038.6(APC):c.530del (p.Asn177fs)324APCPathogenicrs1757573424RCV001064215; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111430112111430GAG5:g.112111430_112111430del-
NM_000038.6(APC):c.527A>G (p.Glu176Gly)324APCUncertain significance-1RCV001915741; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111430112111430AG112111430-
NM_000038.6(APC):c.530A>G (p.Asn177Ser)324APCUncertain significancers1561478485RCV000773905|RCV001350446; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111433112111433AGNC_000005.9:g.112111433A>G-
NM_000038.6(APC):c.531T>C (p.Asn177=)324APCUncertain significancers1234730026RCV001317089; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111434112111434TC112111434-
NM_000038.6(APC):c.531+1G>C324APCPathogenic/Likely pathogenicrs876659973RCV000217536|RCV000411683|RCV000482581; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN5172025112111435112111435GC5:g.112111435G>CClinGen:CA10578295C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.531+2dup324APCPathogenicrs1060503257RCV000458186; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111435112111436GGTNC_000005.9:g.112111436dupClinGen:CA16611556C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.531+5_531+8del324APCLikely pathogenicrs1554071617RCV000646455; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111435112111438TGTAATNC_000005.9:g.112111435GTAA[1]ClinGen:CA658760464C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.531+1G>A324APCPathogenic/Likely pathogenicrs876659973RCV001066456; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111435112111435GA5:g.112111435G>A-
NM_000038.6(APC):c.531+2T>A324APCPathogenic/Likely pathogenicrs863225365RCV000202121|RCV000491613|RCV001203374|RCV001193574; NMedGen:CN517202|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0021055,MedGen:C0032580,OMIM:PS175100, Orphanet:7335112111436112111436TANC_000005.9:g.112111436T>AClinGen:CA279737C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.531+2T>C324APCPathogenicrs863225365RCV000202262|RCV000563395|RCV001853251; NMedGen:CN517202|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111436112111436TCNC_000005.9:g.112111436T>CClinGen:CA279807C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.531+3A>C324APCLikely pathogenicrs1114167550RCV000491509|RCV000646317; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111437112111437ACNC_000005.9:g.112111437A>CClinGen:CA645369352C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.531+3A>T324APCUncertain significance-1RCV001873044; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111437112111437AT112111437-
NM_000038.6(APC):c.531+4A>G324APCUncertain significance-1RCV001970530; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111438112111438AG112111438-
NM_000038.6(APC):c.531+5G>C324APCPathogenicrs587779798RCV000322468|RCV000491896|RCV000542745; NMedGen:CN517202|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111439112111439GC5:g.112111439G>CClinGen:CA10602909C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.531+6T>C324APCUncertain significancers1561478536RCV000699407; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111440112111440TC5:g.112111440T>C-C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.531+9C>G324APCUncertain significancers1554071622RCV000590516|RCV000776342|RCV001242284; NMedGen:CN517202|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111443112111443CG5:g.112111443C>GClinGen:CA658683401CN517202 not provided;
NM_000038.6(APC):c.531+16G>A324APCLikely benignrs770126046RCV000428322|RCV000580247|RCV000662543; NMedGen:CN169374|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112111450112111450GA5:g.112111450G>AClinGen:CA041353C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.10:g.(?_112779849)_(112844136_?)dup324APCUncertain significance-1RCV001033218|RCV001873437; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112115546112179833nana-1-
NM_000038.6(APC):c.532-939G>A324APCLikely benignrs551489857RCV000409642; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112115548112115548GA5:g.112115548G>AClinGen:CA16042085C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.532-939G>T324APCLikely benignrs551489857RCV000412192; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112115548112115548GTNC_000005.9:g.112115548G>TClinGen:CA16042086C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.532-14_532-12del324APCLikely benignrs765893314RCV000581877|RCV001353825|RCV001722422; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN5172025112116468112116470TTTATNC_000005.9:g.112116470ATT[1]ClinGen:CA041434C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.532-17A>T324APCLikely benignrs997606437RCV000408966|RCV000439871|RCV000580653; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN169374|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112116470112116470ATNC_000005.9:g.112116470A>TClinGen:CA16042087C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.532-14A>T324APCLikely benignrs375254915RCV000582879|RCV002060567; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112116473112116473AT5:g.112116473A>TClinGen:CA041407C0027672 Hereditary cancer-predisposing syndrome;
NM_000038.6(APC):c.532-14A>G324APCLikely benign-1RCV002110615; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112116473112116473AG112116473-
NM_000038.6(APC):c.532-10G>A324APCLikely benign-1RCV002142942; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112116477112116477GA112116477-
NM_000038.6(APC):c.532-10G>C324APCLikely benign-1RCV002174636; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112116477112116477GC112116477-
NM_000038.6(APC):c.532-9del324APCLikely benignrs777844116RCV000583887|RCV000646634; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112116478112116478GTG5:g.112116478_112116478delClinGen:CA041581C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.532-8G>A324APCPathogenic/Likely pathogenicrs1060503323RCV000458868|RCV000503571|RCV000491376; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0002032,MedGen:C0699790|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112116479112116479GANC_000005.9:g.112116479G>AClinGen:CA16611747CN240755 Familial adenomatous polyposis;
NM_000038.6(APC):c.532-8G>C324APCLikely benign-1RCV002203863; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112116479112116479GC112116479-
NM_000038.6(APC):c.532-7G>C324APCLikely benignrs1057520840RCV000460487|RCV000579458|RCV001720052; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN5172025112116480112116480GC5:g.112116480G>CClinGen:CA16604648C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.532-7G>T324APCLikely benignrs1057520840RCV000646589|RCV001191941; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112116480112116480GT5:g.112116480G>TClinGen:CA561895117C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.532-6T>C324APCUncertain significancers1554072543RCV000543401|RCV001775867; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN5172025112116481112116481TCNC_000005.9:g.112116481T>CClinGen:CA658657477C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.9:g.(?_112116481)_(112179829_?)dup324APCUncertain significance-1RCV000646698; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112116481112179829nana-C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.532-2A>G324APCLikely pathogenicrs752152148RCV000646510; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112116485112116485AGNC_000005.9:g.112116485A>GClinGen:CA360617494C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.532-2A>C324APCPathogenicrs752152148RCV000824411; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112116485112116485AC5:g.112116485A>C-
NM_000038.6(APC):c.532-2A>T324APCPathogenic-1RCV001975132; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112116485112116485AT112116485-
NM_000038.6(APC):c.532-1G>A324APCPathogenicrs1554072547RCV000506699|RCV000646378; NMedGen:CN169374|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112116486112116486GA5:g.112116486G>AClinGen:CA360617495C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.532T>A (p.Phe178Ile)324APCUncertain significancers1060503344RCV000465632|RCV001002492|RCV001180356|RCV001753909; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN169374|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN5172025112116487112116487TA5:g.112116487T>AClinGen:CA16022491C2713442 175100 Familial adenomatous polyposis 1;
NC_000005.10:g.(?_112780790)_(112846239_?)del324APCPathogenic-1RCV000476663; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112116487112181936nana-C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.535T>G (p.Ser179Ala)324APCUncertain significance-1RCV001929162; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112116490112116490TG112116490-
NM_000038.6(APC):c.537del (p.Leu180fs)324APCPathogenic-1RCV001384463; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112116491112116491TCT112116490-
NM_000038.6(APC):c.537C>A (p.Ser179=)324APCLikely benignrs149736402RCV000167064|RCV000469176|RCV000587471; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN1693745112116492112116492CA5:g.112116492C>AClinGen:CA010363C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.539T>C (p.Leu180Ser)324APCUncertain significance-1RCV002030092; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112116494112116494TC112116494-
NM_000038.6(APC):c.543_546del (p.Thr182fs)324APCPathogenicrs1554072562RCV000533678; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112116495112116498TACAATNC_000005.9:g.112116498_112116501delClinGen:CA645546029C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.540A>G (p.Leu180=)324APCLikely benign-1RCV001506836; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112116495112116495AG112116495-
NM_000038.6(APC):c.541C>G (p.Gln181Glu)324APCUncertain significancers863225366RCV001351852; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112116496112116496CG112116496-
NM_000038.6(APC):c.546A>G (p.Thr182=)324APCLikely benignrs864622392RCV000206443|RCV001394400; NMedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112116501112116501AGNC_000005.9:g.112116501A>GClinGen:CA350474C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.547_548del (p.Asp183fs)324APCPathogenicrs1758238807RCV001212162|RCV001358573; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN5172025112116501112116502CAGC5:g.112116501_112116502del-
NM_000038.6(APC):c.547G>C (p.Asp183His)324APCUncertain significancers1758239055RCV001207066; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112116502112116502GC5:g.112116502G>C-
NM_000038.6(APC):c.548A>T (p.Asp183Val)324APCUncertain significancers1758239334RCV001210480; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112116503112116503AT5:g.112116503A>T-
NM_000038.6(APC):c.551T>C (p.Met184Thr)324APCUncertain significancers1257143633RCV000582295|RCV000646314|RCV001775905; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN5172025112116506112116506TC5:g.112116506T>CClinGen:CA16022537C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.552G>T (p.Met184Ile)324APCUncertain significancers1758240617RCV001228491; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112116507112116507GT5:g.112116507G>T-
NM_000038.6(APC):c.552G>A (p.Met184Ile)324APCUncertain significance-1RCV001372377; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112116507112116507GA112116507-
NM_000038.6(APC):c.554C>T (p.Thr185Ile)324APCUncertain significancers1484797510RCV001058069; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112116509112116509CT5:g.112116509C>T-
NM_000038.6(APC):c.555C>G (p.Thr185=)324APCLikely benignrs1287296038RCV000932337|RCV001408739; NMedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112116510112116510CG5:g.112116510C>G-
NM_000038.6(APC):c.556A>G (p.Arg186Gly)324APCUncertain significancers1580379633RCV001024286|RCV001236397; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112116511112116511AG5:g.112116511A>G-
NM_000038.6(APC):c.557G>C (p.Arg186Thr)324APCUncertain significancers1561485438RCV000708952; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112116512112116512GC5:g.112116512G>C-C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.559del (p.Arg187fs)324APCPathogenicrs1758242304RCV001068749; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112116513112116513GAG5:g.112116513_112116513del-
NM_000038.6(APC):c.560G>A (p.Arg187Lys)324APCUncertain significancers1758242583RCV001299691; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112116515112116515GA112116515-
NM_000038.6(APC):c.564A>G (p.Gln188=)324APCConflicting interpretations of pathogenicityrs377493489RCV000163065|RCV000428165|RCV000469275; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN169374|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112116519112116519AG5:g.112116519A>GClinGen:CA010565C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.565T>C (p.Leu189=)324APCLikely benignrs762146761RCV000475660|RCV000562278|RCV000588432; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN1693745112116520112116520TCNC_000005.9:g.112116520T>CClinGen:CA16611642C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.567G>C (p.Leu189Phe)324APCUncertain significancers1554072586RCV000536999; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112116522112116522GCNC_000005.9:g.112116522G>CClinGen:CA16022574C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.572_573dup (p.Glu192fs)324APCPathogenicrs1758244651RCV001044297; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112116524112116525AAAT5:g.112116524_112116525insAT-
NM_000038.6(APC):c.573T>C (p.Tyr191=)324APCBenign/Likely benignrs185154886RCV000197836|RCV000309947|RCV000426052|RCV000573062|RCV001701788; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MedGen:CN239210|MedGen:CN169374|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN5172025112116528112116528TC5:g.112116528T>CClinGen:CA042785CN239210 APC-Associated Polyposis Disorders;
NM_000038.6(APC):c.578C>G (p.Ala193Gly)324APCUncertain significancers780403698RCV000702800; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112116533112116533CG5:g.112116533C>G-C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.580A>G (p.Arg194Gly)324APCUncertain significancers1758246384RCV001238220; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112116535112116535AG5:g.112116535A>G-
NM_000038.6(APC):c.581G>C (p.Arg194Thr)324APCUncertain significancers200740020RCV001245072; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112116536112116536GC5:g.112116536G>C-
NM_000038.6(APC):c.582G>A (p.Arg194=)324APCLikely benignrs864622103RCV000206184|RCV000573330|RCV001193498; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN1693745112116537112116537GANC_000005.9:g.112116537G>AClinGen:CA350246C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.583C>T (p.Gln195Ter)324APCPathogenicrs749479682RCV000484402|RCV001071166; NMedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112116538112116538CT5:g.112116538C>TClinGen:CA16022611CN517202 not provided;
NM_000038.6(APC):c.583C>G (p.Gln195Glu)324APCUncertain significancers749479682RCV000646275; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112116538112116538CGNC_000005.9:g.112116538C>GClinGen:CA043181C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.584A>T (p.Gln195Leu)324APCUncertain significance-1RCV001947664; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112116539112116539AT112116539-
NM_000038.6(APC):c.586A>G (p.Ile196Val)324APCUncertain significancers1580379926RCV001024624|RCV001338379; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112116541112116541AG5:g.112116541A>G-
NM_000038.6(APC):c.588C>T (p.Ile196=)324APCLikely benignrs147846364RCV000223661|RCV000679072|RCV001080456; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112116543112116543CT5:g.112116543C>TClinGen:CA043300C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.589A>G (p.Arg197Gly)324APCUncertain significancers1561485645RCV000698205; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112116544112116544AG5:g.112116544A>G-C2713442 175100 Familial adenomatous polyposis 1;
NM_000038.6(APC):c.591A>T (p.Arg197Ser)324APCUncertain significancers1758249528RCV001240059; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112116546112116546AT5:g.112116546A>T-
NM_000038.6(APC):c.592G>A (p.Val198Ile)324APCUncertain significancers1168791940RCV000614285|RCV001046918|RCV001024694; NMedGen:CN169374|MONDO:MONDO:0021056,MedGen:C2713442,OMIM:175100|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:1401625112116547112116547GANC_000005.9:g.112116547G>AClinGen:CA16022630CN169374 not specified;
NM_000038.6(APC):c.593T>C (p.Val198Ala)324APCUncertain significance-1RCV001884746; NMONDO:MONDO:0021056,MedGen:C2713442,OMIM:1751005112116548112116548TC112116548-
NM_000038.6(APC):c.595dup (p.Ala199fs)324APC