MSeqDR Mitochondrial Disease Portal


 
*:HP: HPO terms, UMDF: 1= Disease, ND: NAMDC terms.
  Most Studied  CPEO, Complex I Deficiency, COXPD1, Leigh, LHON, MELAS, MERRF, Myopathy, SANDO
Disease Browser
Parent Node:
expand
Neurofibromatoses (D017253)
Parent Node:
expand
Peripheral Nervous System Diseases (D010523)
..Starting node
..expand
Neurofibromatosis 1 (D009456)

       Child Nodes:
........expandWATSON SYNDROME (OMIM:193520)



 Sister Nodes: 
..expandAccessory deep peroneal nerve (C536001)
..expandAcrodynia (D000170)
..expandAmyloid Neuropathies (D017772) Child3
..expandBrachial Plexus Neuropathies (D020516) Child4
..expandCataract ataxia deafness (C538283)
..expandComplex Regional Pain Syndromes (D020918) Child2
..expandCorpus callosum agenesis neuronopathy (C536446)
..expandDeafness, X-Linked 5 (C564472)
..expandDiabetic Neuropathies (D003929) Child2
..expandGiant Axonal Neuropathy (D056768) Child1
..expandGuillain-Barre Syndrome (D020275) Child1
..expandHand-Arm Vibration Syndrome (D053421)
..expandHAREL-YOON SYNDROME (OMIM:617183)
..expandHypertrophic Neuropathy And Cataract (C565490)
..expandInherited Peripheral Neuropathy (C548028)
..expandIsaacs Syndrome (D020386)
..expandMononeuropathies (D020422) Child15
..expandNavajo neurohepatopathy (C538344) Child1  LSDB C:1 L: 00035;
..expandNerve Compression Syndromes (D009408) Child13
..expandNeuralgia (D009437) Child6
..expandNeuritis (D009443) Child3
..expandNeurofibromatosis 1 (D009456) Child1
..expandNEURONOPATHY, DISTAL HEREDITARY MOTOR, TYPE IIC (OMIM:613376)
..expandNeuropathy, Painful (C564945)
..expandNeuropathy, with Paraprotein in Serum, Cerebrospinal Fluid and Urine (C563516)
..expandOptic Atrophy, Hearing Loss, and Peripheral Neuropathy, Autosomal Dominant (C563497)
..expandPain Insensitivity, Congenital (D000699) Child2
..expandPeripheral Nerve Injuries (D059348)
..expandPeripheral Nervous System Neoplasms (D010524) Child25  LSDB C:1
..expandPeripheral Neuropathy, Ataxia, Focal Necrotizing Encephalopathy, and Spongy Degeneration of Brain (C564894)
..expandPERIPHERAL NEUROPATHY, MYOPATHY, HOARSENESS, AND HEARING LOSS (OMIM:614369)
..expandPolyneuropathies (D011115) Child200  LSDB C:3
..expandRadiculopathy (D011843)
..expandSacral plexopathy (C537224)
..expandSmall Fiber Neuropathy (D000071075)
..expandSpinocerebellar Ataxia With Rigidity And Peripheral Neuropathy (C566669)
..expandTarlov Cysts (D052958)
   

Human Disease MESH is developed by UMLS.
Further data from MedGen, OMIM,ClinVar, CTD
Term ID:8804
Name:Neurofibromatosis 1
Definition:An autosomal dominant inherited disorder (with a high frequency of spontaneous mutations) that features developmental changes in the nervous system, muscles, bones, and skin, most notably in tissue derived from the embryonic NEURAL CREST. Multiple hyperpigmented skin lesions and subcutaneous tumors are the hallmark of this disease. Peripheral and central nervous system neoplasms occur frequently, especially OPTIC NERVE GLIOMA and NEUROFIBROSARCOMA. NF1 is caused by mutations which inactivate the NF1 gene (GENES, NEUROFIBROMATOSIS 1) on chromosome 17q. The incidence of learning disabilities is also elevated in this condition. (From Adams et al., Principles of Neurology, 6th ed, pp1014-18) There is overlap of clinical features with NOONAN SYNDROME in a syndrome called neurofibromatosis-Noonan syndrome. Both the PTPN11 and NF1 gene products are involved in the SIGNAL TRANSDUCTION pathway of Ras (RAS PROTEINS).
Alternative IDs:DO:DOID:8712|OMIM:162200
ParentIDs:MESH:D010523|MESH:D017253
TreeNumbers:C04.557.580.600.580.590.650 |C04.700.631.650 |C10.562.600.500 |C10.574.500.549.400 |C10.668.829.675 |C16.320.400.560.400 |C16.320.700.633.650
Synonyms:Cafe au Lait Spots with Pulmonic Stenosis |Cafe-au-Lait Spots with Pulmonic Stenosis |Molluscum Fibrosum |Neurofibromatoses, Peripheral |Neurofibromatoses, Type I |Neurofibromatosis I |Neurofibromatosis, Peripheral |Neurofibromatosis, Peripheral, NF1 |Neurofibro
Slim Mappings:Cancer|Genetic disease (inborn)|Nervous system disease
Reference: MedGen: D009456
MeSH: D009456
OMIM: 162200;
MSeqDR LSDB:  
Genes: NF1;
Phenotypes
1 HP:0000006Autosomal dominant inheritance
2 HP:0002410Aqueductal stenosis
3 HP:0009592Astrocytoma
4 HP:0000997Axillary frecklingHP:0040284
5 HP:0002857Genu valgum
6 HP:0000501Glaucoma
7 HP:0000238Hydrocephalus
8 HP:0000316Hypertelorism
9 HP:0000822Hypertension
10 HP:0002521Hypsarrhythmia
11 HP:0030052Inguinal frecklingHP:0040284 Childhood onset
12 HP:0001256Intellectual disability, mild
13 HP:0009737Lisch nodulesHP:0040284
14 HP:0000256MacrocephalyHP:0040284
15 HP:0002858Meningioma
16 HP:0007565Multiple cafe-au-lait spotsHP:0040284
17 HP:0100697Neurofibrosarcoma
18 HP:0009734Optic nerve gliomaHP:0040284
19 HP:0001548Overgrowth
20 HP:0002897Parathyroid adenoma
21 HP:0002666PheochromocytomaHP:0040284
22 HP:0009732Plexiform neurofibromaHP:0040284
23 HP:0001920Renal artery stenosisHP:0040284
24 HP:0002859Rhabdomyosarcoma
25 HP:0002650ScoliosisHP:0040284
26 HP:0001250Seizures
NAMDC:  Seizures
HP:0040284
27 HP:0004322Short stature
NAMDC:  Short stature (patientˇŻs height is below the 3rd percentile)
HP:0040284
28 HP:0001328Specific learning disabilityHP:0040284
29 HP:0002414Spina bifidaHP:0040284
30 HP:0009735Spinal neurofibromasHP:0040284
31 HP:0009736Tibial pseudoarthrosisHP:0040284
Disease Causing ClinVar Variants
Variation_NameGeneIDGeneSymbolClinicalSignificancedbSNPRCVaccessionTestedInGTRPhenotypeIDsChromosomeStartStopHGVS_cHGVS_pHGVS_gOtherIDsDisease_ClinVar
NC_000017.11:g.(?_31093927)_(31378677_?)del4763NF1Pathogenic-1RCV001033954; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942094529705695nana-1-
NM_000267.3(NF1):c.-383_*3522del4763NF1Pathogenic-1RCV000234608; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942194529704695nana-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.-383_60+?dup4434763NF1Uncertain significance-1RCV000240404; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942194529422387nana-C0027831 162200 Neurofibromatosis, type 1;
NC_000017.11:g.(?_31094927)_(31095369_?)del4763NF1Pathogenic-1RCV000461569; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942194529422387nana-
NC_000017.10:g.(?_29421945)_(29509683_?)dup4763NF1Uncertain significance-1RCV000462709; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942194529509683nana-C0027831 162200 Neurofibromatosis, type 1;
NC_000017.11:g.(?_31094927)_(31182665_?)del4763NF1Pathogenic-1RCV000470588; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942194529509683nana-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.-363T>C4763NF1Uncertain significance-1RCV001125374|RCV001125375|RCV001125376|RCV001125377; NMONDO:MONDO:0008672,MedGen:C0553586,OMIM:193520, Orphanet:3444|MONDO:MONDO:0008078,MedGen:C1834235,OMIM:162210, Orphanet:636|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0011035,MedGen:C2931482,OMIM:601321, Orphanet:638172942196529421965TC17:g.29421965T>C-
NM_000267.3(NF1):c.-322G>A4763NF1Uncertain significancers886052785RCV000291313|RCV000345133|RCV000350250|RCV000383335; NMONDO:MONDO:0008672,MedGen:C0553586,OMIM:193520, Orphanet:3444|MONDO:MONDO:0011035,MedGen:C2931482,OMIM:601321, Orphanet:638|MONDO:MONDO:0008078,MedGen:C1834235,OMIM:162210, Orphanet:636|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942200629422006GA17:g.29422006G>AClinGen:CA10649828
NC_000017.11:g.(?_31095030)_(31095379_?)del4763NF1Pathogenic-1RCV001032077; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942204829422397nana-1-
NC_000017.11:g.(?_31095030)_(31104404_?)dup4763NF1Uncertain significance-1RCV001031083; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942204829431422nana-1-
NC_000017.11:g.(?_31095030)_(31170007_?)del4763NF1Pathogenic-1RCV001032162; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942204829497025nana-1-
NC_000017.11:g.(?_31095030)_(31374155_?)del4763NF1Pathogenic-1RCV001032974; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942204829701173nana-1-
NC_000017.11:g.(?_31095030)_(31374155_?)dup4763NF1Uncertain significance-1RCV001033833; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942204829701173nana-1-
NM_001042492.3(NF1):c.-265G>C4763NF1Uncertain significance-1RCV001127457|RCV001127458|RCV001127459|RCV001127460; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0008672,MedGen:C0553586,OMIM:193520, Orphanet:3444|MONDO:MONDO:0011035,MedGen:C2931482,OMIM:601321, Orphanet:638|MONDO:MONDO:0008078,MedGen:C1834235,OMIM:162210, Orphanet:636172942206329422063GC17:g.29422063G>C-
NM_000267.3(NF1):c.-249_-247dup4763NF1Uncertain significancers886052786RCV000264687|RCV000299818|RCV000303704|RCV000357030; NMONDO:MONDO:0011035,MedGen:C2931482,OMIM:601321, Orphanet:638|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0008672,MedGen:C0553586,OMIM:193520, Orphanet:3444|MONDO:MONDO:0008078,MedGen:C1834235,OMIM:162210, Orphanet:636172942207629422077GGCCC17:g.29422076_29422077insCCCClinGen:CA10648981
NM_000267.3(NF1):c.-248_-247dup4763NF1Uncertain significancers886052786RCV000315238|RCV000335095|RCV000395738|RCV000398889; NMONDO:MONDO:0008078,MedGen:C1834235,OMIM:162210, Orphanet:636|MONDO:MONDO:0008672,MedGen:C0553586,OMIM:193520, Orphanet:3444|MONDO:MONDO:0011035,MedGen:C2931482,OMIM:601321, Orphanet:638|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942207629422077GGCC17:g.29422076_29422077insCCClinGen:CA10648982
NM_001042492.3(NF1):c.-251C>T4763NF1Uncertain significance-1RCV001127461|RCV001127462|RCV001127463|RCV001127464; NMONDO:MONDO:0008672,MedGen:C0553586,OMIM:193520, Orphanet:3444|MONDO:MONDO:0011035,MedGen:C2931482,OMIM:601321, Orphanet:638|MONDO:MONDO:0008078,MedGen:C1834235,OMIM:162210, Orphanet:636|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942207729422077CT17:g.29422077C>T-
NM_000267.3(NF1):c.-242dup4763NF1Uncertain significancers886052787RCV000268349|RCV000325830|RCV000360755|RCV000382934; NMONDO:MONDO:0011035,MedGen:C2931482,OMIM:601321, Orphanet:638|MONDO:MONDO:0008078,MedGen:C1834235,OMIM:162210, Orphanet:636|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0008672,MedGen:C0553586,OMIM:193520, Orphanet:3444172942208229422083TTC17:g.29422082_29422083insCClinGen:CA10648987
NM_000267.3(NF1):c.-237dup4763NF1Uncertain significancers886052788RCV000272038|RCV000293305|RCV000329548|RCV000386384; NMONDO:MONDO:0011035,MedGen:C2931482,OMIM:601321, Orphanet:638|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0008672,MedGen:C0553586,OMIM:193520, Orphanet:3444|MONDO:MONDO:0008078,MedGen:C1834235,OMIM:162210, Orphanet:636172942208729422088TTC17:g.29422087_29422088insCClinGen:CA10645291
NM_000267.3(NF1):c.-237C>T4763NF1Uncertain significancers878967255RCV000279083|RCV000331963|RCV000336447|RCV000388888; NMONDO:MONDO:0011035,MedGen:C2931482,OMIM:601321, Orphanet:638|MONDO:MONDO:0008672,MedGen:C0553586,OMIM:193520, Orphanet:3444|MONDO:MONDO:0008078,MedGen:C1834235,OMIM:162210, Orphanet:636|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942209129422091CT17:g.29422091C>TClinGen:CA10649829
NM_000267.3(NF1):c.-229C>G4763NF1Uncertain significancers886052789RCV000282465|RCV000339843|RCV000390462|RCV000396386; NMONDO:MONDO:0008672,MedGen:C0553586,OMIM:193520, Orphanet:3444|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0011035,MedGen:C2931482,OMIM:601321, Orphanet:638|MONDO:MONDO:0008078,MedGen:C1834235,OMIM:162210, Orphanet:636172942209929422099CG17:g.29422099C>GClinGen:CA10649830
NM_000267.3(NF1):c.-209C>A4763NF1Uncertain significancers886052790RCV000304624|RCV000307988|RCV000361774|RCV000390221; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0008672,MedGen:C0553586,OMIM:193520, Orphanet:3444|MONDO:MONDO:0008078,MedGen:C1834235,OMIM:162210, Orphanet:636|MONDO:MONDO:0011035,MedGen:C2931482,OMIM:601321, Orphanet:638172942211929422119CA17:g.29422119C>AClinGen:CA10649831
NM_000267.3(NF1):c.-173C>G4763NF1Uncertain significancers886052791RCV000272961|RCV000330328|RCV000365046|RCV000369523; NMONDO:MONDO:0011035,MedGen:C2931482,OMIM:601321, Orphanet:638|MONDO:MONDO:0008672,MedGen:C0553586,OMIM:193520, Orphanet:3444|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0008078,MedGen:C1834235,OMIM:162210, Orphanet:636172942215529422155CG17:g.29422155C>GClinGen:CA10648989
NM_001042492.3(NF1):c.-166T>C4763NF1Uncertain significance-1RCV001125461|RCV001125462|RCV001125463|RCV001125464; NMONDO:MONDO:0011035,MedGen:C2931482,OMIM:601321, Orphanet:638|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0008672,MedGen:C0553586,OMIM:193520, Orphanet:3444|MONDO:MONDO:0008078,MedGen:C1834235,OMIM:162210, Orphanet:636172942216229422162TC17:g.29422162T>C-
NM_000267.3(NF1):c.-148C>A4763NF1Uncertain significancers886052792RCV000277292|RCV000280867|RCV000315896|RCV000372887; NMONDO:MONDO:0008672,MedGen:C0553586,OMIM:193520, Orphanet:3444|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0011035,MedGen:C2931482,OMIM:601321, Orphanet:638|MONDO:MONDO:0008078,MedGen:C1834235,OMIM:162210, Orphanet:636172942218029422180CA17:g.29422180C>AClinGen:CA10639319
NM_000267.3(NF1):c.-115T>C4763NF1Uncertain significancers886052793RCV000284478|RCV000319511|RCV000341266|RCV000376586; NMONDO:MONDO:0011035,MedGen:C2931482,OMIM:601321, Orphanet:638|MONDO:MONDO:0008672,MedGen:C0553586,OMIM:193520, Orphanet:3444|MONDO:MONDO:0008078,MedGen:C1834235,OMIM:162210, Orphanet:636|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942221329422213TC17:g.29422213T>CClinGen:CA10648991
NM_000267.3(NF1):c.-84C>T4763NF1Uncertain significancers886052794RCV000287940|RCV000345195|RCV000394473|RCV000394483; NMONDO:MONDO:0011035,MedGen:C2931482,OMIM:601321, Orphanet:638|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0008078,MedGen:C1834235,OMIM:162210, Orphanet:636|MONDO:MONDO:0008672,MedGen:C0553586,OMIM:193520, Orphanet:3444172942224429422244CT17:g.29422244C>TClinGen:CA10639320
NM_000267.3(NF1):c.-73G>T4763NF1Uncertain significancers886052795RCV000310148|RCV000314011|RCV000367042|RCV000400423; NMONDO:MONDO:0008078,MedGen:C1834235,OMIM:162210, Orphanet:636|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0011035,MedGen:C2931482,OMIM:601321, Orphanet:638|MONDO:MONDO:0008672,MedGen:C0553586,OMIM:193520, Orphanet:3444172942225529422255GT17:g.29422255G>TClinGen:CA10649832
NM_001042492.3(NF1):c.-51C>T4763NF1Uncertain significance-1RCV001123463|RCV001123464|RCV001123465|RCV001123466; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0008672,MedGen:C0553586,OMIM:193520, Orphanet:3444|MONDO:MONDO:0011035,MedGen:C2931482,OMIM:601321, Orphanet:638|MONDO:MONDO:0008078,MedGen:C1834235,OMIM:162210, Orphanet:636172942227729422277CT17:g.29422277C>T-
NM_001042492.2(NF1):c.(?_-50)_(*68_?)del4763NF1Pathogenic-1RCV000603014; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942227829701241nana-
NM_000267.3(NF1):c.-22G>C4763NF1Benign/Likely benignrs556823296RCV000243575|RCV000260028|RCV000317626|RCV000355798|RCV000370935|RCV000680348; NMedGen:CN169374|MONDO:MONDO:0008078,MedGen:C1834235,OMIM:162210, Orphanet:636|MONDO:MONDO:0011035,MedGen:C2931482,OMIM:601321, Orphanet:638|MONDO:MONDO:0008672,MedGen:C0553586,OMIM:193520, Orphanet:3444|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200,Orpha172942230629422306GC17:g.29422306G>CClinGen:CA8485435C0553586 193520 Café-au-lait macules with pulmonary stenosis;
NC_000017.10:g.(?_29422308)_(29701193_?)del4763NF1Pathogenic-1RCV000541674; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942230829701193nana-C0027831 162200 Neurofibromatosis, type 1;
NC_000017.11:g.(?_31095290)_(31095389_?)del4763NF1Pathogenic-1RCV001031662; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942230829422407nana-1-
NC_000017.11:g.(?_31095290)_(31183409_?)del4763NF1Pathogenic-1RCV001031978; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942230829510427nana-1-
NC_000017.11:g.(?_31095300)_(31374165_?)del4763NF1Pathogenic-1RCV000707883; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942231829701183nana-
NC_000017.10:g.(?_29422318)_(29422397_?)dup4763NF1Uncertain significance-1RCV000708044; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942231829422397nana-C0027831 162200 Neurofibromatosis, type 1;
NC_000017.10:g.(?_29422318)_(29701183_?)dup4763NF1Uncertain significance-1RCV000707937; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942231829701183nana-
NC_000017.11:g.(?_31095300)_(31095379_?)del4763NF1Pathogenic-1RCV000708115; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942231829422397nana-
NC_000017.11:g.(?_31095300)_(31265349_?)dup4763NF1Uncertain significance-1RCV001031092; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942231829592367nana-1-
NM_000267.3(NF1):c.-8G>A4763NF1Uncertain significancers864622331RCV000204785; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942232029422320GA17:g.29422320G>AClinGen:CA348981C0027831 162200 Neurofibromatosis, type 1;
NC_000017.11:g.(?_31095304)_(31156132_?)del4763NF1Pathogenic-1RCV000554138; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942232229483150nana-
NC_000017.10:g.(?_29422322)_(29497021_?)dup4763NF1Uncertain significance-1RCV000526161; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942232229497021nana-C0027831 162200 Neurofibromatosis, type 1;
NC_000017.10:g.(?_29422322)_(29592363_?)dup4763NF1Uncertain significance-1RCV000538724; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942232229592363nana-C0027831 162200 Neurofibromatosis, type 1;
NC_000017.10:g.(?_29422322)_(29701179_?)dup4763NF1Uncertain significance-1RCV000632630; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942232229701179nana-
NC_000017.11:g.(?_31095304)_(31374161_?)del4763NF1Pathogenic-1RCV001032723; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942232229701179nana-1-
NM_000267.3(NF1):c.1A>G (p.Met1Val)4763NF1Pathogenicrs1060500252RCV000476863; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942232829422328AG17:g.29422328A>GClinGen:CA16615129
NM_001042492.3(NF1):c.1A>C (p.Met1Leu)4763NF1Likely pathogenic-1RCV001172240; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942232829422328AC17:g.29422328A>C-
NM_000267.3(NF1):c.2T>A (p.Met1Lys)4763NF1Likely pathogenicrs886041346RCV000659954|RCV001090740; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202172942232929422329TA17:g.29422329T>A-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.3G>A (p.Met1Ile)4763NF1Likely pathogenicrs1598173737RCV000802449; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942233029422330GA17:g.29422330G>A-
NM_000267.3(NF1):c.4_5delinsTT (p.Ala2Phe)4763NF1Uncertain significancers1555594471RCV000561384|RCV000632482; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942233129422332GCTTNC_000017.10:g.29422331_29422332delinsTTClinGen:CA658658569
NM_000267.3(NF1):c.7G>A (p.Ala3Thr)4763NF1Uncertain significancers1598173770RCV000815492; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942233429422334GA17:g.29422334G>A-
NM_001042492.3(NF1):c.8C>T (p.Ala3Val)4763NF1Uncertain significance-1RCV001223014; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942233529422335CT17:g.29422335C>T-
NM_001042492.3(NF1):c.10C>A (p.His4Asn)4763NF1Uncertain significance-1RCV001056212; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942233729422337CA17:g.29422337C>A-
NM_000267.3(NF1):c.15del (p.Arg5fs)4763NF1Likely pathogenicrs1057516197RCV000408872; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942234129422341AGA17:g.29422341_29422341delClinGen:CA10654925C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.15G>T (p.Arg5Ser)4763NF1Uncertain significancers1567786804RCV000701041; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942234229422342GT17:g.29422342G>T-
NM_000267.3(NF1):c.17C>T (p.Pro6Leu)4763NF1Uncertain significancers864622210RCV000206070|RCV000564343; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172942234429422344CT17:g.29422344C>TClinGen:CA350124C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.19G>A (p.Val7Met)4763NF1Uncertain significance-1RCV001051473; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942234629422346GA17:g.29422346G>A-
NM_000267.3(NF1):c.26G>A (p.Trp9Ter)4763NF1Pathogenicrs1567786829RCV000687206; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942235329422353GA17:g.29422353G>A-
NM_001042492.3(NF1):c.30C>G (p.Val10=)4763NF1Likely benignrs1033348008RCV000937360|RCV001018615; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172942235729422357CG17:g.29422357C>G-
NM_000267.3(NF1):c.31C>T (p.Gln11Ter)4763NF1Pathogenic/Likely pathogenicrs876658658RCV000216917|RCV000222237|RCV001046361; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942235829422358CT17:g.29422358C>TClinGen:CA10577556C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.35C>T (p.Ala12Val)4763NF1Uncertain significance-1RCV001203831; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942236229422362CT17:g.29422362C>T-
NM_000267.3(NF1):c.36C>T (p.Ala12=)4763NF1Likely benignrs786203866RCV000167359|RCV000538619; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942236329422363CT17:g.29422363C>TClinGen:CA198098C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.36C>A (p.Ala12=)4763NF1Likely benignrs786203866RCV000632557; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942236329422363CA17:g.29422363C>AClinGen:CA499197511
NM_000267.3(NF1):c.37G>A (p.Val13Met)4763NF1Uncertain significancers1060500261RCV000461213; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942236429422364GA17:g.29422364G>AClinGen:CA16615401
NM_001042492.3(NF1):c.38T>C (p.Val13Ala)4763NF1Uncertain significance-1RCV001036626; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942236529422365TC17:g.29422365T>C-
NM_000267.3(NF1):c.44G>A (p.Ser15Asn)4763NF1Uncertain significancers1598173852RCV000815984|RCV001022592; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172942237129422371GA17:g.29422371G>A-
NM_000267.3(NF1):c.46C>T (p.Arg16Cys)4763NF1Uncertain significancers1057520334RCV000435513|RCV000632423|RCV001022923; NMedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172942237329422373CT17:g.29422373C>TClinGen:CA16607554C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.47G>C (p.Arg16Pro)4763NF1Uncertain significancers1555594493RCV000573755|RCV001212851; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942237429422374GC17:g.29422374G>CClinGen:CA398979374
NM_000267.3(NF1):c.48C>T (p.Arg16=)4763NF1Likely benignrs1315327163RCV000545551; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942237529422375CT17:g.29422375C>TClinGen:CA499197522C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.51C>G (p.Phe17Leu)4763NF1Uncertain significancers1369290988RCV000806661; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942237829422378CG17:g.29422378C>G-
NM_000267.3(NF1):c.55G>T (p.Glu19Ter)4763NF1Pathogenicrs786203307RCV000166554|RCV000554192; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942238229422382GT17:g.29422382G>TClinGen:CA196174C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.55G>A (p.Glu19Lys)4763NF1Uncertain significancers786203307RCV000706302; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942238229422382GA17:g.29422382G>A-
NM_001042492.3(NF1):c.56AGC[3] (p.Gln20dup)4763NF1Uncertain significance-1RCV001208430; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942238229422383GGAGC17:g.29422382_29422383insAGC-
NM_000267.3(NF1):c.58C>T (p.Gln20Ter)4763NF1Pathogenicrs1567786905RCV000698970; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942238529422385CT17:g.29422385C>T-C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.58C>G (p.Gln20Glu)4763NF1Uncertain significance-1RCV001227828; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942238529422385CG17:g.29422385C>G-
NM_000267.3(NF1):c.59A>C (p.Gln20Pro)4763NF1Uncertain significancers1598173901RCV000806247; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942238629422386AC17:g.29422386A>C-
NM_001042492.3(NF1):c.60G>C (p.Gln20His)4763NF1Uncertain significance-1RCV001240243; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942238729422387GC17:g.29422387G>C-
NM_000267.3(NF1):c.60+1G>T4763NF1Likely pathogenicrs1555594500RCV000632399; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942238829422388GT17:g.29422388G>TClinGen:CA398979449
NM_000267.3(NF1):c.60+1G>C4763NF1Likely pathogenicrs1555594500RCV000821031; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942238829422388GC17:g.29422388G>C-
NM_000267.3(NF1):c.60+2del4763NF1Likely pathogenicrs1131691101RCV000492476|RCV000659955; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942238929422389GTG17:g.29422389_29422389delClinGen:CA645369716C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.60+3A>T4763NF1Uncertain significancers1598173910RCV000794316; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942239029422390AT17:g.29422390A>T-
NM_001042492.3(NF1):c.60+4A>G4763NF1Uncertain significance-1RCV001216495; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942239129422391AG17:g.29422391A>G-
NM_000267.3(NF1):c.60+5C>G4763NF1Conflicting interpretations of pathogenicityrs879413062RCV000529610|RCV000564633; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172942239229422392CG17:g.29422392C>GClinGen:CA289314775C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.60+7G>C4763NF1Likely benignrs1060503895RCV000461025; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172942239429422394GC17:g.29422394G>CClinGen:CA16615403
NM_000267.3(NF1):c.61-16315_479+99del4763NF1Pathogenic-1RCV000200885; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172946668629490493nana-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.61-12088_204+933del4763NF1Pathogenic-1RCV000200940; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172947091329484077nana-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.61-6522_204+1022dup4763NF1Pathogenic-1RCV000200951; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172947647929484166nana-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.61-5189_205-1285del4763NF1Pathogenic-1RCV000200900; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172947781229484743nanaClinGen:CA277558C0027831 162200 Neurofibromatosis, type 1;
NC_000017.11:g.(?_31155963)_(31374175_?)del4763NF1Pathogenic-1RCV000802577; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948298129701193nana-
NM_001042492.3(NF1):c.61-4del4763NF1Benign/Likely benignrs551568608RCV000263544|RCV000267272|RCV000321032|RCV000377934|RCV000506771|RCV000589681; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0011035,MedGen:C2931482,OMIM:601321, Orphanet:638|MONDO:MONDO:0008672,MedGen:C0553586,OMIM:193520, Orphanet:3444|MONDO:MONDO:0008078,MedGen:C1834235,OMIM:162210, Orphanet:636|MedGen:C172948298929482989CTC17:g.29482989_29482989delClinGen:CA8485464
NM_001042492.3(NF1):c.61-11_61-2del4763NF1Pathogenic-1RCV001261004; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948299029482999TTTTTTTTTCAT17:g.29482990_29482999del-
NC_000017.11:g.(?_31155973)_(31156136_?)del4763NF1Pathogenic-1RCV001033732; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948299129483154nana-1-
NC_000017.11:g.(?_31155973)_(31265349_?)dup4763NF1Pathogenic-1RCV001032382; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948299129592367nana-1-
NC_000017.11:g.(?_31155973)_(31297359_?)dup4763NF1Pathogenic-1RCV001033484; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948299129624377nana-1-
NM_000267.3(NF1):c.61-9T>C4763NF1Likely benignrs780956522RCV000550804; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948299229482992TC17:g.29482992T>CClinGen:CA8485468C0027831 162200 Neurofibromatosis, type 1;
NC_000017.11:g.(?_31155977)_(31374161_?)del4763NF1Pathogenic-1RCV000555597; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948299529701179nana-C0027831 162200 Neurofibromatosis, type 1;
NC_000017.11:g.(?_31155977)_(31163382_?)del4763NF1Pathogenic-1RCV000707919; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948299529490400nana-
NM_000267.3(NF1):c.61-2A>T4763NF1Conflicting interpretations of pathogenicityrs1131691100RCV000492668|RCV000989775; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948299929482999AT17:g.29482999A>TClinGen:CA398987996C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.61-2A>G4763NF1Pathogenic/Likely pathogenicrs1131691100RCV000557706|RCV000574076; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172948299929482999AG17:g.29482999A>GClinGen:CA398987994
NM_001042492.3(NF1):c.61-1G>T4763NF1Likely benignrs1263745475RCV000989776; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948300029483000GT17:g.29483000G>T-
NM_001042492.3(NF1):c.61-1G>A4763NF1Pathogenic-1RCV001213358; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948300029483000GA17:g.29483000G>A-
NM_000267.3(NF1):c.62T>C (p.Leu21Pro)4763NF1Uncertain significancers1567814403RCV000700381; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948300229483002TC17:g.29483002T>C-C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.64C>T (p.Pro22Ser)4763NF1Likely benignrs1597625794RCV000989777; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948300429483004CT17:g.29483004C>T-
NM_001042492.3(NF1):c.64C>G (p.Pro22Ala)4763NF1Uncertain significance-1RCV001038649; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948300429483004CG17:g.29483004C>G-
NM_001042492.3(NF1):c.65C>T (p.Pro22Leu)4763NF1Uncertain significance-1RCV001230396; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948300529483005CT17:g.29483005C>T-
NM_000267.3(NF1):c.67A>G (p.Ile23Val)4763NF1Uncertain significancers542824372RCV000460803|RCV000566536; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172948300729483007AG17:g.29483007A>GClinGen:CA8485473
NM_000267.3(NF1):c.68del (p.Ile23fs)4763NF1Likely pathogenicrs1057518884RCV000414793; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948300829483008ATA17:g.29483008_29483008delClinGen:CA16043520
NM_000267.3(NF1):c.74C>T (p.Thr25Ile)4763NF1Uncertain significancers1555604874RCV000573262|RCV001067528; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948301429483014CT17:g.29483014C>TClinGen:CA398988104
NM_001042492.3(NF1):c.74C>G (p.Thr25Arg)4763NF1Uncertain significance-1RCV001049539; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948301429483014CG17:g.29483014C>G-
NM_000267.3(NF1):c.75A>C (p.Thr25=)4763NF1Likely benignrs768754175RCV000531527; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948301529483015AC17:g.29483015A>CClinGen:CA499232487C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.78A>T (p.Gly26=)4763NF1Conflicting interpretations of pathogenicityrs748018099RCV000806526|RCV001026927; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172948301829483018AT17:g.29483018A>T-
NM_000267.3(NF1):c.79C>T (p.Gln27Ter)4763NF1Pathogenic/Likely pathogenicrs1060500363RCV000469252|RCV000585221; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202172948301929483019CT17:g.29483019C>TClinGen:CA16615539
NM_001042492.3(NF1):c.81G>A (p.Gln27=)4763NF1Likely benignrs1597625846RCV000937039; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948302129483021GA17:g.29483021G>A-
NM_000267.3(NF1):c.83A>C (p.Gln28Pro)4763NF1Uncertain significancers587782686RCV000132116|RCV000203778|RCV000782209; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202172948302329483023AC17:g.29483023A>CClinGen:CA169288
NM_001042492.2(NF1):c.87_88CA[2] (p.His31fs)4763NF1Pathogenicrs1567814432RCV000690348; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948302629483027AACA17:g.29483026_29483027del-
NM_000267.3(NF1):c.87C>T (p.Asn29=)4763NF1Likely benignrs1060503914RCV000459541|RCV000564539; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172948302729483027CT17:g.29483027C>TClinGen:CA16615405
NM_000267.3(NF1):c.88A>C (p.Thr30Pro)4763NF1Uncertain significancers1555604881RCV000550449|RCV000574741; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172948302829483028AC17:g.29483028A>CClinGen:CA398988172C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.91C>T (p.His31Tyr)4763NF1Uncertain significancers786202864RCV000165908|RCV001060079; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948303129483031CT17:g.29483031C>TClinGen:CA194500C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.91C>G (p.His31Asp)4763NF1Uncertain significance-1RCV001046801; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948303129483031CG17:g.29483031C>G-
NM_001042492.3(NF1):c.95C>A (p.Thr32Asn)4763NF1Uncertain significance-1RCV001220165; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948303529483035CA17:g.29483035C>A-
NM_000267.3(NF1):c.96C>G (p.Thr32=)4763NF1Likely benignrs1555604886RCV000632604; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948303629483036CG17:g.29483036C>GClinGen:CA499232511
NM_000267.3(NF1):c.99del (p.Val34fs)4763NF1Pathogenicrs1060500320RCV000464003; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948303729483037CAC17:g.29483037_29483037delClinGen:CA16615134
NM_000267.3(NF1):c.97A>G (p.Lys33Glu)4763NF1Uncertain significancers1060500324RCV000457940; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948303729483037AG17:g.29483037A>GClinGen:CA16615540
NM_000267.3(NF1):c.97A>T (p.Lys33Ter)4763NF1Pathogenicrs1060500324RCV000824622; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948303729483037AT17:g.29483037A>T-
NM_000267.3(NF1):c.98A>G (p.Lys33Arg)4763NF1Uncertain significancers1555604887RCV000540766|RCV001019871; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172948303829483038AG17:g.29483038A>GClinGen:CA398988215
NM_000267.3(NF1):c.99A>G (p.Lys33=)4763NF1Uncertain significancers786203280RCV000166515|RCV000632386; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948303929483039AG17:g.29483039A>GClinGen:CA196070C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.100G>A (p.Val34Ile)4763NF1Uncertain significancers772995929RCV000165635|RCV000534740; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948304029483040GA17:g.29483040G>AClinGen:CA193875C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.102C>T (p.Val34=)4763NF1Likely benignrs760823948RCV000632624|RCV001009747; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172948304229483042CT17:g.29483042C>TClinGen:CA8485478C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.104G>A (p.Ser35Asn)4763NF1Uncertain significancers1060500282RCV000468077; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948304429483044GA17:g.29483044G>AClinGen:CA16615406
NM_000267.3(NF1):c.105T>C (p.Ser35=)4763NF1Likely benignrs370026303RCV000533788|RCV000565368; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172948304529483045TC17:g.29483045T>CClinGen:CA8485479C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.107C>G (p.Thr36Ser)4763NF1Conflicting interpretations of pathogenicityrs199966218RCV000129384|RCV000196537|RCV000680810; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202172948304729483047CG17:g.29483047C>GClinGen:CA164315C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.107C>T (p.Thr36Ile)4763NF1Uncertain significancers199966218RCV000571392|RCV001204266; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948304729483047CT17:g.29483047C>TClinGen:CA398988272
NM_000267.3(NF1):c.111G>A (p.Glu37=)4763NF1Likely benignrs1555604893RCV000632568; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948305129483051GA17:g.29483051G>AClinGen:CA499232524
NM_000267.3(NF1):c.116A>T (p.Asn39Ile)4763NF1Uncertain significancers1567814494RCV000704741; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948305629483056AT17:g.29483056A>T-C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.120G>C (p.Lys40Asn)4763NF1Uncertain significance-1RCV001214830; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948306029483060GC17:g.29483060G>C-
NM_000267.3(NF1):c.122A>C (p.Glu41Ala)4763NF1Uncertain significancers786203038RCV000166171|RCV000632311; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948306229483062AC17:g.29483062A>CClinGen:CA195162C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.122A>T (p.Glu41Val)4763NF1Likely pathogenic-1RCV000766133; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948306229483062AT17:g.29483062A>T-
NM_000267.3(NF1):c.125_126dup (p.Leu43fs)4763NF1Pathogenicrs1555604897RCV000583005; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948306329483064AATG17:g.29483063_29483064insTGClinGen:CA658684018
NM_000267.3(NF1):c.127C>T (p.Leu43=)4763NF1Likely benignrs1060503913RCV000473463|RCV001010718; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172948306729483067CT17:g.29483067C>TClinGen:CA16615135
NM_000267.3(NF1):c.128T>C (p.Leu43Pro)4763NF1Conflicting interpretations of pathogenicityrs1555604899RCV000542948|RCV000681046|RCV001010781; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172948306829483068TC17:g.29483068T>CClinGen:CA398988394C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.129_131del (p.Ile44del)4763NF1Uncertain significancers1597625973RCV000819188; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948306829483070CTAAC17:g.29483068_29483070del-
NM_000267.3(NF1):c.129A>C (p.Leu43=)4763NF1Likely benignrs759576680RCV000200434|RCV000222562; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172948306929483069AC17:g.29483069A>CClinGen:CA339311
NM_000267.3(NF1):c.129_130ins568 (p.?)4763NF1Pathogenic-1RCV000240229; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948306929483070nana-
NM_000267.3(NF1):c.134A>G (p.Asn45Ser)4763NF1Uncertain significancers753189381RCV000217609|RCV000556849; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948307429483074AG17:g.29483074A>GClinGen:CA8485481C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.143A>C (p.Lys48Thr)4763NF1Uncertain significancers1555604902RCV000632405; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948308329483083AC17:g.29483083A>CClinGen:CA398988450
NM_000267.3(NF1):c.144A>G (p.Lys48=)4763NF1Uncertain significancers763375105RCV000540011; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948308429483084AG17:g.29483084A>GClinGen:CA8485482C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.145T>A (p.Tyr49Asn)4763NF1Uncertain significancers764367878RCV000469078|RCV000681013|RCV001011690; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172948308529483085TA17:g.29483085T>AClinGen:CA8485483
NM_001042492.3(NF1):c.147C>G (p.Tyr49Ter)4763NF1Pathogenic-1RCV001213478; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948308729483087CG17:g.29483087C>G-
NM_000267.3(NF1):c.153T>C (p.Phe51=)4763NF1Likely benignrs1057523892RCV000434253|RCV001089349; NMedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948309329483093TC17:g.29483093T>CClinGen:CA16607555C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.160G>T (p.Val54Phe)4763NF1Uncertain significancers1060500330RCV000469477; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948310029483100GT17:g.29483100G>TClinGen:CA16615542
NM_001042492.3(NF1):c.164T>A (p.Ile55Lys)4763NF1Uncertain significance-1RCV001238324; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948310429483104TA17:g.29483104T>A-
NM_001042492.3(NF1):c.166A>G (p.Ser56Gly)4763NF1Uncertain significance-1RCV001061261; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948310629483106AG17:g.29483106A>G-
NM_001042492.3(NF1):c.168C>T (p.Ser56=)4763NF1Benignrs17881168RCV000163256|RCV000205406|RCV000215995|RCV000289551|RCV000324800|RCV000381546|RCV000590494; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN169374|MONDO:MONDO:0008672,MedGen:C0553586,OMIM:193520, Orphanet:3444|MONDO:MONDO:0011035,MedGen:C2931482,OMIM:601321, Orphanet:638|M172948310829483108CT17:g.29483108C>TClinGen:CA187866C0553586 193520 Café-au-lait macules with pulmonary stenosis;
NM_000267.3(NF1):c.169G>A (p.Gly57Ser)4763NF1Uncertain significancers779727341RCV000234251|RCV000564586|RCV000765342|RCV000996514; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0011035,MedGen:C2931482,OMIM:601321, Orphanet:638; MONDO:MONDO:0008078,MedGen:C1834235,OMIM:162210, Orphanet:636; MONDO:MONDO:001897172948310929483109GA17:g.29483109G>AClinGen:CA8485485C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.169G>T (p.Gly57Cys)4763NF1Uncertain significance-1RCV001043074; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948310929483109GT17:g.29483109G>T-
NM_000267.3(NF1):c.170G>A (p.Gly57Asp)4763NF1Uncertain significancers1555604925RCV000536722; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948311029483110GA17:g.29483110G>AClinGen:CA398988616C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.171C>T (p.Gly57=)4763NF1Likely benignrs876658709RCV000217770|RCV000473793; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948311129483111CT17:g.29483111C>TClinGen:CA10580183C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.173T>C (p.Leu58Pro)4763NF1Uncertain significancers1597626094RCV000804180; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948311329483113TC17:g.29483113T>C-
NM_000267.3(NF1):c.175A>G (p.Thr59Ala)4763NF1Uncertain significancers1567814586RCV000702444; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948311529483115AG17:g.29483115A>G-
NM_000267.3(NF1):c.178A>G (p.Thr60Ala)4763NF1Uncertain significancers546729596RCV000526548|RCV000568238; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172948311829483118AG17:g.29483118A>GClinGen:CA8485486C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.179C>G (p.Thr60Ser)4763NF1Uncertain significancers1007047958RCV000574187|RCV000632464; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948311929483119CG17:g.29483119C>GClinGen:CA289348700
NM_000267.3(NF1):c.181dup (p.Ile61fs)4763NF1Pathogenicrs1555604935RCV000632454; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948312029483121TTA17:g.29483120_29483121insAClinGen:CA658798747C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.181A>G (p.Ile61Val)4763NF1Uncertain significancers754295034RCV000539139|RCV000572172; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172948312129483121AG17:g.29483121A>GClinGen:CA289348701C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.188del (p.Lys63fs)4763NF1Likely pathogenicrs1555604939RCV000659956; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948312629483126TAT17:g.29483126_29483126del-
NM_000267.3(NF1):c.200A>G (p.Asn67Ser)4763NF1Uncertain significancers375038808RCV000216551|RCV000659957; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948314029483140AG17:g.29483140A>GClinGen:CA8485487C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.203T>C (p.Met68Thr)4763NF1Uncertain significancers779063198RCV000535010; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948314329483143TC17:g.29483143T>CClinGen:CA8485488C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.204+1G>A4763NF1Pathogenicrs886039548RCV000256003|RCV000632494|RCV001000329; NMedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN169374172948314529483145GA17:g.29483145G>AClinGen:CA10588647C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.204+1G>T4763NF1Pathogenicrs886039548RCV000521162|RCV000606260|RCV001014186; NMedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172948314529483145GT17:g.29483145G>TClinGen:CA289348717C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.204+3_204+6del4763NF1Pathogenicrs1567814632RCV000702165; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948314529483148GGTGAG17:g.29483145_29483148del-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.204+2T>G4763NF1Likely pathogenicrs1597626161RCV000805761; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948314629483146TG17:g.29483146T>G-
NM_000267.3(NF1):c.204+4del4763NF1Uncertain significancers1597626163RCV000819632; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948314829483148GAG17:g.29483148_29483148del-
NM_000267.3(NF1):c.204+6T>G4763NF1Uncertain significancers1555604948RCV000547356; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948315029483150TG17:g.29483150T>GClinGen:CA658658575C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.204+9T>C4763NF1Likely benignrs771989896RCV000632535; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948315329483153TC17:g.29483153T>CClinGen:CA8485490
NM_000267.3(NF1):c.205-1284_289-944del4763NF1Pathogenic-1RCV000200888; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948474429489260nanaClinGen:CA277547C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.205-19T>A4763NF1Pathogenicrs1597629649RCV001007707; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948600929486009TA17:g.29486009T>A-
NM_000267.3(NF1):c.205-13T>A4763NF1Uncertain significancers886052797RCV000293266|RCV000350568|RCV000385151|RCV000398111; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0011035,MedGen:C2931482,OMIM:601321, Orphanet:638|MONDO:MONDO:0008672,MedGen:C0553586,OMIM:193520, Orphanet:3444|MONDO:MONDO:0008078,MedGen:C1834235,OMIM:162210, Orphanet:636172948601529486015TA17:g.29486015T>AClinGen:CA10639322
NM_001042492.3(NF1):c.205-11_205-6delinsGGAAAA4763NF1Uncertain significance-1RCV001240001; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948601729486022TTTTCTGGAAAANC_000017.10:g.29486017_29486022delinsGGAAAA-
NC_000017.11:g.(?_31159000)_(31182675_?)dup4763NF1Uncertain significance-1RCV001032781; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948601829509693nana-1-
NC_000017.10:g.(?_29486022)_(29533395_?)del4763NF1Pathogenic-1RCV000531776; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948602229533395nana-C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.205-6T>A4763NF1Pathogenicrs1243948503RCV001007736; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948602229486022TA17:g.29486022T>A-
NM_000267.3(NF1):c.206_207delGA4763NF1Pathogenicrs1060500321RCV000471149|RCV001268342; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202172948602629486027TAGT17:g.29486026_29486027delClinGen:CA16615130
NM_000267.3(NF1):c.205-2A>G4763NF1Pathogenicrs1597629679RCV000808377; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948602629486026AG17:g.29486026A>G-
NM_000267.3(NF1):c.205-1G>C4763NF1Pathogenicrs1555605362RCV000659958; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948602729486027GC17:g.29486027G>C-
NM_001042492.3(NF1):c.205-1G>A4763NF1Pathogenic-1RCV001056967; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948602729486027GA17:g.29486027G>A-
NM_000267.3(NF1):c.212T>C (p.Phe71Ser)4763NF1Uncertain significancers752396270RCV000167453|RCV000794104; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948603529486035TC17:g.29486035T>CClinGen:CA198351
NM_000267.3(NF1):c.219A>T (p.Glu73Asp)4763NF1Uncertain significancers1567816022RCV000690250; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948604229486042AT17:g.29486042A>T-
NM_000267.3(NF1):c.221_222dup (p.Ala75fs)4763NF1Pathogenicrs1597629724RCV000801778; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948604329486044GGCT17:g.29486043_29486044insCT-
NM_000267.3(NF1):c.223G>A (p.Ala75Thr)4763NF1Uncertain significancers1597629733RCV000799922; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948604629486046GA17:g.29486046G>A-
NM_001042492.3(NF1):c.224C>G (p.Ala75Gly)4763NF1Uncertain significance-1RCV001205486; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948604729486047CG17:g.29486047C>G-
NM_000267.3(NF1):c.233del (p.Asn78fs)4763NF1Pathogenicrs1438566555RCV000657240|RCV000820700; NMedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948605029486050GAG17:g.29486050_29486050del-
NM_000267.3(NF1):c.231A>T (p.Lys77Asn)4763NF1Uncertain significancers373563053RCV000129481|RCV000205241; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948605429486054AT17:g.29486054A>TClinGen:CA164511C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.232_234del (p.Asn78del)4763NF1Uncertain significancers1555605367RCV000527494|RCV001015180; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172948605529486057AAATA17:g.29486055_29486057delClinGen:CA658658576C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.234T>A (p.Asn78Lys)4763NF1Uncertain significancers876658354RCV000219194|RCV000227890; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948605729486057TA17:g.29486057T>AClinGen:CA10580185C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.235T>C (p.Leu79=)4763NF1Likely benignrs764855221RCV000216983|RCV000464568|RCV000614768; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN169374172948605829486058TC17:g.29486058T>CClinGen:CA8485505C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.235T>G (p.Leu79Val)4763NF1Uncertain significance-1RCV001229448; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948605829486058TG17:g.29486058T>G-
NM_000267.3(NF1):c.236T>G (p.Leu79Ter)4763NF1Pathogenicrs1597629765RCV000811523; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948605929486059TG17:g.29486059T>G-
NM_000267.3(NF1):c.237A>T (p.Leu79Phe)4763NF1Uncertain significancers752208826RCV000632487|RCV001015321; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172948606029486060AT17:g.29486060A>TClinGen:CA398989603
NM_000267.3(NF1):c.237A>G (p.Leu79=)4763NF1Likely benignrs752208826RCV000681160|RCV001015348|RCV001084771; NMedGen:CN517202|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948606029486060AG17:g.29486060A>GClinGen:CA8485506
NM_000267.3(NF1):c.239A>G (p.Tyr80Cys)4763NF1Uncertain significancers4795581RCV000165912|RCV000465537; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948606229486062AG17:g.29486062A>GClinGen:CA194515,UniProtKB:P21359#VAR_022254C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.239A>C (p.Tyr80Ser)4763NF1Uncertain significancers4795581RCV000553141|RCV000575886|RCV000613716; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MedGen:CN169374172948606229486062AC17:g.29486062A>CClinGen:CA289350615C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.244_247del4763NF1Pathogenicrs771115661RCV000567242|RCV000681036|RCV001223294; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948606329486066ATCTCA17:g.29486063_29486066delClinGen:CA658658577C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.246_247del4763NF1Pathogenicrs771115661RCV000632345; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948606329486064ATCA17:g.29486063_29486064delClinGen:CA8485507
NM_000267.3(NF1):c.241C>A (p.Leu81Ile)4763NF1Uncertain significancers587782772RCV000132301|RCV000198417; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948606429486064CA17:g.29486064C>AClinGen:CA169597C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.243_254delinsTGAGAGAGA (p.Ser82_Ile85delinsGluArgAsp)4763NF1Likely pathogenicrs1597629809RCV000820780; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948606629486077CTCTCAGTTGATTGAGAGAGA17:g.29486067_29486077del-
NM_000267.3(NF1):c.244T>C (p.Ser82Pro)4763NF1Uncertain significancers1597629813RCV000807903; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948606729486067TC17:g.29486067T>C-
NM_000267.3(NF1):c.245C>T (p.Ser82Phe)4763NF1Conflicting interpretations of pathogenicityrs199474729RCV000059172|RCV000659959; NMedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948606829486068CT17:g.29486068C>TClinGen:CA219465,UniProtKB:P21359#VAR_021730,UniProtKB/Swiss-Prot:VAR_021730C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.245C>A (p.Ser82Tyr)4763NF1Likely pathogenic-1RCV001237741; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948606829486068CA17:g.29486068C>A-
NM_000267.3(NF1):c.247C>T (p.Gln83Ter)4763NF1Pathogenicrs746824139RCV000796434; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948607029486070CT17:g.29486070C>T-
NM_000267.3(NF1):c.248A>G (p.Gln83Arg)4763NF1Uncertain significancers1060500360RCV000464951; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948607129486071AG17:g.29486071A>GClinGen:CA16615140
NM_000267.3(NF1):c.248A>C (p.Gln83Pro)4763NF1Pathogenicrs1060500360RCV000795319; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948607129486071AC17:g.29486071A>C-
NM_001042492.3(NF1):c.253_261del (p.Ile85_Leu87del)4763NF1Uncertain significance-1RCV001229777; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948607329486081GTTGATTATAG17:g.29486073_29486081del-
NM_000267.3(NF1):c.256A>G (p.Ile86Val)4763NF1Uncertain significancers757057811RCV000702860|RCV001015980; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172948607929486079AG17:g.29486079A>G-C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.261G>C (p.Leu87Phe)4763NF1Uncertain significance-1RCV001065320; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948608429486084GC17:g.29486084G>C-
NM_000267.3(NF1):c.264T>C (p.Asp88=)4763NF1Likely benignrs1359209770RCV000632556; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948608729486087TC17:g.29486087T>CClinGen:CA499232876
NM_000267.3(NF1):c.266C>A (p.Thr89Lys)4763NF1Uncertain significancers1555605392RCV000659960; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948608929486089CA17:g.29486089C>A-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.269T>G (p.Leu90Arg)4763NF1Uncertain significancers1555605393RCV000659961; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948609229486092TG17:g.29486092T>G-C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.269T>A (p.Leu90Gln)4763NF1Likely pathogenicrs1555605393RCV000989778; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948609229486092TA17:g.29486092T>A-
NM_001042492.3(NF1):c.269T>C (p.Leu90Pro)4763NF1Uncertain significance-1RCV001062713; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948609229486092TC17:g.29486092T>C-
NM_001042492.3(NF1):c.270G>A (p.Leu90=)4763NF1Uncertain significance-1RCV001125564|RCV001125565|RCV001125566|RCV001125567; NMONDO:MONDO:0008078,MedGen:C1834235,OMIM:162210, Orphanet:636|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0011035,MedGen:C2931482,OMIM:601321, Orphanet:638|MONDO:MONDO:0008672,MedGen:C0553586,OMIM:193520, Orphanet:3444172948609329486093GA17:g.29486093G>A-
NM_000267.3(NF1):c.274A>G (p.Lys92Glu)4763NF1Uncertain significancers1555605396RCV000575639|RCV000704437; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948609729486097AG17:g.29486097A>GClinGen:CA398989810
NM_001042492.3(NF1):c.275A>G (p.Lys92Arg)4763NF1Uncertain significance-1RCV001044094; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948609829486098AG17:g.29486098A>G-
NM_000267.3(NF1):c.276A>T (p.Lys92Asn)4763NF1Uncertain significancers1060503900RCV000697292; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948609929486099AT17:g.29486099A>T-
NM_000267.3(NF1):c.278G>A (p.Cys93Tyr)4763NF1Conflicting interpretations of pathogenicityrs199474728RCV000059180|RCV000466535; NMedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948610129486101GA17:g.29486101G>AClinGen:CA219494,UniProtKB:P21359#VAR_017551,UniProtKB/Swiss-Prot:VAR_017551C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.279T>A (p.Cys93Ter)4763NF1Pathogenicrs1597629882RCV000810499; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948610229486102TA17:g.29486102T>A-
NM_001042492.3(NF1):c.279T>G (p.Cys93Trp)4763NF1Likely pathogenic-1RCV001197025; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948610229486102TG17:g.29486102T>G-
NM_000267.3(NF1):c.282del (p.Ala95fs)4763NF1Pathogenicrs1555605404RCV000584701; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948610429486104CTC17:g.29486104_29486104delClinGen:CA658684020
NM_000267.3(NF1):c.284C>T (p.Ala95Val)4763NF1Uncertain significancers1567816119RCV000689760; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948610729486107CT17:g.29486107C>T-C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.284C>G (p.Ala95Gly)4763NF1Uncertain significancers1567816119RCV001016784|RCV001059584; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948610729486107CG17:g.29486107C>G-
NM_000267.3(NF1):c.288+1del4763NF1Pathogenicrs1057519370RCV000472465; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948610929486109TGT17:g.29486109_29486109delClinGen:CA16044136
NM_001042492.3(NF1):c.288G>T (p.Gly96=)4763NF1Likely pathogenic-1RCV001040432; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948611129486111GT17:g.29486111G>T-
NM_000267.3(NF1):c.288+1G>T4763NF1Pathogenicrs1567816131RCV000692271; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948611229486112GT17:g.29486112G>T-
NM_000267.3(NF1):c.288+1G>C4763NF1Pathogenicrs1567816131RCV000796292; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948611229486112GC17:g.29486112G>C-
NM_001042492.3(NF1):c.288+1G>A4763NF1Pathogenic-1RCV001070848; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948611229486112GA17:g.29486112G>A-
NM_000267.3(NF1):c.288+2T>A4763NF1Pathogenicrs1555605406RCV000632491; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948611329486113TA17:g.29486113T>AClinGen:CA398989911
NM_000267.3(NF1):c.288+2T>C4763NF1Pathogenicrs1555605406RCV000704779; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948611329486113TC17:g.29486113T>C-
NM_001042492.3(NF1):c.288+3A>T4763NF1Uncertain significance-1RCV001212410; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948611429486114AT17:g.29486114A>T-
NM_000267.3(NF1):c.288+4A>G4763NF1Uncertain significancers781459468RCV000474467; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948611529486115AG17:g.29486115A>GClinGen:CA16615554
NM_000267.3(NF1):c.288+5G>T4763NF1Pathogenicrs1555605409RCV000547442; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948611629486116GT17:g.29486116G>TClinGen:CA658658578
NM_000267.3(NF1):c.288+5G>A4763NF1Pathogenic/Likely pathogenicrs1555605409RCV000796289; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948611629486116GA17:g.29486116G>A-
NM_000267.3(NF1):c.288+230_480-1812delins3234763NF1Pathogenic-1RCV000200945; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948634129495097nana-C0027831 162200 Neurofibromatosis, type 1;
NC_000017.11:g.(?_31160230)_(31163386_?)del4763NF1Pathogenic-1RCV001033342; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948724829490404nana-1-
NM_000267.3(NF1):c.289-1237_586+3325del4763NF1Pathogenic-1RCV000200949; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948896729500340nana-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.289-1171_888+1963dup4763NF1Pathogenic-1RCV000200895; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948903329511646nana-
NM_000267.3(NF1):c.289-956_586+4999del4763NF1Pathogenic-1RCV000200891; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948924829502014nana-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.289-950_586+3043del4763NF1Pathogenic-1RCV000200920; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172948925429500058nana-
NM_000267.3(NF1):c.289-6T>C4763NF1Uncertain significancers757074803RCV000470904; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949019829490198TC17:g.29490198T>CClinGen:CA8485527
NM_001042492.3(NF1):c.289-6T>G4763NF1Pathogenic-1RCV001093648; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949019829490198TG17:g.29490198T>G-
NM_001042492.3(NF1):c.289-4T>G4763NF1Conflicting interpretations of pathogenicityrs1258767746RCV000936453|RCV001016837; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172949020029490200TG17:g.29490200T>G-
NM_000267.3(NF1):c.289-3T>C4763NF1Uncertain significancers1461646186RCV000803347; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949020129490201TC17:g.29490201T>C-
NC_000017.11:g.(?_31163186)_(31163376_?)del4763NF1Pathogenic-1RCV000475627; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949020429490394nana-C0027831 162200 Neurofibromatosis, type 1;
NC_000017.11:g.(?_31163186)_(31169997_?)del4763NF1Pathogenic-1RCV000471692; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949020429497015nana-C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.289C>T (p.Gln97Ter)4763NF1Pathogenicrs1597635615RCV001009587; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636; Human Phenotype Ontology:HP:0009736,MedGen:C4024216172949020429490204CT17:g.29490204C>T-
NM_000267.3(NF1):c.297G>A (p.Lys99=)4763NF1Likely benignrs876658428RCV000220175|RCV000872781; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949021229490212GA17:g.29490212G>AClinGen:CA10580187C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.298del (p.Asp100fs)4763NF1Pathogenicrs1567817841RCV000699268; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949021229490212AGA17:g.29490212_29490212del-
NM_000267.3(NF1):c.304A>G (p.Met102Val)4763NF1Uncertain significancers756370324RCV000532623|RCV000565942|RCV000681271; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MedGen:CN517202172949021929490219AG17:g.29490219A>GClinGen:CA8485530C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.311_312del (p.Arg103_Leu104insTer)4763NF1Pathogenicrs1555606053RCV000632392; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949022629490227TTAT17:g.29490226_29490227delClinGen:CA658798755
NM_001042492.3(NF1):c.319A>G (p.Thr107Ala)4763NF1Uncertain significance-1RCV001245079; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949023429490234AG17:g.29490234A>G-
NM_000267.3(NF1):c.321G>A (p.Thr107=)4763NF1Benign/Likely benignrs786201731RCV000164171|RCV000555658; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949023629490236GA17:g.29490236G>AClinGen:CA190218C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.323T>C (p.Met108Thr)4763NF1Uncertain significancers780233935RCV000544444|RCV001019386; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172949023829490238TC17:g.29490238T>CClinGen:CA8485531C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.328del (p.Val110fs)4763NF1Pathogenicrs1567817865RCV000692777; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949024229490242TGT17:g.29490242_29490242del-
NM_000267.3(NF1):c.332_335del (p.Lys111fs)4763NF1Pathogenicrs1135402787RCV000497208; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949024529490248TCAAAT17:g.29490245_29490248delClinGen:CA645372606C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.333del (p.Lys111fs)4763NF1Pathogenicrs1597635722RCV000989779; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949024629490246CAC17:g.29490246_29490246del-
NM_000267.3(NF1):c.334C>T (p.Gln112Ter)4763NF1Pathogenicrs1555606061RCV000506647|RCV000814001; NMedGen:CN169374|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949024929490249CT17:g.29490249C>TClinGen:CA398981725
NM_001042492.3(NF1):c.338dup (p.Leu113fs)4763NF1Pathogenicrs1597635740RCV000793049|RCV001020168; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172949025129490252GGT17:g.29490251_29490252insT-
NM_001042492.3(NF1):c.338T>A (p.Leu113Ter)4763NF1Pathogenic-1RCV001063310; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949025329490253TA17:g.29490253T>A-
NM_000267.3(NF1):c.340C>T (p.Leu114=)4763NF1Benign/Likely benignrs7207410RCV000129656|RCV000198193|RCV000244766|RCV000311849|RCV000315541|RCV000398971|RCV000680345; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN169374|MONDO:MONDO:0008078,MedGen:C1834235,OMIM:162210, Orphanet:636|MONDO:MONDO:0008672,MedGen:C0553586,OMIM:193520, Orphanet:3444|M172949025529490255CT17:g.29490255C>TClinGen:CA164878C0553586 193520 Café-au-lait macules with pulmonary stenosis;
NM_001042492.3(NF1):c.349del (p.Ile117fs)4763NF1Pathogenic-1RCV001056262; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949026229490262GAG17:g.29490262_29490262del-
NM_000267.3(NF1):c.348A>T (p.Glu116Asp)4763NF1Uncertain significancers1231174547RCV000567494|RCV001070156; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949026329490263AT17:g.29490263A>TClinGen:CA398981757C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.348A>C (p.Glu116Asp)4763NF1Uncertain significance-1RCV001069279; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949026329490263AC17:g.29490263A>C-
NM_000267.3(NF1):c.349A>G (p.Ile117Val)4763NF1Uncertain significancers1597635759RCV000795498; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949026429490264AG17:g.29490264A>G-
NM_000267.3(NF1):c.354C>T (p.Cys118=)4763NF1Conflicting interpretations of pathogenicityrs768777585RCV000165034|RCV000681114|RCV001080592|RCV001127656|RCV001127657|RCV001127658|RCV001251350; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0008672,MedGen:C0553586,OMIM:193520, Orphanet:3444|MONDO:MONDO:0008078,MedGen:C1834235,OMIM:162210, Orphanet:636|M172949026929490269CT17:g.29490269C>TClinGen:CA192349C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.355C>T (p.His119Tyr)4763NF1Uncertain significancers1555606066RCV000570245|RCV001061457; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949027029490270CT17:g.29490270C>TClinGen:CA398981774C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.355C>A (p.His119Asn)4763NF1Uncertain significancers1555606066RCV000687764; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949027029490270CA17:g.29490270C>A-C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.360T>C (p.Phe120=)4763NF1Likely benignrs1597635781RCV000977764; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949027529490275TC17:g.29490275T>C-
NM_000267.3(NF1):c.364C>T (p.His122Tyr)4763NF1Uncertain significancers587782107RCV000130623|RCV001062580; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949027929490279CT17:g.29490279C>TClinGen:CA166772C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.366C>T (p.His122=)4763NF1Likely benignrs138952888RCV000222387|RCV000526048; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949028129490281CT17:g.29490281C>TClinGen:CA8485532C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.366C>G (p.His122Gln)4763NF1Uncertain significance-1RCV001056525; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949028129490281CG17:g.29490281C>G-
NM_000267.3(NF1):c.367A>G (p.Thr123Ala)4763NF1Uncertain significancers587781757RCV000129973|RCV000632509; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949028229490282AG17:g.29490282A>GClinGen:CA165455C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.368C>T (p.Thr123Ile)4763NF1Uncertain significancers878853886RCV000231497; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949028329490283CT17:g.29490283C>TClinGen:CA10583461C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.368C>A (p.Thr123Asn)4763NF1Uncertain significancers878853886RCV000793464; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949028329490283CA17:g.29490283C>A-
NM_000267.3(NF1):c.369C>G (p.Thr123=)4763NF1Benign/Likely benignrs146691765RCV000163483|RCV000197180|RCV000253461|RCV000271990|RCV000308384|RCV000366567|RCV000585903; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN169374|MONDO:MONDO:0008078,MedGen:C1834235,OMIM:162210, Orphanet:636|MONDO:MONDO:0011035,MedGen:C2931482,OMIM:601321, Orphanet:638|MO172949028429490284CG17:g.29490284C>GClinGen:CA188418C0553586 193520 Café-au-lait macules with pulmonary stenosis;
NM_000267.3(NF1):c.369C>T (p.Thr123=)4763NF1Likely benignrs146691765RCV000459031; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949028429490284CT17:g.29490284C>TClinGen:CA16615407
NM_000267.3(NF1):c.370T>A (p.Cys124Ser)4763NF1Uncertain significancers1555606074RCV000539960; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949028529490285TA17:g.29490285T>AClinGen:CA398981804
NM_001042492.3(NF1):c.370del (p.Cys124fs)4763NF1Pathogenicrs1597635825RCV000809662; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949028529490285CTC17:g.29490285_29490285del-
NM_000267.3(NF1):c.372T>C (p.Cys124=)4763NF1Likely benignrs1555606078RCV000552599; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949028729490287TC17:g.29490287T>CClinGen:CA499200441C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.373C>T (p.Arg125Cys)4763NF1Uncertain significancers876659418RCV000215356|RCV000808155; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949028829490288CT17:g.29490288C>TClinGen:CA10580188
NM_000267.3(NF1):c.373C>G (p.Arg125Gly)4763NF1Uncertain significancers876659418RCV000566642|RCV001219117; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949028829490288CG17:g.29490288C>GClinGen:CA398981813
NM_000267.3(NF1):c.374G>A (p.Arg125His)4763NF1Uncertain significancers149003051RCV000573497|RCV000681097|RCV000685560; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949028929490289GA17:g.29490289G>AClinGen:CA8485533C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.386A>G (p.Gln129Arg)4763NF1Uncertain significancers1060500250RCV000459426|RCV001021324; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172949030129490301AG17:g.29490301A>GClinGen:CA16615132
NM_000267.3(NF1):c.387G>C (p.Gln129His)4763NF1Uncertain significancers1390215440RCV000632324|RCV001021343; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172949030229490302GC17:g.29490302G>CClinGen:CA398981842
NM_001042492.3(NF1):c.387G>A (p.Gln129=)4763NF1Likely benignrs1390215440RCV000946336; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949030229490302GA17:g.29490302G>A-
NM_000267.3(NF1):c.389A>T (p.His130Leu)4763NF1Uncertain significancers876660277RCV000217661|RCV000802097; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949030429490304AT17:g.29490304A>TClinGen:CA10580189
NM_000267.3(NF1):c.389A>G (p.His130Arg)4763NF1Uncertain significancers876660277RCV000525286|RCV000563492|RCV001255477; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MedGen:CN169374172949030429490304AG17:g.29490304A>GClinGen:CA398981848C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.390T>A (p.His130Gln)4763NF1Uncertain significancers1597635884RCV000799204; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949030529490305TA17:g.29490305T>A-
NM_000267.3(NF1):c.392C>T (p.Ala131Val)4763NF1Uncertain significancers1567817930RCV000681226|RCV000697276; NMedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949030729490307CT17:g.29490307C>T-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.393A>C (p.Ala131=)4763NF1Likely benignrs761086521RCV000165260|RCV000463137; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949030829490308AC17:g.29490308A>CClinGen:CA192896C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.393_394delinsCC (p.Ala132Pro)4763NF1Uncertain significance-1RCV001067915; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949030829490309AGCCNC_000017.10:g.29490308_29490309delinsCC-
NM_000267.3(NF1):c.397del (p.Glu133fs)4763NF1Pathogenicrs878853891RCV000234482; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949031229490312TGT17:g.29490312_29490312delClinGen:CA10583462
NM_001042492.3(NF1):c.397G>A (p.Glu133Lys)4763NF1Uncertain significance-1RCV001235562; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949031229490312GA17:g.29490312G>A-
NM_001042492.3(NF1):c.399A>G (p.Glu133=)4763NF1Likely benignrs1597635911RCV000938605; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949031429490314AG17:g.29490314A>G-
NM_000267.3(NF1):c.403C>T (p.Arg135Trp)4763NF1Uncertain significancers775191883RCV000205474|RCV000574432; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172949031829490318CT17:g.29490318C>TClinGen:CA349631C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.403_405del (p.Arg135del)4763NF1Uncertain significancers1597635919RCV000807891; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949031829490320TCGGT17:g.29490318_29490320del-
NM_001042492.3(NF1):c.403del (p.Arg135fs)4763NF1Pathogenic-1RCV001042987; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949031829490318TCT17:g.29490318_29490318del-
NM_000267.3(NF1):c.404G>A (p.Arg135Gln)4763NF1Uncertain significancers1060500244RCV000456876|RCV000566403|RCV000679388; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MedGen:CN517202172949031929490319GA17:g.29490319G>AClinGen:CA16615142
NM_001042492.3(NF1):c.404G>T (p.Arg135Leu)4763NF1Uncertain significance-1RCV001069248; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949031929490319GT17:g.29490319G>T-
NM_001042492.3(NF1):c.410C>G (p.Ser137Cys)4763NF1Uncertain significancers1597635932RCV001021885|RCV001054187; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949032529490325CG17:g.29490325C>G-
NM_000267.3(NF1):c.412G>C (p.Ala138Pro)4763NF1Pathogenicrs1597635936RCV000806300; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949032729490327GC17:g.29490327G>C-
NM_001042492.3(NF1):c.412G>A (p.Ala138Thr)4763NF1Uncertain significance-1RCV001053885; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949032729490327GA17:g.29490327G>A-
NM_001042492.3(NF1):c.416C>T (p.Ser139Phe)4763NF1Uncertain significance-1RCV001061093; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949033129490331CT17:g.29490331C>T-
NM_000267.3(NF1):c.417T>C (p.Ser139=)4763NF1Likely benignrs762434870RCV000216128|RCV000632538; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949033229490332TC17:g.29490332T>CClinGen:CA8485535C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.418G>A (p.Gly140Arg)4763NF1Uncertain significance-1RCV001226593; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949033329490333GA17:g.29490333G>A-
NM_001042492.3(NF1):c.431C>T (p.Ser144Phe)4763NF1Uncertain significance-1RCV001049826; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949034629490346CT17:g.29490346C>T-
NM_000267.3(NF1):c.433C>G (p.Leu145Val)4763NF1Uncertain significancers786203460RCV000166775|RCV001037866; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949034829490348CG17:g.29490348C>GClinGen:CA196702C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.433C>T (p.Leu145Phe)4763NF1Uncertain significancers786203460RCV000546140|RCV001022319; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172949034829490348CT17:g.29490348C>TClinGen:CA398981939C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.439_445dup (p.Asn149fs)4763NF1Pathogenic-1RCV001070999; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949035329490354CCTGCAACA17:g.29490353_29490354insTGCAACA-
NM_000267.3(NF1):c.441C>A (p.Cys147Ter)4763NF1risk factorrs1597636022RCV000856563; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949035629490356CA17:g.29490356C>A-
NM_000267.3(NF1):c.445A>G (p.Asn149Asp)4763NF1Uncertain significancers750974024RCV000690934; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949036029490360AG17:g.29490360A>G-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.449del (p.Phe150fs)4763NF1Pathogenicrs1567817974RCV000696241; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949036329490363CTC17:g.29490363_29490363del-
NM_000267.3(NF1):c.450C>T (p.Phe150=)4763NF1Likely benignrs202142624RCV000632597; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949036529490365CT17:g.29490365C>TClinGen:CA8485538C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.450C>A (p.Phe150Leu)4763NF1Uncertain significance-1RCV001064096; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949036529490365CA17:g.29490365C>A-
NM_000267.3(NF1):c.451A>C (p.Asn151His)4763NF1Uncertain significancers769391944RCV000474298|RCV001022622; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172949036629490366AC17:g.29490366A>CClinGen:CA16615408
NM_001042492.3(NF1):c.451A>G (p.Asn151Asp)4763NF1Uncertain significance-1RCV001203127; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949036629490366AG17:g.29490366A>G-
NM_000267.3(NF1):c.452A>G (p.Asn151Ser)4763NF1Uncertain significancers1567817981RCV000691131|RCV001022641; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172949036729490367AG17:g.29490367A>G-
NM_001042492.3(NF1):c.454G>A (p.Ala152Thr)4763NF1Uncertain significance-1RCV001058604; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949036929490369GA17:g.29490369G>A-
NM_000267.3(NF1):c.456A>G (p.Ala152=)4763NF1Likely benignrs377481833RCV000121635|RCV000223487|RCV000233135; NMedGen:CN169374|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949037129490371AG17:g.29490371A>GClinGen:CA161050C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.456A>C (p.Ala152=)4763NF1Likely benignrs377481833RCV000572225|RCV000681309|RCV001088176; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949037129490371AC17:g.29490371A>CClinGen:CA349899
NM_001042492.3(NF1):c.461_462del (p.Val153_Phe154insTer)4763NF1Pathogenic-1RCV001202631; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949037529490376CTTC17:g.29490375_29490376del-
NM_000267.3(NF1):c.464G>A (p.Ser155Asn)4763NF1Uncertain significancers1555606113RCV000569925|RCV000692642; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949037929490379GA17:g.29490379G>AClinGen:CA398982148C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.466C>T (p.Arg156Cys)4763NF1Uncertain significancers755890242RCV000559442|RCV000575020; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172949038129490381CT17:g.29490381C>TClinGen:CA8485541
NM_000267.3(NF1):c.467G>T (p.Arg156Leu)4763NF1Uncertain significancers754096545RCV000216562|RCV000632459|RCV000681084; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202172949038229490382GT17:g.29490382G>TClinGen:CA8485542C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.467G>A (p.Arg156His)4763NF1Uncertain significancers754096545RCV000632442; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949038229490382GA17:g.29490382G>AClinGen:CA8485543C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.468C>T (p.Arg156=)4763NF1Likely benignrs779074793RCV000195708; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949038329490383CT17:g.29490383C>TClinGen:CA335875
NM_000267.3(NF1):c.469A>G (p.Ile157Val)4763NF1Uncertain significancers1555606118RCV000566319|RCV001066379; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949038429490384AG17:g.29490384A>GClinGen:CA398982168
NM_000267.3(NF1):c.475A>G (p.Thr159Ala)4763NF1Uncertain significancers371192107RCV000132115|RCV000206040|RCV000681279; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202172949039029490390AG17:g.29490390A>GClinGen:CA169283C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.475A>C (p.Thr159Pro)4763NF1Uncertain significancers371192107RCV000165462|RCV001225003; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949039029490390AC17:g.29490390A>CClinGen:CA193461C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.479G>C (p.Arg160Thr)4763NF1Likely pathogenicrs199474752RCV000059206|RCV000538243; NMedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949039429490394GC17:g.29490394G>CUniProtKB:P21359#VAR_065888,UniProtKB/Swiss-Prot:VAR_065888,ClinGen:CA219595C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.479+1G>A4763NF1Pathogenicrs1555606137RCV000549804|RCV000992431; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202172949039529490395GA17:g.29490395G>AClinGen:CA398982218C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.479+1G>T4763NF1Pathogenic/Likely pathogenicrs1555606137RCV000681426|RCV001223886; NMedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949039529490395GT17:g.29490395G>T-CN517202 not provided;
NM_001042492.3(NF1):c.479+1G>C4763NF1Pathogenic-1RCV001221190; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949039529490395GC17:g.29490395G>C-
NM_001042492.3(NF1):c.479+1_479+1356del4763NF1Likely pathogenic-1RCV001226814; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949039529491750GGTTAGTGTGTAAATCCACATGGGACTACTGAAGTAATATGAATATTAGAAGTTTTGTTTTTTGTCTACATAAAAATAAAAAGTTAATGGAAATGAGGTTTTTTTGTTTTG17:g.29490395_29490493del-
NM_000267.3(NF1):c.479+5G>A4763NF1Pathogenicrs1567818033RCV000685086; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949039929490399GA17:g.29490399G>A-C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.479+5G>T4763NF1Uncertain significance-1RCV001197758; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949039929490399GT17:g.29490399G>T-
NM_000267.3(NF1):c.479+7G>A4763NF1Likely benignrs778398666RCV000475388; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949040129490401GA17:g.29490401G>AClinGen:CA8485544
NM_000267.3(NF1):c.480-2989_586+3445del4763NF1Pathogenic-1RCV000200893; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949392029500460nanaClinGen:CA277551C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.480-2832_888+5938delinsTTGAA4763NF1Pathogenic-1RCV000200922; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949407729515621nana-C0027831 162200 Neurofibromatosis, type 1;
NC_000017.11:g.(?_31169871)_(31343155_?)del4763NF1Pathogenic-1RCV000707843; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949688929670173nana-
NC_000017.11:g.(?_31169881)_(31374165_?)del4763NF1Pathogenic-1RCV000796783; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949689929701183nana-
NC_000017.11:g.(?_31169881)_(31183454_?)del4763NF1Pathogenic-1RCV001033638; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949689929510472nana-1-
NC_000017.11:g.(?_31169881)_(31236031_?)dup4763NF1Uncertain significance-1RCV001031914; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949689929563049nana-1-
NC_000017.11:g.(?_31169881)_(31249129_?)dup4763NF1Likely pathogenic-1RCV001032355; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949689929576147nana-1-
NM_001042492.3(NF1):c.480-8C>G4763NF1Pathogenicrs1597643692RCV001007708; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949690129496901CG17:g.29496901C>G-
NM_001042492.3(NF1):c.480-6T>C4763NF1Likely benignrs1597643699RCV000929547; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949690329496903TC17:g.29496903T>C-
NM_000267.3(NF1):c.480-5T>C4763NF1Conflicting interpretations of pathogenicityrs1555607069RCV000528066|RCV001023083; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172949690429496904TC17:g.29496904T>CClinGen:CA658658581C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.480delG4763NF1Pathogenicrs1597643722RCV000802960; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949690829496908AGA17:g.29496908_29496908del-
NM_001042492.3(NF1):c.480-1G>A4763NF1Pathogenic-1RCV001048346; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949690829496908GA17:g.29496908G>A-
NM_000267.3(NF1):c.480G>A (p.Arg160=)4763NF1Conflicting interpretations of pathogenicityrs1555607071RCV000602417|RCV000701518|RCV001023091; NMedGen:CN169374|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172949690929496909GA17:g.29496909G>AClinGen:CA499201314C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.484C>G (p.Gln162Glu)4763NF1Uncertain significancers1555607073RCV000553892|RCV000565659; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172949691329496913CG17:g.29496913C>GClinGen:CA398984664
NM_000267.3(NF1):c.484C>T (p.Gln162Ter)4763NF1Pathogenicrs1555607073RCV000560991|RCV000659962; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949691329496913CT17:g.29496913C>TClinGen:CA398984667C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.484C>A (p.Gln162Lys)4763NF1Uncertain significancers1555607073RCV000709411; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949691329496913CA17:g.29496913C>A-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.493A>G (p.Thr165Ala)4763NF1Uncertain significancers786203186RCV000166390|RCV000632282; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949692229496922AG17:g.29496922A>GClinGen:CA195740C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.494C>G (p.Thr165Ser)4763NF1Uncertain significancers876660009RCV000533990|RCV000570176; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172949692329496923CG17:g.29496923C>GClinGen:CA398984775C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.495_498TGTT[1] (p.Cys167fs)4763NF1Pathogenicrs786201874RCV000164374|RCV000461491|RCV000486687|RCV001009588|RCV001023375; NMeSH:D030342,MedGen:C0950123|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202|Human Phenotype Ontology:HP:0009736,MedGen:C4024216; MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C002767172949692429496927CTGTTC17:g.29496924_29496927delClinGen:CA190800C0950123 Inborn genetic diseases;
NM_000267.3(NF1):c.496_497del (p.Val166fs)4763NF1Pathogenicrs1135402788RCV000497069; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949692429496925CTGC17:g.29496924_29496925delClinGen:CA645372607
NM_001042492.3(NF1):c.499T>G (p.Cys167Gly)4763NF1Uncertain significance-1RCV001043524; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949692829496928TG17:g.29496928T>G-
NM_000267.3(NF1):c.503C>G (p.Ser168Ter)4763NF1Pathogenicrs1131691994RCV000493132|RCV000707168|RCV001009566; NMedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|Human Phenotype Ontology:HP:0009736,MedGen:C4024216; MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949693229496932CG17:g.29496932C>GClinGen:CA398984855C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.504A>G (p.Ser168=)4763NF1Likely benignrs876658638RCV000219955|RCV000471976; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949693329496933AG17:g.29496933A>GClinGen:CA10580193C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.511A>C (p.Asn171His)4763NF1Uncertain significancers1597643796RCV000799601; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949694029496940AC17:g.29496940A>C-
NM_000267.3(NF1):c.512A>G (p.Asn171Ser)4763NF1Uncertain significancers767500770RCV000166685|RCV000234201|RCV000681197; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202172949694129496941AG17:g.29496941A>GClinGen:CA196478C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.512A>C (p.Asn171Thr)4763NF1Uncertain significancers767500770RCV000792351; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949694129496941AC17:g.29496941A>C-
NM_000267.3(NF1):c.514G>A (p.Val172Ile)4763NF1Uncertain significancers1555607083RCV000632296|RCV000679397; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202172949694329496943GA17:g.29496943G>AClinGen:CA398984983
NM_000267.3(NF1):c.518A>T (p.Asp173Val)4763NF1Uncertain significancers1597643820RCV000818178; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949694729496947AT17:g.29496947A>T-
NM_000267.3(NF1):c.520G>T (p.Val174Phe)4763NF1Uncertain significancers1555607084RCV000565080|RCV000820168; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949694929496949GT17:g.29496949G>TClinGen:CA398985025
NM_000267.3(NF1):c.520G>A (p.Val174Ile)4763NF1Uncertain significancers1555607084RCV000796405; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949694929496949GA17:g.29496949G>A-
NM_000267.3(NF1):c.525T>C (p.His175=)4763NF1Likely benignrs750358089RCV000197874|RCV000222374; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172949695429496954TC17:g.29496954T>CClinGen:CA337510C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.528T>A (p.Asp176Glu)4763NF1Conflicting interpretations of pathogenicityrs112306990RCV000034585|RCV000121638|RCV000129680|RCV000199175|RCV000264802|RCV000268253|RCV000323382; NMedGen:CN517202|MedGen:CN169374|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0011035,MedGen:C2931482,OMIM:601321, Orphanet:638|MONDO:MONDO:0008078,MedGen:C1834235,OMIM:162210172949695729496957TA17:g.29496957T>AClinGen:CA161065,UniProtKB:P21359#VAR_017552C0553586 193520 Café-au-lait macules with pulmonary stenosis;
NM_000267.3(NF1):c.529dup (p.Ile177fs)4763NF1Pathogenicrs1555607093RCV000632323; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949695729496958TTA17:g.29496957_29496958insAClinGen:CA658798765C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.529A>G (p.Ile177Val)4763NF1Uncertain significancers766213678RCV000218907|RCV000550459|RCV000679399; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202172949695829496958AG17:g.29496958A>GClinGen:CA8485552C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.538_541del (p.Leu180fs)4763NF1Pathogenicrs1135402789RCV000497153; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949696729496970GTTACG17:g.29496967_29496970delClinGen:CA645372608
NM_001042492.3(NF1):c.540dup (p.Gln181fs)4763NF1Pathogenic-1RCV001214615; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949696829496969TTA17:g.29496968_29496969insA-
NM_000267.3(NF1):c.541_542del (p.Gln181fs)4763NF1Likely pathogenicrs1135402790RCV000497228; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949696929496970TACT17:g.29496969_29496970delClinGen:CA645372609C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.541C>T (p.Gln181Ter)4763NF1Pathogenicrs753529924RCV000583592|RCV001007972; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202172949697029496970CT17:g.29496970C>TClinGen:CA398985168
NM_000267.3(NF1):c.549C>G (p.Ile183Met)4763NF1Uncertain significancers1597643884RCV000815361; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949697829496978CG17:g.29496978C>G-
NM_000267.3(NF1):c.550A>C (p.Asn184His)4763NF1Uncertain significancers1555607101RCV000632312|RCV001024202; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172949697929496979AC17:g.29496979A>CClinGen:CA398985235C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.551A>G (p.Asn184Ser)4763NF1Uncertain significancers876659849RCV000213670|RCV001042725; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949698029496980AG17:g.29496980A>GClinGen:CA10580194C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.556G>T (p.Asp186Tyr)4763NF1Uncertain significancers1567820765RCV000756436|RCV001214491; NMedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949698529496985GT17:g.29496985G>T-
NM_000267.3(NF1):c.557A>T (p.Asp186Val)4763NF1Uncertain significancers1567820771RCV000706861; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949698629496986AT17:g.29496986A>T-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.560del (p.Cys187fs)4763NF1Pathogenicrs1555607107RCV000566676|RCV000581233; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949698929496989TGT17:g.29496989_29496989delClinGen:CA658658582C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.563C>T (p.Ala188Val)4763NF1Uncertain significancers1060500309RCV000468877; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949699229496992CT17:g.29496992C>TClinGen:CA16615136
NM_000267.3(NF1):c.567A>G (p.Lys189=)4763NF1Conflicting interpretations of pathogenicityrs1567820796RCV000689909|RCV001024397; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172949699629496996AG17:g.29496996A>G-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.569del (p.Lys189_Leu190insTer)4763NF1Pathogenicrs1555607110RCV000632318; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949699729496997ATA17:g.29496997_29496997delClinGen:CA658798768
NM_000267.3(NF1):c.569T>G (p.Leu190Ter)4763NF1Pathogenicrs1555607112RCV000498082|RCV000632370; NMedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949699829496998TG17:g.29496998T>GClinGen:CA398985389C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.574C>T (p.Arg192Ter)4763NF1Pathogenicrs397514641RCV000033171|RCV000442381|RCV000492110|RCV000626737|RCV001003806; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|Human Phenotype Ontology:HP:0007183,MedGen:C4024926; Human Phenotype Ontology:HP:0007416,Human Phenotype Ontology:HP:0007565,172949700329497003CT17:g.29497003C>TClinGen:CA325787,OMIM:613113.0046C1860335 Axillary freckling;
NM_000267.3(NF1):c.575G>A (p.Arg192Gln)4763NF1Uncertain significancers587781670RCV000129826|RCV000476088|RCV000765343; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|Human Phenotype Ontology:HP:0012209,MONDO:MONDO:0011908,MedGen:C0349639,OMIM:607785, Orphanet:86834; MONDO:MONDO:0011035,MedGen:C2931482,OMIM:172949700429497004GA17:g.29497004G>AClinGen:CA165152C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.581T>C (p.Leu194Pro)4763NF1Pathogenicrs199474753RCV000809471; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949701029497010TC17:g.29497010T>C-
NM_000267.3(NF1):c.582G>A (p.Leu194=)4763NF1Likely benignrs786201846RCV000164339|RCV000457431; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949701129497011GA17:g.29497011G>AClinGen:CA190696C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.584A>G (p.Lys195Arg)4763NF1Uncertain significancers587778552RCV000121637|RCV000166667|RCV000691511; NMedGen:CN169374|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949701329497013AG17:g.29497013A>GClinGen:CA161060C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.585G>A (p.Lys195=)4763NF1Conflicting interpretations of pathogenicityrs918734204RCV000571055|RCV001209882; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949701429497014GA17:g.29497014G>AClinGen:CA289329301C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.586G>A (p.Glu196Lys)4763NF1Uncertain significancers876659079RCV000222660|RCV000468972; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949701529497015GA17:g.29497015G>AClinGen:CA10580195C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.586+1G>A4763NF1Pathogenicrs1555607126RCV000659963; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949701629497016GA17:g.29497016G>A-
NM_000267.3(NF1):c.586+2T>C4763NF1Likely pathogenicrs1135402791RCV000497162; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949701729497017TC17:g.29497017T>CClinGen:CA398985553
NM_000267.3(NF1):c.586+4A>G4763NF1Uncertain significancers1597644028RCV000824354; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949701929497019AG17:g.29497019A>G-
NM_000267.3(NF1):c.586+5G>A4763NF1Likely pathogenicrs1060500284RCV000472016; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949702029497020GA17:g.29497020G>AClinGen:CA16615148
NM_000267.3(NF1):c.586+5G>C4763NF1Uncertain significancers1060500284RCV000681378|RCV000686118; NMedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949702029497020GC17:g.29497020G>C-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.586+5del4763NF1Uncertain significancers1567820838RCV000695136; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949702029497020AGA17:g.29497020_29497020del-
NM_001042492.3(NF1):c.586+10_586+15del4763NF1Likely benignrs1555607130RCV000632596; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949702329497028TTAAATGT17:g.29497023_29497028delClinGen:CA658798772
NM_000267.3(NF1):c.586+2095_1261-2276delinsGTGG4763NF1Pathogenic-1RCV000200926; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172949911029530982nana-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.586+3099_1261-1045del4763NF1Pathogenic-1RCV000200876; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950011429532213nana-C0027831 162200 Neurofibromatosis, type 1;
NC_000017.11:g.(?_31179106)_(31357039_?)del4763NF1Pathogenic-1RCV000544684; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950612429684057nana-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.587-1766_888+1856del4763NF1Pathogenic-1RCV000200896; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950667429511539nanaClinGen:CA277554C0027831 162200 Neurofibromatosis, type 1;
NC_000017.11:g.(?_31181402)_(31182685_?)del4763NF1Pathogenic-1RCV001033286; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950842029509703nana-1-
NC_000017.11:g.(?_31181402)_(31253278_?)del4763NF1Pathogenic-1RCV001033463; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950842029580296nana-1-
NM_001042492.3(NF1):c.587-15_587-14del4763NF1Pathogenicrs1597657969RCV001007728; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950842529508426ATTA17:g.29508425_29508426del-
NM_001042492.3(NF1):c.587-14T>A4763NF1Pathogenicrs940581106RCV001007709; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950842629508426TA17:g.29508426T>A-
NC_000017.11:g.(?_31181408)_(31183454_?)del4763NF1Pathogenic-1RCV001031419; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950842629510472nana-1-
NC_000017.10:g.(?_29508434)_(29509689_?)del4763NF1Pathogenic-1RCV000552705; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950843429509689nana-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.587-3C>T4763NF1Uncertain significancers375188075RCV000225911|RCV000569929|RCV001001224; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MedGen:CN169374172950843729508437CT17:g.29508437C>TClinGen:CA8485570C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.587-3C>G4763NF1Conflicting interpretations of pathogenicityrs375188075RCV000564927|RCV001007751; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950843729508437CG17:g.29508437C>GClinGen:CA658656544C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.587-2A>G4763NF1Likely pathogenicrs1057518360RCV000553997; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950843829508438AG17:g.29508438A>GClinGen:CA398989166C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.589A>G (p.Thr197Ala)4763NF1Uncertain significancers1171626658RCV000694325; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950844229508442AG17:g.29508442A>G-C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.590C>G (p.Thr197Arg)4763NF1Likely pathogenicrs1597658021RCV000824992; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950844329508443CG17:g.29508443C>G-
NM_000267.3(NF1):c.592G>A (p.Ala198Thr)4763NF1Uncertain significancers1555608643RCV000632365|RCV001024695; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172950844529508445GA17:g.29508445G>AClinGen:CA398989201
NM_000267.3(NF1):c.592del (p.Ala198fs)4763NF1Pathogenicrs1567825858RCV000691606; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950844529508445AGA17:g.29508445_29508445del-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.593C>A (p.Ala198Glu)4763NF1Uncertain significancers863224663RCV000198111; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950844629508446CA17:g.29508446C>AClinGen:CA337644
NM_000267.3(NF1):c.593C>T (p.Ala198Val)4763NF1Uncertain significancers863224663RCV000819054; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950844629508446CT17:g.29508446C>T-
NM_000267.3(NF1):c.594A>T (p.Ala198=)4763NF1Likely benignrs138411879RCV000233453|RCV000562866|RCV000612276; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MedGen:CN169374172950844729508447AT17:g.29508447A>TClinGen:CA8485571C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.594del (p.Phe199fs)4763NF1Pathogenicrs1555608647RCV000632475; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950844729508447CAC17:g.29508447_29508447delClinGen:CA658798742
NM_000267.3(NF1):c.599A>T (p.Lys200Ile)4763NF1Uncertain significancers1597658055RCV000819466; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950845229508452AT17:g.29508452A>T-
NM_000267.3(NF1):c.603del (p.Phe201fs)4763NF1Pathogenicrs1135402792RCV000497229; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950845429508454ATA17:g.29508454_29508454delClinGen:CA645372610C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.602T>G (p.Phe201Cys)4763NF1Uncertain significance-1RCV001213797; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950845529508455TG17:g.29508455T>G-
NM_000267.3(NF1):c.610dup (p.Leu204fs)4763NF1Pathogenicrs1135402793RCV000497078; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950846029508461GGC17:g.29508460_29508461insCClinGen:CA645372611
NM_000267.3(NF1):c.607G>T (p.Ala203Ser)4763NF1Uncertain significancers904361724RCV000571893|RCV001206849; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950846029508460GT17:g.29508460G>TClinGen:CA289334456
NM_000267.3(NF1):c.607del (p.Ala203fs)4763NF1Pathogenicrs1567825887RCV000705600; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950846029508460AGA17:g.29508460_29508460del-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.614A>G (p.Lys205Arg)4763NF1Uncertain significancers1555608659RCV000571790|RCV000692685; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950846729508467AG17:g.29508467A>GClinGen:CA398989320
NM_000267.3(NF1):c.615G>A (p.Lys205=)4763NF1Likely benignrs1135402794RCV000497168|RCV000936137; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202172950846829508468GA17:g.29508468G>AClinGen:CA499206325
NM_000267.3(NF1):c.616A>G (p.Lys206Glu)4763NF1Uncertain significancers1060500269RCV000460273; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950846929508469AG17:g.29508469A>GClinGen:CA16615413
NM_000267.3(NF1):c.618G>C (p.Lys206Asn)4763NF1Uncertain significancers1567825917RCV000702199; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950847129508471GC17:g.29508471G>C-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.624_632del (p.Gln209_Ala211del)4763NF1Uncertain significancers1555608666RCV000632378; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950847529508483TGCGCAGTTAT17:g.29508475_29508483delClinGen:CA658798744C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.623C>T (p.Ala208Val)4763NF1Conflicting interpretations of pathogenicityrs758624540RCV000222794|RCV000525463; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950847629508476CT17:g.29508476C>TClinGen:CA8485573C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.624G>T (p.Ala208=)4763NF1Likely benignrs370184932RCV000167031|RCV000908872; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950847729508477GT17:g.29508477G>TClinGen:CA197321C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.624G>A (p.Ala208=)4763NF1Likely benignrs370184932RCV000231387|RCV000564699|RCV000613169; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MedGen:CN169374172950847729508477GA17:g.29508477G>AClinGen:CA8485574C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.625C>T (p.Gln209Ter)4763NF1Pathogenicrs786203448RCV000166757|RCV000204041; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950847829508478CT17:g.29508478C>TClinGen:CA196655C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.628T>C (p.Leu210=)4763NF1Likely benignrs757812365RCV000230718|RCV000561066; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172950848129508481TC17:g.29508481T>CClinGen:CA8485575
NM_001042492.3(NF1):c.630dup (p.Ala211fs)4763NF1Pathogenic-1RCV001203712; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950848229508483TTA17:g.29508482_29508483insA-
NM_000267.3(NF1):c.631G>A (p.Ala211Thr)4763NF1Uncertain significancers781519491RCV000567968|RCV000820381; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950848429508484GA17:g.29508484G>AClinGen:CA8485576C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.632C>T (p.Ala211Val)4763NF1Uncertain significancers1555608675RCV000570512|RCV000820933; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950848529508485CT17:g.29508485C>TClinGen:CA398989406
NM_000267.3(NF1):c.633A>G (p.Ala211=)4763NF1Likely benignrs876660800RCV000216105|RCV000475240; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950848629508486AG17:g.29508486A>GClinGen:CA10580197C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.637A>G (p.Ile213Val)4763NF1Uncertain significance-1RCV001067982; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950849029508490AG17:g.29508490A>G-
NM_001042492.3(NF1):c.643del (p.Ser215fs)4763NF1Pathogenicrs1597658192RCV001009567; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636; Human Phenotype Ontology:HP:0009736,MedGen:C4024216172950849629508496TAT17:g.29508496_29508496del-
NM_001042492.3(NF1):c.645C>T (p.Ser215=)4763NF1Likely benignrs746163138RCV000931666; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950849829508498CT17:g.29508498C>T-
NM_000267.3(NF1):c.647T>C (p.Leu216Pro)4763NF1Pathogenicrs199474756RCV000059214|RCV000705441; NMedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950850029508500TC17:g.29508500T>CClinGen:CA219627,UniProtKB:P21359#VAR_021732,UniProtKB/Swiss-Prot:VAR_021732C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.647T>G (p.Leu216Arg)4763NF1Conflicting interpretations of pathogenicityrs199474756RCV000803443|RCV000996515; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202172950850029508500TG17:g.29508500T>G-
NM_000267.3(NF1):c.649G>T (p.Glu217Ter)4763NF1Pathogenicrs878853909RCV000228869; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950850229508502GT17:g.29508502G>TClinGen:CA10583463
NM_001042492.3(NF1):c.653del (p.Lys218fs)4763NF1Pathogenicrs1131691094RCV000809400; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950850329508503GAG17:g.29508503_29508503del-
NM_000267.3(NF1):c.654+1G>T4763NF1Likely pathogenicrs1060500245RCV000464166|RCV001025389; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172950850829508508GT17:g.29508508G>TClinGen:CA16615561
NM_000267.3(NF1):c.654+1G>A4763NF1Pathogenicrs1060500245RCV000507089|RCV001009568; NMedGen:CN169374|Human Phenotype Ontology:HP:0009736,MedGen:C4024216; MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950850829508508GA17:g.29508508G>AClinGen:CA398989532
NM_000267.3(NF1):c.654+4del4763NF1Uncertain significancers1555608683RCV000659964; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950851029508510TAT17:g.29508510_29508510del-
NM_000267.3(NF1):c.655-60_888+5621delins1354763NF1Pathogenic-1RCV000200870; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950866829515304nana-C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.655-12_655-9del4763NF1Pathogenicrs1597658505RCV001007729; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950871429508717GTTCTG17:g.29508714_29508717del-
NM_000267.3(NF1):c.655-8A>G4763NF1Likely benignrs758089068RCV000460277; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950872029508720AG17:g.29508720A>GClinGen:CA8485601
NM_000267.3(NF1):c.655-3T>C4763NF1Conflicting interpretations of pathogenicityrs746584147RCV000560937|RCV000814989; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950872529508725TC17:g.29508725T>CClinGen:CA8485603
NM_000267.3(NF1):c.655-2A>C4763NF1Pathogenic/Likely pathogenicrs1555608734RCV000659965; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950872629508726AC17:g.29508726A>C-
NM_001042492.3(NF1):c.655-2A>G4763NF1Pathogenic-1RCV001220323; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950872629508726AG17:g.29508726A>G-
NM_001042492.3(NF1):c.655G>C (p.Ala219Pro)4763NF1Uncertain significance-1RCV001217717; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950872829508728GC17:g.29508728G>C-
NM_000267.3(NF1):c.656C>G (p.Ala219Gly)4763NF1Uncertain significancers1160353919RCV000562343|RCV000797621; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950872929508729CG17:g.29508729C>GClinGen:CA398989616C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.667T>C (p.Trp223Arg)4763NF1Pathogenic/Likely pathogenicrs1555608740RCV000659966|RCV000680812; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202172950874029508740TC17:g.29508740T>C-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.668G>A (p.Trp223Ter)4763NF1Pathogenicrs1567826110RCV000702987; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950874129508741GA17:g.29508741G>A-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.669G>A (p.Trp223Ter)4763NF1Pathogenicrs1057517967RCV000413819|RCV000492355|RCV000704754; NMedGen:CN517202|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950874229508742GA17:g.29508742G>AClinGen:CA16043099C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.669G>T (p.Trp223Cys)4763NF1Uncertain significancers1057517967RCV000792331; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950874229508742GT17:g.29508742G>T-
NM_000267.3(NF1):c.670G>C (p.Val224Leu)4763NF1Uncertain significancers1567826116RCV000692021; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950874329508743GC17:g.29508743G>C-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.677A>C (p.Asn226Thr)4763NF1Uncertain significancers770339628RCV000705989|RCV001025632; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172950875029508750AC17:g.29508750A>C-
NM_001042492.3(NF1):c.679T>C (p.Tyr227His)4763NF1Uncertain significance-1RCV001059628; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950875229508752TC17:g.29508752T>C-
NM_000267.3(NF1):c.680A>T (p.Tyr227Phe)4763NF1Uncertain significancers1555608742RCV000569985|RCV000690852; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950875329508753AT17:g.29508753A>TClinGen:CA398989855C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.681T>C (p.Tyr227=)4763NF1Conflicting interpretations of pathogenicityrs745804540RCV000420850|RCV000573159|RCV001080031|RCV001124638|RCV001124639|RCV001124640; NMedGen:CN517202|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0008672,MedGen:C0553586,OMIM:193520, Orphanet:3444|MONDO:MONDO:0011035,MedGen:C2931482,OMIM:601321, Orphanet:638|M172950875429508754TC17:g.29508754T>CClinGen:CA8485606C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.681T>A (p.Tyr227Ter)4763NF1Pathogenicrs745804540RCV000703736; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950875429508754TA17:g.29508754T>A-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.681T>G (p.Tyr227Ter)4763NF1Pathogenicrs745804540RCV000813110; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950875429508754TG17:g.29508754T>G-
NM_001042492.3(NF1):c.685G>C (p.Asp229His)4763NF1Uncertain significance-1RCV001214947; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950875829508758GC17:g.29508758G>C-
NM_000267.3(NF1):c.686A>G (p.Asp229Gly)4763NF1Uncertain significancers1060500285RCV000457709|RCV000573518; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172950875929508759AG17:g.29508759A>GClinGen:CA16615154
NM_001042492.3(NF1):c.688G>T (p.Glu230Ter)4763NF1Pathogenic-1RCV001055990; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950876129508761GT17:g.29508761G>T-
NM_001042492.3(NF1):c.690A>C (p.Glu230Asp)4763NF1Uncertain significance-1RCV001223792; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950876329508763AC17:g.29508763A>C-
NM_000267.3(NF1):c.693_694delinsCT (p.Thr232Ser)4763NF1Uncertain significancers1555608748RCV000632286; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950876629508767TACTNC_000017.10:g.29508766_29508767delinsCTClinGen:CA658798746
NM_000267.3(NF1):c.695C>T (p.Thr232Ile)4763NF1Uncertain significancers769719064RCV000632485|RCV000681214; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202172950876829508768CT17:g.29508768C>TClinGen:CA8485607C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.696A>G (p.Thr232=)4763NF1Likely benignrs368691517RCV000163501|RCV000200327|RCV000615609|RCV001090741; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN169374|MedGen:CN517202172950876929508769AG17:g.29508769A>GClinGen:CA188466C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.697A>G (p.Lys233Glu)4763NF1Uncertain significancers922257267RCV000551965; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950877029508770AG17:g.29508770A>GClinGen:CA398990006C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.697A>C (p.Lys233Gln)4763NF1Uncertain significancers922257267RCV000632294; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950877029508770AC17:g.29508770A>CClinGen:CA289334694
NM_001042492.3(NF1):c.702G>A (p.Leu234=)4763NF1Benignrs1801052RCV000162647|RCV000218671|RCV000279983|RCV000319858|RCV000334631|RCV000374483|RCV000588821; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MedGen:CN169374|MONDO:MONDO:0008078,MedGen:C1834235,OMIM:162210, Orphanet:636|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0011035,MedGen:C2931482,OMIM:601321, Orphanet:638|MO172950877529508775GA17:g.29508775G>AClinGen:CA186628C0553586 193520 Café-au-lait macules with pulmonary stenosis;
NM_000267.3(NF1):c.702_703inv (p.Tyr235His)4763NF1Uncertain significance-1RCV000573566|RCV001041298; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950877529508776GTACNC_000017.10:g.29508775_29508776invClinGen:CA658656553C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.702_708del (p.Tyr235fs)4763NF1Pathogenic-1RCV001224125; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950877529508781TGTACCAGT17:g.29508775_29508781del-
NM_000267.3(NF1):c.703T>C (p.Tyr235His)4763NF1Uncertain significancers864622465RCV000205078|RCV000221863; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172950877629508776TC17:g.29508776T>CClinGen:CA349262
NM_001042492.3(NF1):c.705C>A (p.Tyr235Ter)4763NF1Pathogenic-1RCV001229570; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950877829508778CA17:g.29508778C>A-
NM_000267.3(NF1):c.706C>G (p.Gln236Glu)4763NF1Uncertain significancers1597658664RCV000822308|RCV001025996; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172950877929508779CG17:g.29508779C>G-
NM_000267.3(NF1):c.707A>G (p.Gln236Arg)4763NF1Uncertain significancers1321998864RCV000813796; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950878029508780AG17:g.29508780A>G-
NM_001042492.3(NF1):c.711C>G (p.Ile237Met)4763NF1Uncertain significance-1RCV001063306; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950878429508784CG17:g.29508784C>G-
NM_000267.3(NF1):c.712C>G (p.Pro238Ala)4763NF1Uncertain significancers1060500365RCV000476499; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950878529508785CG17:g.29508785C>GClinGen:CA16615143
NM_000267.3(NF1):c.715C>T (p.Gln239Ter)4763NF1Pathogenicrs1597658676RCV000814862; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950878829508788CT17:g.29508788C>T-
NM_001042492.3(NF1):c.717G>A (p.Gln239=)4763NF1Likely benignrs1597658684RCV000924697; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950879029508790GA17:g.29508790G>A-
NM_000267.3(NF1):c.720T>C (p.Thr240=)4763NF1Likely benignrs1555608761RCV000632547|RCV001026162; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172950879329508793TC17:g.29508793T>CClinGen:CA499207744
NM_001042492.3(NF1):c.721G>A (p.Asp241Asn)4763NF1Uncertain significance-1RCV001042616; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950879429508794GA17:g.29508794G>A-
NM_000267.3(NF1):c.724dup (p.Met242fs)4763NF1Pathogenicrs1555608763RCV000518858|RCV000806565; NMedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950879629508797TTA17:g.29508796_29508797insAClinGen:CA658656555
NM_000267.3(NF1):c.730G>A (p.Glu244Lys)4763NF1Conflicting interpretations of pathogenicityrs1567826188RCV000692867|RCV001091252; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202172950880329508803GA17:g.29508803G>A-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.730+1G>C4763NF1Pathogenicrs1060500274RCV000472003; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950880429508804GC17:g.29508804G>CClinGen:CA16615414
NM_000267.3(NF1):c.730+1G>A4763NF1Pathogenicrs1060500274RCV000598702|RCV001039600; NMedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950880429508804GA17:g.29508804G>AClinGen:CA398990261CN517202 not provided;
NM_000267.3(NF1):c.730+1G>T4763NF1Pathogenic/Likely pathogenicrs1060500274RCV000659967; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950880429508804GT17:g.29508804G>T-
NM_000267.3(NF1):c.730+5G>A4763NF1Uncertain significancers1567826200RCV000695289; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950880829508808GA17:g.29508808G>A-
NM_000267.3(NF1):c.730+6G>C4763NF1Uncertain significancers1444298546RCV000806543; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950880929508809GC17:g.29508809G>C-
NM_000267.3(NF1):c.730+8T>C4763NF1Likely benignrs1555608771RCV000542074; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950881129508811TC17:g.29508811T>CClinGen:CA658656556C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.730+8T>G4763NF1Likely benignrs1555608771RCV000983782; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950881129508811TG17:g.29508811T>G-
NM_000267.3(NF1):c.730+10C>T4763NF1Likely benignrs750468471RCV000459607; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950881329508813CT17:g.29508813C>TClinGen:CA16615563C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.730+16dup4763NF1Conflicting interpretations of pathogenicityrs373999174RCV000294916|RCV000349802|RCV000389208|RCV000395451|RCV000481991; NMONDO:MONDO:0008672,MedGen:C0553586,OMIM:193520, Orphanet:3444|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0008078,MedGen:C1834235,OMIM:162210, Orphanet:636|MONDO:MONDO:0011035,MedGen:C2931482,OMIM:601321, Orphanet:638|MedGen:C172950881829508819GGA17:g.29508818_29508819insAClinGen:CA10645292
NM_001042492.3(NF1):c.730+32dup4763NF1Benignrs71142032RCV000989780|RCV001002257; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN169374172950881929508820AAT17:g.29508819_29508820insT-
NM_001042492.3(NF1):c.731-14T>G4763NF1Pathogenicrs1597659694RCV001007710; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950951229509512TG17:g.29509512T>G-
NM_000267.3(NF1):c.731-6A>C4763NF1Conflicting interpretations of pathogenicityrs369366499RCV000243785|RCV000679410|RCV001081743|RCV001125651|RCV001125652|RCV001125653; NMedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0008672,MedGen:C0553586,OMIM:193520, Orphanet:3444|MONDO:MONDO:0008078,MedGen:C1834235,OMIM:162210, Orphanet:636|MONDO:MONDO:0011035,MedGen:C2931482,O172950952029509520AC17:g.29509520A>CClinGen:CA336953
NM_000267.3(NF1):c.731-2A>T4763NF1Pathogenicrs1555608924RCV000530567; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950952429509524AT17:g.29509524A>TClinGen:CA398990437
NM_001042492.3(NF1):c.731-2A>G4763NF1Pathogenicrs1555608924RCV000992434|RCV001207548; NMedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950952429509524AG17:g.29509524A>G-
NM_001042492.3(NF1):c.731-2A>C4763NF1Pathogenicrs1555608924RCV001009569|RCV001207645; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636; Human Phenotype Ontology:HP:0009736,MedGen:C4024216|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950952429509524AC17:g.29509524A>C-
NM_000267.3(NF1):c.731-1G>A4763NF1Pathogenicrs1555608928RCV000579029|RCV001203062; NMedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950952529509525GA17:g.29509525G>AClinGen:CA398990442CN517202 not provided;
NM_000267.3(NF1):c.732A>C (p.Glu244Asp)4763NF1Uncertain significancers1567826603RCV000706853; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950952729509527AC17:g.29509527A>C-
NM_000267.3(NF1):c.734G>A (p.Cys245Tyr)4763NF1Uncertain significancers587781869RCV000130189|RCV001058836; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950952929509529GA17:g.29509529G>AClinGen:CA165906C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.736G>T (p.Ala246Ser)4763NF1Uncertain significancers1597659751RCV000803181; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950953129509531GT17:g.29509531G>T-
NM_000267.3(NF1):c.740A>G (p.Glu247Gly)4763NF1Uncertain significancers864622385RCV000206270; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950953529509535AG17:g.29509535A>GClinGen:CA350333
NM_000267.3(NF1):c.746T>G (p.Leu249Arg)4763NF1Uncertain significancers1567826623RCV000693333; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950954129509541TG17:g.29509541T>G-
NM_000267.3(NF1):c.746T>C (p.Leu249Pro)4763NF1Uncertain significancers1567826623RCV000757562|RCV000806391|RCV001026474; NMedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172950954129509541TC17:g.29509541T>C-
NM_000267.3(NF1):c.747A>G (p.Leu249=)4763NF1Likely benignrs761964963RCV000214521|RCV000876564; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950954229509542AG17:g.29509542A>GClinGen:CA8485636C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.750del (p.Phe250fs)4763NF1Pathogenicrs1567826633RCV000687954; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950954329509543ATA17:g.29509543_29509543del-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.753C>G (p.Asp251Glu)4763NF1Uncertain significancers1567826636RCV000699338; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950954829509548CG17:g.29509548C>G-C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.2(NF1):c.755_757TGG[1] (p.Val253del)4763NF1Likely pathogenicrs1060500323RCV000469747; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950955029509552TTGGT17:g.29509550_29509552delClinGen:CA16615147
NM_000267.3(NF1):c.757G>T (p.Val253Leu)4763NF1Uncertain significancers786203607RCV000474516|RCV001026584; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172950955229509552GT17:g.29509552G>TClinGen:CA16615564
NM_001042492.3(NF1):c.757G>A (p.Val253Met)4763NF1Uncertain significance-1RCV001229138; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950955229509552GA17:g.29509552G>A-
NM_001042492.3(NF1):c.758T>A (p.Val253Glu)4763NF1Uncertain significance-1RCV001044721; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950955329509553TA17:g.29509553T>A-
NM_000267.3(NF1):c.768T>G (p.Phe256Leu)4763NF1Uncertain significancers1597659838RCV000802206; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950956329509563TG17:g.29509563T>G-
NM_000267.3(NF1):c.771T>C (p.Ala257=)4763NF1Likely benignrs766932517RCV000632602; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950956629509566TC17:g.29509566T>CClinGen:CA8485640C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.774A>G (p.Glu258=)4763NF1Likely benignrs1555608947RCV000575704|RCV000904862; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950956929509569AG17:g.29509569A>GClinGen:CA499209162C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.776G>A (p.Ser259Asn)4763NF1Uncertain significance-1RCV001212221; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950957129509571GA17:g.29509571G>A-
NM_000267.3(NF1):c.778A>G (p.Thr260Ala)4763NF1Uncertain significancers1466892954RCV000706528; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950957329509573AG17:g.29509573A>G-
NM_000267.3(NF1):c.779C>T (p.Thr260Ile)4763NF1Uncertain significancers1567826665RCV000698503; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950957429509574CT17:g.29509574C>T-C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.781A>C (p.Lys261Gln)4763NF1Uncertain significance-1RCV001202200; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950957629509576AC17:g.29509576A>C-
NM_001042492.3(NF1):c.781A>G (p.Lys261Glu)4763NF1Uncertain significance-1RCV001233466; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950957629509576AG17:g.29509576A>G-
NM_000267.3(NF1):c.784C>T (p.Arg262Cys)4763NF1Uncertain significancers754343223RCV000228995|RCV000573744; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172950957929509579CT17:g.29509579C>TClinGen:CA8485641C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.785G>A (p.Arg262His)4763NF1Uncertain significancers1555608957RCV000632412; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950958029509580GA17:g.29509580G>AClinGen:CA398990832C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.786_787insTT (p.Lys263fs)4763NF1Pathogenicrs1597659879RCV001009570; NHuman Phenotype Ontology:HP:0009736,MedGen:C4024216; MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950958029509581GGTT17:g.29509580_29509581insTT-
NM_000267.3(NF1):c.789del (p.Ala264fs)4763NF1Pathogenicrs1135402795RCV000497021; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950958229509582TAT17:g.29509582_29509582delClinGen:CA645373080
NM_000267.3(NF1):c.787A>G (p.Lys263Glu)4763NF1Uncertain significancers1597659883RCV000808117; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950958229509582AG17:g.29509582A>G-
NM_001042492.3(NF1):c.790del (p.Ala264fs)4763NF1Pathogenicrs1597659893RCV000800736; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950958529509585AGA17:g.29509585_29509585del-
NM_000267.3(NF1):c.792del (p.Ala265fs)4763NF1Pathogenicrs1135402796RCV000497084; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950958729509587CAC17:g.29509587_29509587delClinGen:CA645373081
NM_001042492.3(NF1):c.796G>A (p.Val266Ile)4763NF1Uncertain significance-1RCV001037025; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950959129509591GA17:g.29509591G>A-
NM_000267.3(NF1):c.799_802del (p.Trp267fs)4763NF1Uncertain significancers1567826683RCV000779213; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950959429509597TTGGCT17:g.29509594_29509597del-
NM_000267.3(NF1):c.801G>A (p.Trp267Ter)4763NF1Pathogenicrs1064794273RCV000481303|RCV000699692|RCV001000935|RCV001027074; NMedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN169374|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172950959629509596GA17:g.29509596G>AClinGen:CA16620355C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.803C>A (p.Pro268Gln)4763NF1Uncertain significance-1RCV001045098; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950959829509598CA17:g.29509598C>A-
NM_001042492.3(NF1):c.803C>T (p.Pro268Leu)4763NF1Uncertain significance-1RCV001238864; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950959829509598CT17:g.29509598C>T-
NM_000267.3(NF1):c.804A>G (p.Pro268=)4763NF1Likely benignrs759964997RCV000552864; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950959929509599AG17:g.29509599A>GClinGen:CA8485642
NM_000267.3(NF1):c.807A>G (p.Leu269=)4763NF1Likely benignrs1333394353RCV000632588|RCV001027144; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172950960229509602AG17:g.29509602A>GClinGen:CA499209259
NM_000267.3(NF1):c.808C>T (p.Gln270Ter)4763NF1Pathogenicrs1555608970RCV000822263; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950960329509603CT17:g.29509603C>T-
NM_000267.3(NF1):c.809A>G (p.Gln270Arg)4763NF1Uncertain significancers1597659939RCV000816018; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950960429509604AG17:g.29509604A>G-
NM_001042492.3(NF1):c.812T>C (p.Ile271Thr)4763NF1Uncertain significancers1597659948RCV001027207|RCV001202960; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950960729509607TC17:g.29509607T>C-
NM_000267.3(NF1):c.814A>G (p.Ile272Val)4763NF1Uncertain significancers1555608971RCV000632376; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950960929509609AG17:g.29509609A>GClinGen:CA398990963C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.817del (p.Leu273fs)4763NF1Likely pathogenicrs1555608972RCV000659968; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950961229509612TCT17:g.29509612_29509612del-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.819C>T (p.Leu273=)4763NF1Likely benignrs765595990RCV000471116|RCV000564278; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172950961429509614CT17:g.29509614C>TClinGen:CA8485643
NM_001042492.3(NF1):c.820_823dup (p.Ile275fs)4763NF1Pathogenic-1RCV001219896; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950961429509615CCCTTA17:g.29509614_29509615insCTTA-
NM_000267.3(NF1):c.823A>T (p.Ile275Phe)4763NF1Uncertain significancers786202464RCV000200432; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950961829509618AT17:g.29509618A>TClinGen:CA339306
NM_000267.3(NF1):c.824T>C (p.Ile275Thr)4763NF1Uncertain significancers1406698961RCV000801196; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950961929509619TC17:g.29509619T>C-
NM_001042492.3(NF1):c.827T>A (p.Leu276Ter)4763NF1Pathogenic-1RCV001169879; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950962229509622TA17:g.29509622T>A-
NM_001042492.3(NF1):c.830G>A (p.Cys277Tyr)4763NF1Uncertain significance-1RCV001225077; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950962529509625GA17:g.29509625G>A-
NM_000267.3(NF1):c.834A>G (p.Pro278=)4763NF1Likely benignrs1318820078RCV000632609; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950962929509629AG17:g.29509629A>GClinGen:CA499209493C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.838del (p.Glu279_Ile280insTer)4763NF1Pathogenic-1RCV001237806; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950963129509631GAG17:g.29509631_29509631del-
NM_000267.3(NF1):c.843C>A (p.Ile281=)4763NF1Likely benignrs146094856RCV000632594; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950963829509638CA17:g.29509638C>AClinGen:CA289335184
NM_000267.3(NF1):c.844C>T (p.Gln282Ter)4763NF1Pathogenicrs753054046RCV000788984|RCV000821408; NMedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950963929509639CT17:g.29509639C>T-
NM_001042492.3(NF1):c.844C>A (p.Gln282Lys)4763NF1Uncertain significance-1RCV001049014; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950963929509639CA17:g.29509639C>A-
NM_000267.3(NF1):c.845A>G (p.Gln282Arg)4763NF1Uncertain significancers779034900RCV000632302|RCV000765344|RCV001017837; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|Human Phenotype Ontology:HP:0012209,MONDO:MONDO:0011908,MedGen:C0349639,OMIM:607785, Orphanet:86834; MONDO:MONDO:0011035,MedGen:C2931482,OMIM:601321, Orphanet:638; MONDO:MONDO:0008078,MedGen:C1834172950964029509640AG17:g.29509640A>GClinGen:CA289335196
NM_001042492.3(NF1):c.846G>A (p.Gln282=)4763NF1Benign/Likely benignrs138840528RCV000163252|RCV000199756|RCV000220521|RCV000306778|RCV000310231|RCV000401268|RCV000514640|RCV001258309; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN169374|MONDO:MONDO:0008672,MedGen:C0553586,OMIM:193520, Orphanet:3444|MONDO:MONDO:0008078,MedGen:C1834235,OMIM:162210, Orphanet:636|M172950964129509641GA17:g.29509641G>AClinGen:CA187856C0553586 193520 Café-au-lait macules with pulmonary stenosis;
NM_000267.3(NF1):c.847G>T (p.Asp283Tyr)4763NF1Uncertain significancers200572531RCV000034592|RCV000130047|RCV000205213|RCV001027794; NMedGen:CN517202|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636; MONDO:MONDO:0011035,MedGen:C2931482,OMIM:601321, Orphanet:638; MO172950964229509642GT17:g.29509642G>TClinGen:CA165606C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.847G>A (p.Asp283Asn)4763NF1Uncertain significancers200572531RCV000797852; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950964229509642GA17:g.29509642G>A-
NM_001042492.3(NF1):c.847_854del (p.Asp283fs)4763NF1Pathogenic-1RCV001220195; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950964229509649GGATATATCG17:g.29509642_29509649del-
NM_000267.3(NF1):c.848A>G (p.Asp283Gly)4763NF1Uncertain significancers878853921RCV000231223|RCV000561118; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172950964329509643AG17:g.29509643A>GClinGen:CA10583464
NM_001042492.3(NF1):c.848A>T (p.Asp283Val)4763NF1Uncertain significance-1RCV001222380; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950964329509643AT17:g.29509643A>T-
NM_001042492.3(NF1):c.851_854dup (p.Lys286fs)4763NF1Pathogenic-1RCV001206125; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950964529509646AATATC17:g.29509645_29509646insTATC-
NM_001042492.3(NF1):c.851T>C (p.Ile284Thr)4763NF1Uncertain significance-1RCV001069754; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950964629509646TC17:g.29509646T>C-
NM_000267.3(NF1):c.852A>G (p.Ile284Met)4763NF1Uncertain significancers1567826762RCV000702482|RCV001017962; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172950964729509647AG17:g.29509647A>G-
NM_000267.3(NF1):c.853T>G (p.Ser285Ala)4763NF1Uncertain significancers1555608981RCV000632508|RCV001017975; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172950964829509648TG17:g.29509648T>GClinGen:CA398991136
NM_001042492.3(NF1):c.854C>T (p.Ser285Phe)4763NF1Uncertain significance-1RCV001246044; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950964929509649CT17:g.29509649C>T-
NM_001042492.3(NF1):c.861C>T (p.Asp287=)4763NF1Likely benignrs749949219RCV000164254|RCV000220619|RCV000681227|RCV001079842; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950965629509656CT17:g.29509656C>TClinGen:CA190456C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.862G>A (p.Val288Met)4763NF1Uncertain significancers755670651RCV000223253|RCV000234015|RCV000608961; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN169374172950965729509657GA17:g.29509657G>AClinGen:CA8485645C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.862del (p.Val288fs)4763NF1Likely pathogenicrs1135402797RCV000497173; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950965729509657CGC17:g.29509657_29509657delClinGen:CA645373082
NM_000267.3(NF1):c.864G>C (p.Val288=)4763NF1Conflicting interpretations of pathogenicityrs201181517RCV000164185|RCV000549822|RCV001127746|RCV001127747|RCV001127748; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0008078,MedGen:C1834235,OMIM:162210, Orphanet:636|MONDO:MONDO:0008672,MedGen:C0553586,OMIM:193520, Orphanet:3444|MONDO:MONDO:00110172950965929509659GC17:g.29509659G>CClinGen:CA190258C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.864G>T (p.Val288=)4763NF1Likely benignrs201181517RCV000469166; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950965929509659GT17:g.29509659G>TClinGen:CA16615423
NM_000267.3(NF1):c.866T>C (p.Val289Ala)4763NF1Uncertain significancers749251299RCV000805116; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950966129509661TC17:g.29509661T>C-
NM_000267.3(NF1):c.872A>C (p.Glu291Ala)4763NF1Uncertain significancers876660171RCV000223188|RCV000479894|RCV000806878; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950966729509667AC17:g.29509667A>CClinGen:CA10580203
NM_000267.3(NF1):c.873A>C (p.Glu291Asp)4763NF1Uncertain significancers754915138RCV000528084|RCV000562194; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172950966829509668AC17:g.29509668A>CClinGen:CA8485647C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.876C>T (p.Asn292=)4763NF1Likely benignrs786202811RCV000165824|RCV000535689; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950967129509671CT17:g.29509671C>TClinGen:CA194275C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.878del (p.Asn293fs)4763NF1Pathogenic-1RCV001214817; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950967229509672CAC17:g.29509672_29509672del-
NM_000267.3(NF1):c.882_885del (p.Met294fs)4763NF1Pathogenicrs1567826819RCV000704809; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950967529509678CATGAC17:g.29509675_29509678del-
NM_000267.3(NF1):c.884A>G (p.Asn295Ser)4763NF1Conflicting interpretations of pathogenicityrs1555608994RCV000573406|RCV000632514; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950967929509679AG17:g.29509679A>GClinGen:CA398991296C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.885T>A (p.Asn295Lys)4763NF1Uncertain significancers864622300RCV000204948|RCV000573511; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172950968029509680TA17:g.29509680T>AClinGen:CA349137
NM_000267.3(NF1):c.886A>T (p.Lys296Ter)4763NF1Pathogenicrs1135402798RCV000497026; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950968129509681AT17:g.29509681A>TClinGen:CA398991305
NM_000267.3(NF1):c.888G>A (p.Lys296=)4763NF1Uncertain significancers1597660134RCV000807487; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950968329509683GA17:g.29509683G>A-
NM_000267.3(NF1):c.888+1G>C4763NF1Likely pathogenicrs1135402799RCV000497118; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950968429509684GC17:g.29509684G>CClinGen:CA398991319
NM_000267.3(NF1):c.888+1G>A4763NF1Pathogenicrs1135402799RCV000659969; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950968429509684GA17:g.29509684G>A-
NM_001042492.3(NF1):c.888+1G>T4763NF1Pathogenicrs1135402799RCV000989781; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950968429509684GT17:g.29509684G>T-
NM_001042492.3(NF1):c.888+2T>G4763NF1Pathogenic-1RCV001222911; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950968529509685TG17:g.29509685T>G-
NM_000267.3(NF1):c.888+5G>A4763NF1Conflicting interpretations of pathogenicityrs556444929RCV000129823|RCV000459107; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950968829509688GA17:g.29509688G>AClinGen:CA165147C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.888+6G>T4763NF1Uncertain significancers1555609000RCV000632387; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950968929509689GT17:g.29509689G>TClinGen:CA658798748C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.888+6G>A4763NF1Uncertain significance-1RCV001203851; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950968929509689GA17:g.29509689G>A-
NM_001042492.3(NF1):c.888+8G>A4763NF1Likely benignrs772234682RCV000928174; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172950969129509691GA17:g.29509691G>A-
NM_000267.3(NF1):c.888+789A>G4763NF1Uncertain significancers1597660974RCV000822665; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172951047229510472AG17:g.29510472A>G-
NM_000267.3(NF1):c.888+5515_1261-1635del4763NF1Pathogenic-1RCV000200882; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172951519829531623nana-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.888+8334_1721+34delinsTC4763NF1Pathogenic-1RCV000200886; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172951801729548981nana-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.889-8107_1261-278del4763NF1Pathogenic-1RCV000200911; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172951933329532980nana-
NM_000267.3(NF1):c.889-894_1261-284del4763NF1Pathogenic-1RCV000200941; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952654629532974nanaClinGen:CA277594C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.889-453_908del4763NF1Pathogenicrs1555610774RCV000200938; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952698329527455TGTCTCTACTAAAAATACAAAAATTAGCCAGGCATGGTGGCAGGCGCCTGTAAACCCAGCTACTCTGGAGGCTGAGGCGGGAGAATCGCTTGACCCTGGGAGGCAGAGGTT17:g.29526983_29527081delClinGen:CA277591
NM_001042492.3(NF1):c.889-21C>A4763NF1Pathogenicrs753797445RCV001007711; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952741929527419CA17:g.29527419C>A-
NC_000017.11:g.(?_31200402)_(31265359_?)del4763NF1Pathogenic-1RCV000795438; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952742029592377nana-
NC_000017.11:g.(?_31200402)_(31206391_?)del4763NF1Pathogenic-1RCV001032991; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952742029533409nana-1-
NC_000017.11:g.(?_31200412)_(31206381_?)del4763NF1Pathogenic-1RCV000707837; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952743029533399nana-
NC_000017.11:g.(?_31200412)_(31265349_?)del4763NF1Pathogenic-1RCV000708300; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952743029592367nana-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.889-6del4763NF1Likely benignrs864622362RCV000204154; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952743429527434TCT17:g.29527434_29527434delClinGen:CA348401
NC_000017.11:g.(?_31200416)_(31206377_?)del4763NF1Pathogenic-1RCV000632632; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952743429533395nana-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.889-2A>G4763NF1Conflicting interpretations of pathogenicityrs878853922RCV000227780|RCV000571966|RCV000992436|RCV001000939; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MedGen:CN169374172952743829527438AG17:g.29527438A>GClinGen:CA10583465C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.889-2del4763NF1Pathogenicrs1567834983RCV000705662; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952743829527438TAT17:g.29527438_29527438del-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.889-1G>A4763NF1Pathogenic/Likely pathogenicrs587781517RCV000497206; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952743929527439GA17:g.29527439G>AClinGen:CA398995477
NM_000267.3(NF1):c.889-1G>C4763NF1Pathogenicrs587781517RCV000582247; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952743929527439GC17:g.29527439G>CClinGen:CA398995476
NC_000017.11:g.(?_31200422)_(31265339_?)del4763NF1Pathogenic-1RCV000813969; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952744029592357nana-
NM_000267.3(NF1):c.898C>T (p.Leu300=)4763NF1Likely benignrs786201926RCV000164460|RCV000529014|RCV000612814; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN169374172952744929527449CT17:g.29527449C>TClinGen:CA191016C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.901G>A (p.Asp301Asn)4763NF1Uncertain significance-1RCV001058532; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952745229527452GA17:g.29527452G>A-
NM_001042492.3(NF1):c.903_913del (p.Asp301fs)4763NF1Pathogenic-1RCV001065427; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952745329527463GACAGTCTACGAG17:g.29527453_29527463del-
NM_000267.3(NF1):c.905G>A (p.Ser302Asn)4763NF1Conflicting interpretations of pathogenicityrs786202746RCV000165716|RCV000476472; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952745629527456GA17:g.29527456G>AClinGen:CA194056C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.907C>G (p.Leu303Val)4763NF1Uncertain significancers1555610847RCV000571314|RCV001060289; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952745829527458CG17:g.29527458C>GClinGen:CA398995563
NM_000267.3(NF1):c.908del (p.Leu303fs)4763NF1Pathogenicrs1555610848RCV000539183; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952745929527459CTC17:g.29527459_29527459delClinGen:CA658656562C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.909_910delinsTT (p.Arg304Ter)4763NF1Pathogenicrs1555610854RCV000632510; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952746029527461ACTTNC_000017.10:g.29527460_29527461delinsTTClinGen:CA658798749
NM_000267.3(NF1):c.910C>T (p.Arg304Ter)4763NF1Pathogenicrs786203950RCV000167474|RCV000468520|RCV000508304|RCV000579282; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN169374|MedGen:CN517202172952746129527461CT17:g.29527461C>TClinGen:CA198406C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.910C>G (p.Arg304Gly)4763NF1Uncertain significance-1RCV001222432; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952746129527461CG17:g.29527461C>G-
NM_000267.3(NF1):c.911G>A (p.Arg304Gln)4763NF1Uncertain significancers76015786RCV000807822; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952746229527462GA17:g.29527462G>A-
NM_001042492.3(NF1):c.911G>T (p.Arg304Leu)4763NF1Uncertain significance-1RCV001038337; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952746229527462GT17:g.29527462G>T-
NM_000267.3(NF1):c.913A>G (p.Lys305Glu)4763NF1Uncertain significancers1567835041RCV000712408|RCV000808179; NMedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952746429527464AG17:g.29527464A>G-
NM_001042492.2(NF1):c.920_921delinsA (p.Leu307fs)4763NF1Pathogenicrs1555610860RCV000632453; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952747129527472TTA17:g.29527472_29527472delClinGen:CA658798751
NM_000267.3(NF1):c.924_927del (p.Gly309fs)4763NF1Pathogenicrs1060500301RCV000456984; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952747329527476TGCTGT17:g.29527473_29527476delClinGen:CA16615424
NM_000267.3(NF1):c.923C>G (p.Ala308Gly)4763NF1Uncertain significancers876660836RCV000214706|RCV000681196|RCV000686132; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952747429527474CG17:g.29527474C>GClinGen:CA10580205C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.926G>A (p.Gly309Asp)4763NF1Uncertain significancers1555610862RCV000527376; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952747729527477GA17:g.29527477G>AClinGen:CA398995648C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.928C>T (p.His310Tyr)4763NF1Uncertain significancers1597680837RCV001019110|RCV001041780; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952747929527479CT17:g.29527479C>T-
NM_000267.3(NF1):c.930T>C (p.His310=)4763NF1Likely benignrs1555610865RCV000542406|RCV001019162; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172952748129527481TC17:g.29527481T>CClinGen:CA499218008C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.936A>C (p.Gly312=)4763NF1Likely benignrs876658874RCV000220426|RCV000944978; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952748729527487AC17:g.29527487A>CClinGen:CA10580206C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.942G>A (p.Arg314=)4763NF1Likely benignrs786203445RCV000166754|RCV000464346; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952749329527493GA17:g.29527493G>AClinGen:CA196646C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.943C>T (p.Gln315Ter)4763NF1Pathogenicrs766011053RCV000659970; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952749429527494CT17:g.29527494C>T-
NM_001042492.3(NF1):c.944_945insTGCC (p.Gln315fs)4763NF1Pathogenic-1RCV001205403; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952749529527496AATGCC17:g.29527495_29527496insTGCC-
NM_000267.3(NF1):c.945_946delinsAA (p.Leu316Met)4763NF1Pathogenicrs267606609RCV000000396; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952749629527497GCAANC_000017.10:g.29527496_29527497delinsAAClinGen:CA114197,OMIM:613113.0036C2931482 601321 Neurofibromatosis-Noonan syndrome;
NM_001042492.3(NF1):c.952_953del (p.Glu318fs)4763NF1Pathogenic-1RCV001070093; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952750229527503CAGC17:g.29527502_29527503del-
NM_000267.3(NF1):c.955dup (p.Ser319fs)4763NF1Pathogenicrs876660931RCV000219150|RCV000810511; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952750329527504GGA17:g.29527503_29527504insAClinGen:CA10580208
NM_000267.3(NF1):c.952del (p.Glu318fs)4763NF1Pathogenicrs1555610881RCV000549119; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952750329527503AGA17:g.29527503_29527503delClinGen:CA658656564C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.958G>C (p.Ala320Pro)4763NF1Uncertain significance-1RCV001061326; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952750929527509GC17:g.29527509G>C-
NM_000267.3(NF1):c.959C>A (p.Ala320Asp)4763NF1Conflicting interpretations of pathogenicityrs1555610884RCV000659971|RCV000780544; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN169374172952751029527510CA17:g.29527510C>A-
NM_000267.3(NF1):c.960T>A (p.Ala320=)4763NF1Benign/Likely benignrs376447070RCV000167230|RCV000474176; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952751129527511TA17:g.29527511T>AClinGen:CA197789C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.961G>C (p.Ala321Pro)4763NF1Uncertain significance-1RCV001208522; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952751229527512GC17:g.29527512G>C-
NM_001042492.3(NF1):c.964del (p.Ile322fs)4763NF1Pathogenicrs1597680909RCV000820795; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952751429527514CAC17:g.29527514_29527514del-
NM_000267.3(NF1):c.964A>G (p.Ile322Val)4763NF1Uncertain significancers755007999RCV000462749|RCV000567290; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172952751529527515AG17:g.29527515A>GClinGen:CA8485664
NM_000267.3(NF1):c.965T>C (p.Ile322Thr)4763NF1Uncertain significancers1417994243RCV000561475|RCV000690184|RCV000757558; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202172952751629527516TC17:g.29527516T>CClinGen:CA398995947
NM_001042492.3(NF1):c.968C>A (p.Ala323Asp)4763NF1Pathogenic-1RCV001041575; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952751929527519CA17:g.29527519C>A-
NM_000267.3(NF1):c.969C>T (p.Ala323=)4763NF1Likely benignrs786201462RCV000163692|RCV000552609; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952752029527520CT17:g.29527520C>TClinGen:CA188964C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.970T>C (p.Cys324Arg)4763NF1Uncertain significancers199474735RCV000059219|RCV001060875; NMedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952752129527521TC17:g.29527521T>CUniProtKB/Swiss-Prot:VAR_032463,ClinGen:CA219647,UniProtKB:P21359#VAR_032463CN517202 not provided;
NM_000267.3(NF1):c.972T>A (p.Cys324Ter)4763NF1Pathogenicrs1597680938RCV000820261; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952752329527523TA17:g.29527523T>A-
NM_000267.3(NF1):c.974T>G (p.Val325Gly)4763NF1Uncertain significancers1422095982RCV000816061; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952752529527525TG17:g.29527525T>G-
NM_000267.3(NF1):c.976A>G (p.Lys326Glu)4763NF1Uncertain significancers1597680956RCV000795559; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952752729527527AG17:g.29527527A>G-
NM_001042492.3(NF1):c.977A>G (p.Lys326Arg)4763NF1Uncertain significance-1RCV001241548; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952752829527528AG17:g.29527528A>G-
NM_000267.3(NF1):c.978A>G (p.Lys326=)4763NF1Conflicting interpretations of pathogenicityrs1555610891RCV000575775|RCV000791791; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952752929527529AG17:g.29527529A>GClinGen:CA499218340
NM_001042492.3(NF1):c.979_997del (p.Leu327fs)4763NF1Pathogenicrs1597680978RCV000984801; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952753029527548ACTGTGTAAAGCAAGTACTTA17:g.29527530_29527548del-
NM_000267.3(NF1):c.983_984del4763NF1Pathogenicrs1555610893RCV000530605; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952753129527532CTGC17:g.29527531_29527532delClinGen:CA658656567C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.980T>C (p.Leu327Pro)4763NF1Conflicting interpretations of pathogenicityrs201624827RCV000659972|RCV000757560; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202172952753129527531TC17:g.29527531T>C-
NM_001042492.3(NF1):c.980T>G (p.Leu327Arg)4763NF1Uncertain significance-1RCV001206956; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952753129527531TG17:g.29527531T>G-
NM_001042492.3(NF1):c.987A>G (p.Lys329=)4763NF1Uncertain significance-1RCV001238722; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952753829527538AG17:g.29527538A>G-
NM_000267.3(NF1):c.988G>C (p.Ala330Pro)4763NF1Uncertain significancers199474767RCV000473350; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952753929527539GC17:g.29527539G>CClinGen:CA16615153
NM_000267.3(NF1):c.988del (p.Ala330fs)4763NF1Likely pathogenicrs1555610896RCV000659973; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952753929527539AGA17:g.29527539_29527539del-
NM_000267.3(NF1):c.988_995del (p.Ala330fs)4763NF1Pathogenicrs1567835161RCV000692308; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952753929527546AGCAAGTACA17:g.29527539_29527546del-
NM_000267.3(NF1):c.989C>T (p.Ala330Val)4763NF1Pathogenic/Likely pathogenicrs1555610898RCV000659974|RCV000680813; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202172952754029527540CT17:g.29527540C>T-
NM_000267.3(NF1):c.996_999del (p.Tyr333fs)4763NF1Pathogenicrs1555610900RCV000555781; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952754429527547GTACTG17:g.29527544_29527547delClinGen:CA658656568C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.997dup (p.Tyr333fs)4763NF1Pathogenic-1RCV001035664; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952754629527547CCT17:g.29527546_29527547insT-
NM_001042492.2(NF1):c.997del (p.Tyr333fs)4763NF1Pathogenicrs1567835183RCV000694438; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952754729527547CTC17:g.29527547_29527547del-
NM_001042492.3(NF1):c.998dup (p.Tyr333Ter)4763NF1Pathogenic-1RCV001054809; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952754829527549TTA17:g.29527548_29527549insA-
NM_001042492.3(NF1):c.997T>C (p.Tyr333His)4763NF1Uncertain significance-1RCV001203532; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952754829527548TC17:g.29527548T>C-
NM_000267.3(NF1):c.999C>G (p.Tyr333Ter)4763NF1Pathogenicrs1466912192RCV000802285; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952755029527550CG17:g.29527550C>G-
NM_000267.3(NF1):c.1004A>G (p.Asn335Ser)4763NF1Uncertain significancers758212945RCV000558546|RCV000565713; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172952755529527555AG17:g.29527555A>GClinGen:CA8485667C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1005T>C (p.Asn335=)4763NF1Benign/Likely benignrs777369021RCV000163833|RCV000199777|RCV000613914; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN169374172952755629527556TC17:g.29527556T>CClinGen:CA189299C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.1007G>A (p.Trp336Ter)4763NF1Pathogenic-1RCV001216084; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952755829527558GA17:g.29527558G>A-
NM_000267.3(NF1):c.1013A>G (p.Asp338Gly)4763NF1Uncertain significancers199474773RCV000059149|RCV000817222; NMedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952756429527564AG17:g.29527564A>GClinGen:CA219374,UniProtKB:P21359#VAR_010990,UniProtKB/Swiss-Prot:VAR_010990
NM_001042492.3(NF1):c.1017_1018CT[1] (p.Ser340fs)4763NF1Pathogenic/Likely pathogenicrs1555610903RCV000659975|RCV000788498|RCV001009571|RCV001009689; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636; Human Phenotype Ontology:HP:0009736,MedGen:C4024216|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172952756829527569ACTA17:g.29527568_29527569del-
NM_001042492.3(NF1):c.1018T>G (p.Ser340Ala)4763NF1Uncertain significance-1RCV001210370; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952756929527569TG17:g.29527569T>G-
NM_000267.3(NF1):c.1019C>G (p.Ser340Cys)4763NF1Uncertain significancers771089333RCV000547070; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952757029527570CG17:g.29527570C>GClinGen:CA8485669C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1020dup (p.Val341fs)4763NF1Pathogenicrs1555610905RCV000657241|RCV000809527; NMedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952757029527571CCT17:g.29527570_29527571insT-
NM_000267.3(NF1):c.1021G>A (p.Val341Ile)4763NF1Uncertain significancers1555610907RCV000564194|RCV000823991; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952757229527572GA17:g.29527572G>AClinGen:CA398996340
NM_001042492.3(NF1):c.1024A>G (p.Ile342Val)4763NF1Uncertain significance-1RCV001043066; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952757529527575AG17:g.29527575A>G-
NM_001042492.3(NF1):c.1034_1035insGTTTTCCTACT (p.Val346fs)4763NF1Pathogenic-1RCV001232117; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952757529527576AATTTTCCTACTG17:g.29527575_29527576insTTTTCCTACTG-
NM_000267.3(NF1):c.1032A>G (p.Leu344=)4763NF1Conflicting interpretations of pathogenicityrs199832006RCV000163379|RCV000612672|RCV000679374|RCV001086621|RCV001121966|RCV001121967|RCV001121968; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0011035,MedGen:C2931482,OMIM:601321, Orphanet:638|MONDO:MONDO:0008672,MedGen:C0553586,OMIM:193520172952758329527583AG17:g.29527583A>GClinGen:CA188135C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.1036del (p.Val346fs)4763NF1Pathogenic-1RCV001222476; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952758729527587TGT17:g.29527587_29527587del-
NM_000267.3(NF1):c.1041_1045del (p.Gln347fs)4763NF1Pathogenicrs1135402800RCV000497032; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952759029527594TCAGTCT17:g.29527590_29527594delClinGen:CA645373077C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1042T>C (p.Ser348Pro)4763NF1Uncertain significancers864622064RCV000205395; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952759329527593TC17:g.29527593T>CClinGen:CA349558C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1045A>G (p.Met349Val)4763NF1Uncertain significancers776050648RCV000632402|RCV001009788; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172952759629527596AG17:g.29527596A>GClinGen:CA8485673
NM_000267.3(NF1):c.1048G>A (p.Val350Met)4763NF1Uncertain significancers1185636269RCV000559602|RCV001017077; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172952759929527599GA17:g.29527599G>AClinGen:CA398996490C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1052T>A (p.Val351Asp)4763NF1Uncertain significancers878853861RCV000227273; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952760329527603TA17:g.29527603T>AClinGen:CA10583466C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1052T>C (p.Val351Ala)4763NF1Uncertain significancers878853861RCV000483644|RCV001043716; NMedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952760329527603TC17:g.29527603T>CClinGen:CA16620356CN517202 not provided;
NM_001042492.3(NF1):c.1057C>G (p.Leu353Val)4763NF1Uncertain significance-1RCV001053543; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952760829527608CG17:g.29527608C>G-
NM_000267.3(NF1):c.1059del (p.Lys354fs)4763NF1Pathogenicrs863224488RCV000196611; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952760929527609CTC17:g.29527609_29527609delClinGen:CA336562C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.1058T>C (p.Leu353Pro)4763NF1Uncertain significance-1RCV001210621; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952760929527609TC17:g.29527609T>C-
NM_000267.3(NF1):c.1061A>G (p.Lys354Arg)4763NF1Uncertain significancers1135402801RCV000497123; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952761229527612AG17:g.29527612A>GClinGen:CA398996566C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1061A>C (p.Lys354Thr)4763NF1Uncertain significancers1135402801RCV000797648; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952761229527612AC17:g.29527612A>C-
NM_001042492.3(NF1):c.1062_1062+6del4763NF1Likely pathogenic-1RCV001057499; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952761229527618AAGGTAACA17:g.29527612_29527618del-
NM_000267.3(NF1):c.1062+1G>A4763NF1Pathogenicrs1597681200RCV000817442; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952761429527614GA17:g.29527614G>A-
NM_001042492.3(NF1):c.1062+2dup4763NF1Uncertain significance-1RCV001215382; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952761429527615GGT17:g.29527614_29527615insT-
NM_001042492.3(NF1):c.1062+2T>C4763NF1Pathogenic-1RCV001229795; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952761529527615TC17:g.29527615T>C-
NM_001042492.3(NF1):c.1062+2T>G4763NF1Pathogenic-1RCV001247671; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952761529527615TG17:g.29527615T>G-
NM_000267.3(NF1):c.1062+3A>G4763NF1Pathogenic/Likely pathogenicrs1057521098RCV000437730|RCV000583516; NMedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952761629527616AG17:g.29527616A>GClinGen:CA16608391C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1062+5C>T4763NF1Uncertain significancers1555610916RCV000632367; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952761829527618CT17:g.29527618C>TClinGen:CA658798752
NM_000267.3(NF1):c.1062+6A>G4763NF1Uncertain significancers1060500291RCV000469027; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952761929527619AG17:g.29527619A>GClinGen:CA16615428
NM_000267.3(NF1):c.1062+7T>C4763NF1Likely benignrs979521240RCV000477519; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952762029527620TC17:g.29527620T>CClinGen:CA16615430
NM_001042492.3(NF1):c.1063-14T>A4763NF1Pathogenicrs538708444RCV001007737; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952804129528041TA17:g.29528041T>A-
NM_000267.3(NF1):c.1063-13G>A4763NF1Conflicting interpretations of pathogenicityrs1131691066RCV000492691|RCV000632430; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952804229528042GA17:g.29528042G>AClinGen:CA645369653C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.1063-3T>G4763NF1Pathogenicrs758206740RCV001007764; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952805229528052TG17:g.29528052T>G-
NM_000267.3(NF1):c.1063-2A>G4763NF1Pathogenic/Likely pathogenicrs1060500358RCV000471389|RCV000599201; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202172952805329528053AG17:g.29528053A>GClinGen:CA16615156
NM_000267.3(NF1):c.1063-1G>C4763NF1Likely pathogenicrs1555610955RCV000659976; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952805429528054GC17:g.29528054G>C-
NM_001042492.3(NF1):c.1066del (p.Leu356fs)4763NF1Pathogenicrs1597681864RCV000822264; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952805729528057ACA17:g.29528057_29528057del-
NM_000267.3(NF1):c.1068G>A (p.Leu356=)4763NF1Likely benignrs1259636575RCV000573769|RCV000875303; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952806029528060GA17:g.29528060G>AClinGen:CA499219346C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1069C>G (p.Leu357Val)4763NF1Uncertain significancers1567835662RCV000686974; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952806129528061CG17:g.29528061C>G-
NM_000267.3(NF1):c.1070T>C (p.Leu357Pro)4763NF1Pathogenicrs137854563RCV000000398|RCV000000399; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0008078,MedGen:C1834235,OMIM:162210, Orphanet:636172952806229528062TC17:g.29528062T>COMIM:613113.0038,ClinGen:CA212552,UniProtKB:P21359#VAR_021733C1834235 162210 Neurofibromatosis, familial spinal;
NM_000267.3(NF1):c.1070T>G (p.Leu357Arg)4763NF1Conflicting interpretations of pathogenicityrs137854563RCV000216480|RCV000487279|RCV000808095; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952806229528062TG17:g.29528062T>GClinGen:CA10580209
NM_000267.3(NF1):c.1073_1074insA (p.Phe358fs)4763NF1Likely pathogenicrs1555610971RCV000659977; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952806529528066TTA17:g.29528065_29528066insA-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1077del (p.Pro360fs)4763NF1Likely pathogenicrs1555610972RCV000659978; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952806929528069ATA17:g.29528069_29528069del-
NM_000267.3(NF1):c.1078C>T (p.Pro360Ser)4763NF1Uncertain significancers1597681902RCV000806132; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952807029528070CT17:g.29528070C>T-
NM_001042492.3(NF1):c.1078C>A (p.Pro360Thr)4763NF1Uncertain significance-1RCV001041930; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952807029528070CA17:g.29528070C>A-
NM_000267.3(NF1):c.1082G>C (p.Ser361Thr)4763NF1Uncertain significancers876660103RCV000215346|RCV000436371|RCV000702812; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952807429528074GC17:g.29528074G>CClinGen:CA10580211C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1089A>G (p.Pro363=)4763NF1Likely benignrs757508086RCV000165666|RCV000231017; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952808129528081AG17:g.29528081A>GClinGen:CA193939C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1094C>A (p.Ser365Ter)4763NF1Pathogenicrs864622107RCV000205613; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952808629528086CA17:g.29528086C>AClinGen:CA349742
NM_000267.3(NF1):c.1094C>G (p.Ser365Ter)4763NF1Pathogenicrs864622107RCV000507359|RCV000807218; NMedGen:CN169374|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952808629528086CG17:g.29528086C>GClinGen:CA398996822
NM_000267.3(NF1):c.1095_1096del (p.Gly367fs)4763NF1Pathogenicrs1597681960RCV000817520; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952808729528088CAAC17:g.29528087_29528088del-
NM_001042492.3(NF1):c.1097dup (p.Gly367fs)4763NF1Pathogenic-1RCV001227088; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952808829528089AAG17:g.29528088_29528089insG-
NM_000267.3(NF1):c.1104_1107del (p.Gln369fs)4763NF1Likely pathogenicrs1555610984RCV000659979; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952809329528096GCAGTG17:g.29528093_29528096del-
NM_001042492.3(NF1):c.1103dup (p.Ser368fs)4763NF1Pathogenic-1RCV001044119; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952809429528095AAG17:g.29528094_29528095insG-
NM_000267.3(NF1):c.1108C>T (p.Pro370Ser)4763NF1Uncertain significancers878853862RCV000233817|RCV000681022; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202172952810029528100CT17:g.29528100C>TClinGen:CA10583467
NM_001042492.3(NF1):c.1110del (p.Ala371fs)4763NF1Pathogenic-1RCV001228116; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952810229528102CTC17:g.29528102_29528102del-
NM_000267.3(NF1):c.1112C>T (p.Ala371Val)4763NF1Uncertain significancers1597681991RCV000800180; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952810429528104CT17:g.29528104C>T-
NM_000267.3(NF1):c.1113A>C (p.Ala371=)4763NF1Likely benignrs786201652RCV000164045|RCV000470848; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952810529528105AC17:g.29528105A>CClinGen:CA189897C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.1115A>T (p.Asp372Val)4763NF1Uncertain significance-1RCV001240115; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952810729528107AT17:g.29528107A>T-
NM_000267.3(NF1):c.1118T>C (p.Val373Ala)4763NF1Uncertain significancers1597682016RCV000818411; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952811029528110TC17:g.29528110T>C-
NM_000267.3(NF1):c.1120G>A (p.Asp374Asn)4763NF1Uncertain significancers876658666RCV000223198|RCV000824322; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952811229528112GA17:g.29528112G>AClinGen:CA10580212
NM_001042492.3(NF1):c.1121_1122del (p.Asp374fs)4763NF1Pathogenicrs1597682030RCV001009885|RCV001225438; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952811329528114GATG17:g.29528113_29528114del-
NM_000267.3(NF1):c.1130T>C (p.Ile377Thr)4763NF1Uncertain significancers878853863RCV000228845|RCV001017404; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172952812229528122TC17:g.29528122T>CClinGen:CA10583468
NM_000267.3(NF1):c.1131T>C (p.Ile377=)4763NF1Likely benignrs1555610993RCV000550957; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952812329528123TC17:g.29528123T>CClinGen:CA499219589C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1134C>G (p.Asp378Glu)4763NF1Uncertain significancers781367679RCV000699925; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952812629528126CG17:g.29528126C>G-C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.1134C>T (p.Asp378=)4763NF1Likely benignrs781367679RCV000944625|RCV001009967; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172952812629528126CT17:g.29528126C>T-
NM_000267.3(NF1):c.1135T>C (p.Cys379Arg)4763NF1Uncertain significancers1060500281RCV000463618; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952812729528127TC17:g.29528127T>CClinGen:CA16615433
NM_000267.3(NF1):c.1137C>T (p.Cys379=)4763NF1Benign/Likely benignrs139648455RCV000163603|RCV000600736|RCV000679375|RCV001080658; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952812929528129CT17:g.29528129C>TClinGen:CA188739C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1138C>T (p.Leu380Phe)4763NF1Uncertain significancers1426127948RCV000526803|RCV000574491; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172952813029528130CT17:g.29528130C>TClinGen:CA398997070C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1139T>C (p.Leu380Pro)4763NF1Pathogenicrs1555611004RCV000534870; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952813129528131TC17:g.29528131T>CClinGen:CA398997077C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.1139T>A (p.Leu380His)4763NF1Uncertain significance-1RCV001229137; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952813129528131TA17:g.29528131T>A-
NM_000267.3(NF1):c.1144del (p.Ser382fs)4763NF1Likely pathogenicrs1135402802RCV000497211; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952813429528134GTG17:g.29528134_29528134delClinGen:CA645373078
NM_001042492.3(NF1):c.1144T>C (p.Ser382Pro)4763NF1Uncertain significance-1RCV001237431; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952813629528136TC17:g.29528136T>C-
NM_000267.3(NF1):c.1145C>T (p.Ser382Phe)4763NF1Uncertain significancers1555611016RCV000632356; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952813729528137CT17:g.29528137C>TClinGen:CA398997106C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1148G>T (p.Cys383Phe)4763NF1Uncertain significancers1597682085RCV000798230; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952814029528140GT17:g.29528140G>T-
NM_000267.3(NF1):c.1152del (p.Arg385fs)4763NF1Pathogenicrs1135402803RCV000497070; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952814229528142CTC17:g.29528142_29528142delClinGen:CA645373079
NM_000267.3(NF1):c.1153C>T (p.Arg385Cys)4763NF1Uncertain significancers1322986962RCV000567658|RCV000813001; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952814529528145CT17:g.29528145C>TClinGen:CA398997152
NM_001042492.3(NF1):c.1153del (p.Arg385fs)4763NF1Pathogenic-1RCV001059282; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952814529528145TCT17:g.29528145_29528145del-
NM_000267.3(NF1):c.1154G>A (p.Arg385His)4763NF1Uncertain significancers1350329837RCV000547769; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952814629528146GA17:g.29528146G>AClinGen:CA398997154
NM_001042492.3(NF1):c.1156A>G (p.Ile386Val)4763NF1Uncertain significance-1RCV001199057; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952814829528148AG17:g.29528148A>G-
NM_000267.3(NF1):c.1166A>G (p.His389Arg)4763NF1Conflicting interpretations of pathogenicityrs149739570RCV000130738|RCV000204985|RCV000680982|RCV000708723|RCV000765345|RCV000845190|RCV001121969|RCV001121970|RCV001121971; NMeSH:D030342,MedGen:C0950123|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|Human Phenotype Ontology:HP:0012209,MONDO:MONDO:0011908,MedGen:C0349639,OMIM:607785, Orphanet:86172952815829528158AG17:g.29528158A>GClinGen:CA167012
NM_000267.3(NF1):c.1170C>T (p.Asn390=)4763NF1Likely benignrs769004910RCV000528466|RCV000606041|RCV001010121; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN169374|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172952816229528162CT17:g.29528162C>TClinGen:CA8485691C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1173C>T (p.Asn391=)4763NF1Likely benignrs367986994RCV000163899|RCV000540775|RCV000612783; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN169374172952816529528165CT17:g.29528165C>TClinGen:CA189463C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1174C>T (p.Gln392Ter)4763NF1Pathogenicrs1597682137RCV000793315; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952816629528166CT17:g.29528166C>T-
NM_000267.3(NF1):c.1176A>G (p.Gln392=)4763NF1Likely benignrs566220983RCV000570234|RCV000681201|RCV001089441; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952816829528168AG17:g.29528168A>GClinGen:CA8485692C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.1182dup (p.Lys395Ter)4763NF1Pathogenicrs1597682159RCV001010192|RCV001223319; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952817129528172CCT17:g.29528171_29528172insT-
NM_000267.3(NF1):c.1182T>C (p.Phe394=)4763NF1Likely benignrs786202581RCV000165456|RCV000204529; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952817429528174TC17:g.29528174T>CClinGen:CA193445C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.1183_1185+2del4763NF1Likely pathogenicrs1555611039RCV000553362; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952817429528178TTAAGGT17:g.29528174_29528178delClinGen:CA658656577C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1185G>A (p.Lys395=)4763NF1Likely pathogenicrs1567835847RCV000705299; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952817729528177GA17:g.29528177G>A-
NM_000267.3(NF1):c.1185+1G>A4763NF1Pathogenicrs864622161RCV000204498|RCV001091254; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202172952817829528178GA17:g.29528178G>AClinGen:CA348721
NM_001042492.3(NF1):c.1185+1G>T4763NF1Pathogenic-1RCV001236506; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952817829528178GT17:g.29528178G>T-
NM_000267.3(NF1):c.1185+2T>G4763NF1Pathogenicrs1555611043RCV000507799|RCV001070792; NMedGen:CN169374|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952817929528179TG17:g.29528179T>GClinGen:CA398997367
NM_001042492.3(NF1):c.1185+2T>C4763NF1Pathogenic-1RCV001043018; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952817929528179TC17:g.29528179T>C-
NM_000267.3(NF1):c.1185+5G>C4763NF1Uncertain significancers1597682182RCV000810419; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952818229528182GC17:g.29528182G>C-
NM_000267.3(NF1):c.1185+7G>C4763NF1Conflicting interpretations of pathogenicityrs1322791959RCV000989782; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952818429528184GC17:g.29528184G>CClinGen:CA658656578C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1185+7G>A4763NF1Likely benignrs1322791959RCV000632626; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952818429528184GA17:g.29528184G>AClinGen:CA625467379
NM_001042492.3(NF1):c.1185+8C>G4763NF1Conflicting interpretations of pathogenicityrs1041153819RCV000938430|RCV001091255; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202172952818529528185CG17:g.29528185C>G-
NM_001042492.3(NF1):c.1185+9A>T4763NF1Likely benignrs776421322RCV000924943; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952818629528186AT17:g.29528186A>T-
NM_001042492.3(NF1):c.1185+10T>C4763NF1Likely benignrs759048037RCV000953950; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952818729528187TC17:g.29528187T>C-
NM_001042492.3(NF1):c.1186-7T>C4763NF1Likely benignrs1597682676RCV000867396; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952842229528422TC17:g.29528422T>C-
NM_000267.3(NF1):c.1186-6C>T4763NF1Likely benignrs200684215RCV000554705; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952842329528423CT17:g.29528423C>TClinGen:CA8485715C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1186-4A>G4763NF1Likely benignrs769295150RCV000467417|RCV000562613|RCV000613287; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MedGen:CN169374172952842529528425AG17:g.29528425A>GClinGen:CA8485716
NM_000267.3(NF1):c.1186-1G>C4763NF1Likely pathogenicrs876660782RCV000542382; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952842829528428GC17:g.29528428G>CClinGen:CA398997403C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.1186-1G>A4763NF1Pathogenicrs876660782RCV000989783; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952842829528428GA17:g.29528428G>A-
NM_000267.3(NF1):c.1186A>C (p.Ile396Leu)4763NF1Uncertain significancers1413735911RCV000530886|RCV000565374; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172952842929528429AC17:g.29528429A>CClinGen:CA398997406
NM_001042492.3(NF1):c.1188_1189del (p.Ile396fs)4763NF1Likely pathogenicrs1597682729RCV000989784; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952843029528431ATCA17:g.29528430_29528431del-
NM_001042492.3(NF1):c.1192del (p.Leu398fs)4763NF1Pathogenic-1RCV001035999; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952843429528434GCG17:g.29528434_29528434del-
NM_001042492.3(NF1):c.1198C>T (p.Gln400Ter)4763NF1Pathogenicrs1597682751RCV001009572; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636; Human Phenotype Ontology:HP:0009736,MedGen:C4024216172952844129528441CT17:g.29528441C>T-
NM_001042492.3(NF1):c.1207C>A (p.Pro403Thr)4763NF1Uncertain significance-1RCV001067475; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952845029528450CA17:g.29528450C>A-
NM_001042492.3(NF1):c.1207C>T (p.Pro403Ser)4763NF1Uncertain significance-1RCV001238799; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952845029528450CT17:g.29528450C>T-
NM_000267.3(NF1):c.1213A>G (p.Thr405Ala)4763NF1Uncertain significancers587782233RCV000130930|RCV000632354; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952845629528456AG17:g.29528456A>GClinGen:CA167397C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1218del (p.His407fs)4763NF1Pathogenicrs1131691106RCV000492281|RCV000701483; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952845929528459ATA17:g.29528459_29528459delClinGen:CA645369717C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1219C>T (p.His407Tyr)4763NF1Uncertain significancers1156614886RCV000793098; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952846229528462CT17:g.29528462C>T-
NM_000267.3(NF1):c.1223A>G (p.Tyr408Cys)4763NF1Uncertain significancers876660344RCV000216611|RCV001070482; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952846629528466AG17:g.29528466A>GClinGen:CA10580216C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.1224T>G (p.Tyr408Ter)4763NF1Pathogenic-1RCV001047467; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952846729528467TG17:g.29528467T>G-
NM_000267.3(NF1):c.1229T>G (p.Leu410Arg)4763NF1Uncertain significancers1376759287RCV000692721; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952847229528472TG17:g.29528472T>G-
NM_001042492.3(NF1):c.1231G>A (p.Val411Ile)4763NF1Uncertain significancers199703072RCV001010461|RCV001219044; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952847429528474GA17:g.29528474G>A-
NM_001042492.3(NF1):c.1235A>G (p.Asn412Ser)4763NF1Uncertain significance-1RCV001220956; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952847829528478AG17:g.29528478A>G-
NM_000267.3(NF1):c.1237T>C (p.Ser413Pro)4763NF1Pathogenicrs1555611093RCV000659980; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952848029528480TC17:g.29528480T>C-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1238C>G (p.Ser413Ter)4763NF1Pathogenicrs1241533665RCV000691369|RCV001010493; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172952848129528481CG17:g.29528481C>G-
NM_000267.3(NF1):c.1238C>A (p.Ser413Ter)4763NF1Pathogenicrs1241533665RCV000819802; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952848129528481CA17:g.29528481C>A-
NM_000267.3(NF1):c.1243C>T (p.His415Tyr)4763NF1Uncertain significancers1415155749RCV000708724|RCV000820084; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952848629528486CT17:g.29528486C>T-
NM_000267.3(NF1):c.1244A>G (p.His415Arg)4763NF1Uncertain significancers1555611097RCV000574709|RCV000659981; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952848729528487AG17:g.29528487A>GClinGen:CA398997703
NM_000267.3(NF1):c.1245del (p.Arg416fs)4763NF1Likely pathogenicrs1555611098RCV000659982; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952848829528488ATA17:g.29528488_29528488del-
NM_000267.3(NF1):c.1246C>T (p.Arg416Ter)4763NF1Pathogenicrs764079291RCV000467266|RCV000484297|RCV000999931; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202|MedGen:CN169374172952848929528489CT17:g.29528489C>TClinGen:CA8485718C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1247G>A (p.Arg416Gln)4763NF1Uncertain significancers1343309278RCV000543779|RCV001010550; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172952849029528490GA17:g.29528490G>AClinGen:CA398997717C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1248A>T (p.Arg416=)4763NF1Likely benignrs1403345664RCV000556323; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952849129528491AT17:g.29528491A>TClinGen:CA499220705C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.1251_1260+25del4763NF1Likely pathogenic-1RCV001244406; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952849129528525GAATCATCACCAATGTAAGTCCAAAAGGTATTGCTAG17:g.29528491_29528525del-
NM_001042492.3(NF1):c.1257C>A (p.Thr419=)4763NF1Likely benignrs774269651RCV000902877; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952850029528500CA17:g.29528500C>A-
NM_000267.3(NF1):c.1259A>G (p.Asn420Ser)4763NF1Uncertain significancers1555611107RCV000532243|RCV001010614; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172952850229528502AG17:g.29528502A>GClinGen:CA398997795C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1260+1G>A4763NF1Pathogenicrs267606603RCV000000384; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952850429528504GA17:g.29528504G>AClinGen:CA251471,OMIM:613113.0025C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1260+1G>T4763NF1Pathogenicrs267606603RCV000691582; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952850429528504GT17:g.29528504G>T-
NM_000267.3(NF1):c.1260+2dup4763NF1Uncertain significancers1597682922RCV000811513; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952850429528505GGT17:g.29528504_29528505insT-
NM_001042492.3(NF1):c.1260+2_1260+3insTT4763NF1Likely pathogenic-1RCV001069709; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952850429528505GGTT17:g.29528504_29528505insTT-
NM_001042492.3(NF1):c.1260+1G>C4763NF1Pathogenic-1RCV001052535; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952850429528504GC17:g.29528504G>C-
NM_000267.3(NF1):c.1260+2T>G4763NF1Likely pathogenicrs1555611110RCV000632347; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952850529528505TG17:g.29528505T>GClinGen:CA398997819
NM_001042492.3(NF1):c.1260+2T>C4763NF1Likely pathogenic-1RCV001037303; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952850529528505TC17:g.29528505T>C-
NM_001042492.3(NF1):c.1260+3A>C4763NF1Uncertain significance-1RCV001207911; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952850629528506AC17:g.29528506A>C-
NM_001042492.3(NF1):c.1260+4A>T4763NF1Uncertain significance-1RCV001224843; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952850729528507AT17:g.29528507A>T-
NM_000267.3(NF1):c.1260+5G>C4763NF1Likely pathogenicrs1060500253RCV000462352; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952850829528508GC17:g.29528508G>CClinGen:CA16615566
NM_000267.3(NF1):c.1260+5G>A4763NF1Pathogenicrs1060500253RCV000794721|RCV000845191; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015446,MedGen:C3805239, Orphanet:1456172952850829528508GA17:g.29528508G>A-
NM_000267.3(NF1):c.1260+6T>C4763NF1Uncertain significancers1555611111RCV000659983; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952850929528509TC17:g.29528509T>C-
NM_000267.3(NF1):c.1260+6T>G4763NF1Uncertain significancers1555611111RCV000659984; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952850929528509TG17:g.29528509T>G-
NM_000267.3(NF1):c.1260+9A>G4763NF1Likely benignrs1060503908RCV000465637; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172952851229528512AG17:g.29528512A>GClinGen:CA16615158
NM_000267.3(NF1):c.1260+1604A>G4763NF1Pathogenicrs1131691067RCV000492499|RCV000816703; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953010729530107AG17:g.29530107A>GClinGen:CA645369654
NC_000017.11:g.(?_31203089)_(31352424_?)del4763NF1Pathogenic-1RCV001032998; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953010729679442nana-1-
NM_001042492.3(NF1):c.1261-21T>G4763NF1Pathogenicrs1597688656RCV001007738; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953323729533237TG17:g.29533237T>G-
NM_001042492.3(NF1):c.1261-19G>A4763NF1Pathogenic/Likely pathogenicrs1597688663RCV001007739|RCV001010601; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172953323929533239GA17:g.29533239G>A-
NM_001042492.3(NF1):c.1261-13T>A4763NF1Pathogenicrs1597688674RCV001007740; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953324529533245TA17:g.29533245T>A-
NC_000017.11:g.(?_31206230)_(31374165_?)del4763NF1Pathogenic-1RCV001033738; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953324829701183nana-1-
NM_000267.3(NF1):c.1261-3T>A4763NF1Uncertain significancers761761583RCV000234264; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953325529533255TA17:g.29533255T>AClinGen:CA8485741C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.1261-2A>G4763NF1Pathogenic-1RCV001060941; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953325629533256AG17:g.29533256A>G-
NM_001042492.3(NF1):c.1261-2A>T4763NF1Pathogenic-1RCV001036832; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953325629533256AT17:g.29533256A>T-
NM_000267.3(NF1):c.1261T>G (p.Ser421Ala)4763NF1Uncertain significancers878853864RCV000228032|RCV001010606; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172953325829533258TG17:g.29533258T>GClinGen:CA10583469
NM_001042492.3(NF1):c.1261_1268delinsCCC (p.Ser421fs)4763NF1Pathogenic-1RCV001239925; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953325829533265TCCGCATTCCC17:g.29533259_29533265del-
NM_000267.3(NF1):c.1263C>T (p.Ser421=)4763NF1Likely benignrs767410768RCV000219603|RCV000632529; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953326029533260CT17:g.29533260C>TClinGen:CA8485742C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.1263C>A (p.Ser421=)4763NF1Uncertain significance-1RCV001214367; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953326029533260CA17:g.29533260C>A-
NM_000267.3(NF1):c.1264G>A (p.Ala422Thr)4763NF1Uncertain significancers786202145RCV000164813|RCV000681190|RCV000706979; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953326129533261GA17:g.29533261G>AClinGen:CA191826C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.1270G>A (p.Asp424Asn)4763NF1Uncertain significance-1RCV001239353; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953326729533267GA17:g.29533267G>A-
NM_000267.3(NF1):c.1274G>C (p.Trp425Ser)4763NF1Uncertain significancers1597688734RCV000812451; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953327129533271GC17:g.29533271G>C-
NM_001042492.3(NF1):c.1275G>A (p.Trp425Ter)4763NF1Pathogenic-1RCV001061335; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953327229533272GA17:g.29533272G>A-
NM_000267.3(NF1):c.1280_1292del (p.Pro427fs)4763NF1Pathogenicrs1135402804RCV000497156; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953327529533287GGCCTAAGATTGATG17:g.29533275_29533287delClinGen:CA645373083
NM_000267.3(NF1):c.1280C>T (p.Pro427Leu)4763NF1Uncertain significancers1597688746RCV000794169; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953327729533277CT17:g.29533277C>T-
NM_001042492.3(NF1):c.1290T>C (p.Asp430=)4763NF1Likely benignrs766688203RCV000875846|RCV001010789; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172953328729533287TC17:g.29533287T>C-
NM_001042492.3(NF1):c.1296_1297dup (p.Tyr433fs)4763NF1Pathogenic-1RCV001215738; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953328929533290CCTG17:g.29533289_29533290insTG-
NM_000267.3(NF1):c.1296G>A (p.Val432=)4763NF1Conflicting interpretations of pathogenicityrs371599283RCV000217043|RCV000232088|RCV000506234|RCV001085063; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MedGen:CN169374|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953329329533293GA17:g.29533293G>AClinGen:CA8485746C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.1296delinsATA (p.Cys434fs)4763NF1Pathogenic-1RCV001246727; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953329329533293GATA17:g.29533293_29533294insTA-
NM_000267.3(NF1):c.1299T>G (p.Tyr433Ter)4763NF1Pathogenicrs876660099RCV000461633|RCV000760822; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202172953329629533296TG17:g.29533296T>GClinGen:CA16615569
NM_000267.3(NF1):c.1304A>G (p.His435Arg)4763NF1Uncertain significancers1555611571RCV000560048; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953330129533301AG17:g.29533301A>GClinGen:CA398999317C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1307C>T (p.Ser436Leu)4763NF1Uncertain significancers755190083RCV000806540|RCV001010903; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172953330429533304CT17:g.29533304C>T-
NM_000267.3(NF1):c.1308G>A (p.Ser436=)4763NF1Conflicting interpretations of pathogenicityrs765425127RCV000164423|RCV000681012|RCV001084179|RCV001124738|RCV001124739|RCV001124740; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0011035,MedGen:C2931482,OMIM:601321, Orphanet:638|MONDO:MONDO:0008078,MedGen:C1834235,OMIM:162210, Orphanet:636|MO172953330529533305GA17:g.29533305G>AClinGen:CA190911C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1309G>T (p.Val437Phe)4763NF1Uncertain significancers1555611574RCV000535947|RCV000574870; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172953330629533306GT17:g.29533306G>TClinGen:CA398999349C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1310T>A (p.Val437Asp)4763NF1Uncertain significancers876658642RCV000218603|RCV000544035; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953330729533307TA17:g.29533307T>AClinGen:CA10580219C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1310T>C (p.Val437Ala)4763NF1Uncertain significancers876658642RCV000458889|RCV000570439; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172953330729533307TC17:g.29533307T>CClinGen:CA16615157
NM_000267.3(NF1):c.1318C>T (p.Arg440Ter)4763NF1Pathogenicrs778405030RCV000213237|RCV000225855|RCV000519956|RCV000762984; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636; Human Phenotype Ontology:HP:0012209,MONDO:MONDO:0011908,MedGen:172953331529533315CT17:g.29533315C>TClinGen:CA8485754C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1319G>A (p.Arg440Gln)4763NF1Uncertain significancers1466678870RCV000692563; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953331629533316GA17:g.29533316G>A-C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.1321A>G (p.Asn441Asp)4763NF1Uncertain significance-1RCV001235125; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953331829533318AG17:g.29533318A>G-
NM_000267.3(NF1):c.1322_1323AT[1] (p.Met442fs)4763NF1Pathogenicrs1135402805RCV000497218; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953331929533320AATA17:g.29533319_29533320delClinGen:CA645373084C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.1324A>G (p.Met442Val)4763NF1Uncertain significance-1RCV001208899; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953332129533321AG17:g.29533321A>G-
NM_000267.3(NF1):c.1328T>C (p.Phe443Ser)4763NF1Conflicting interpretations of pathogenicityrs1555611581RCV000659985; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953332529533325TC17:g.29533325T>C-
NM_000267.3(NF1):c.1330G>C (p.Gly444Arg)4763NF1Uncertain significancers1162173842RCV000566895|RCV000812785; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953332729533327GC17:g.29533327G>CClinGen:CA398999508
NM_000267.3(NF1):c.1331del (p.Gly444fs)4763NF1Pathogenicrs1567838293RCV000689684; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953332729533327TGT17:g.29533327_29533327del-
NM_000267.3(NF1):c.1331G>A (p.Gly444Asp)4763NF1Uncertain significancers1555611582RCV000632326|RCV000681210; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202172953332829533328GA17:g.29533328G>AClinGen:CA398999514C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.1337C>T (p.Thr446Ile)4763NF1Uncertain significance-1RCV001225406; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953333429533334CT17:g.29533334C>T-
NM_000267.3(NF1):c.1340T>C (p.Leu447Pro)4763NF1Likely pathogenicrs1597688896RCV000821261; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953333729533337TC17:g.29533337T>C-
NM_000267.3(NF1):c.1343dup (p.His448fs)4763NF1Pathogenicrs1555611584RCV000476377; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953333929533340CCA17:g.29533339_29533340insAClinGen:CA16615160
NM_000267.3(NF1):c.1344dup (p.Lys449Ter)4763NF1Pathogenicrs1567838311RCV000691036; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953334029533341AAT17:g.29533340_29533341insT-C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.1346_1347dup (p.Ala450fs)4763NF1Pathogenic-1RCV001206265; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953334129533342TTAA17:g.29533341_29533342insAA-
NM_001042492.3(NF1):c.1348_1349dup (p.Val451fs)4763NF1Pathogenic-1RCV001224853; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953334429533345AAGC17:g.29533344_29533345insGC-
NM_000267.3(NF1):c.1352T>C (p.Val451Ala)4763NF1Uncertain significancers747466938RCV000219244|RCV001061906; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953334929533349TC17:g.29533349T>CClinGen:CA10580220C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1352T>G (p.Val451Gly)4763NF1Uncertain significancers747466938RCV000792004; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953334929533349TG17:g.29533349T>G-
NM_000267.3(NF1):c.1354C>T (p.Gln452Ter)4763NF1Pathogenicrs1555611590RCV000632336; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953335129533351CT17:g.29533351C>TClinGen:CA398999651
NM_001042492.3(NF1):c.1355A>T (p.Gln452Leu)4763NF1Uncertain significance-1RCV001070745; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953335229533352AT17:g.29533352A>T-
NM_000267.3(NF1):c.1356A>G (p.Gln452=)4763NF1Likely benignrs1324833228RCV000537574|RCV000569656; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172953335329533353AG17:g.29533353A>GClinGen:CA499222573C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1357G>A (p.Gly453Ser)4763NF1Uncertain significancers1273060925RCV000632314|RCV001011155; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172953335429533354GA17:g.29533354G>AClinGen:CA398999678C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1358G>T (p.Gly453Val)4763NF1Uncertain significancers876660915RCV000222296|RCV000632390; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953335529533355GT17:g.29533355G>TClinGen:CA10580221C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1359T>C (p.Gly453=)4763NF1Likely benignrs1555611595RCV000632589; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953335629533356TC17:g.29533356T>CClinGen:CA499222588
NM_001042492.3(NF1):c.1362T>A (p.Cys454Ter)4763NF1Pathogenic-1RCV001243556; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953335929533359TA17:g.29533359T>A-
NM_000267.3(NF1):c.1369C>T (p.His457Tyr)4763NF1Uncertain significancers757560526RCV000232404; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953336629533366CT17:g.29533366C>TClinGen:CA8485756C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1370_1372del (p.His457del)4763NF1Uncertain significancers1567838357RCV000690671; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953336629533368ACACA17:g.29533366_29533368del-
NM_001042492.3(NF1):c.1370A>T (p.His457Leu)4763NF1Uncertain significancers786202763RCV000165738|RCV000709412; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953336729533367AT17:g.29533367A>TClinGen:CA194111C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1371C>T (p.His457=)4763NF1Likely benignrs1318894606RCV000549922|RCV001011192; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172953336829533368CT17:g.29533368C>TClinGen:CA499222632C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1372C>G (p.Pro458Ala)4763NF1Uncertain significancers1597688990RCV000804852; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953336929533369CG17:g.29533369C>G-
NM_000267.3(NF1):c.1374dup (p.Ala459fs)4763NF1Pathogenicrs1135402806RCV000497074; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953337029533371CCA17:g.29533370_29533371insAClinGen:CA645373085
NM_000267.3(NF1):c.1374A>G (p.Pro458=)4763NF1Likely benignrs1555611601RCV000632622; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953337129533371AG17:g.29533371A>GClinGen:CA499222645
NM_000267.3(NF1):c.1376C>A (p.Ala459Glu)4763NF1Uncertain significancers1131691070RCV000492466|RCV001054075; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953337329533373CA17:g.29533373C>AClinGen:CA398999818C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.1376C>T (p.Ala459Val)4763NF1Uncertain significance-1RCV001060565; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953337329533373CT17:g.29533373C>T-
NM_000267.3(NF1):c.1379T>C (p.Ile460Thr)4763NF1Uncertain significancers147417054RCV000803750|RCV001011255; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172953337629533376TC17:g.29533376T>C-
NM_000267.3(NF1):c.1381C>T (p.Arg461Ter)4763NF1Pathogenicrs878853865RCV000229618|RCV000255390|RCV000492771; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172953337829533378CT17:g.29533378C>TClinGen:CA10583470
NM_000267.3(NF1):c.1382G>A (p.Arg461Gln)4763NF1Uncertain significancers1555611606RCV000707265|RCV001011292; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172953337929533379GA17:g.29533379G>A-
NM_000267.3(NF1):c.1389A>G (p.Ala463=)4763NF1Likely benignrs1131923RCV000206534; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953338629533386AG17:g.29533386A>GClinGen:CA350557
NM_000267.3(NF1):c.1391C>T (p.Pro464Leu)4763NF1Uncertain significancers1269425503RCV000688496|RCV001011300; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172953338829533388CT17:g.29533388C>T-
NM_000267.3(NF1):c.1392G>A (p.Pro464=)4763NF1Uncertain significancers201604273RCV000165625|RCV000534388; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953338929533389GA17:g.29533389G>AClinGen:CA193852C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1392G>T (p.Pro464=)4763NF1Uncertain significancers201604273RCV000470630; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953338929533389GT17:g.29533389G>TClinGen:CA16615162
NM_000267.3(NF1):c.1392+1del4763NF1Likely pathogenicrs1060500347RCV000457531; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953338929533389CGC17:g.29533389_29533389delClinGen:CA16615571
NM_001042492.3(NF1):c.1392+1G>A4763NF1Pathogenicrs267604791RCV000497249|RCV001011301; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172953339029533390GA17:g.29533390G>AClinGen:CA289352384C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.1392+1G>C4763NF1Pathogenicrs267604791RCV000710039; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953339029533390GC17:g.29533390G>C-
NM_000267.3(NF1):c.1392+2T>C4763NF1Likely pathogenicrs1555611610RCV000557922; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953339129533391TC17:g.29533391T>CClinGen:CA398999983C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1392+5_1392+6delinsTT4763NF1Conflicting interpretations of pathogenicityrs587782851RCV000132450|RCV000226320|RCV000413830; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202172953339429533395GATTNC_000017.10:g.29533394_29533395delinsTTClinGen:CA169876C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1392+5G>A4763NF1Uncertain significancers199999754RCV000570623|RCV000820049; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953339429533394GA17:g.29533394G>AClinGen:CA658656585
NM_001042492.3(NF1):c.1392+6A>T4763NF1Uncertain significance-1RCV001125730|RCV001125731|RCV001125732|RCV001125733; NMONDO:MONDO:0011035,MedGen:C2931482,OMIM:601321, Orphanet:638|MONDO:MONDO:0008672,MedGen:C0553586,OMIM:193520, Orphanet:3444|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0008078,MedGen:C1834235,OMIM:162210, Orphanet:636172953339529533395AT17:g.29533395A>T-
NM_000267.3(NF1):c.1392+7T>C4763NF1Conflicting interpretations of pathogenicityrs773017698RCV000203728|RCV001174611; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN169374172953339629533396TC17:g.29533396T>CClinGen:CA348027C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1393-3329_3975-6377del4763NF1Pathogenic-1RCV000200927; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953814029569625nana-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1393-2652_1528-892del4763NF1Pathogenic-1RCV000200946; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953881729545131nanaClinGen:CA277598C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1393-2488_1642-648delinsAATAG4763NF1Pathogenic-1RCV000200897; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953898129548220nanaClinGen:CA277555
NM_000267.3(NF1):c.1393-1905_2251+85dup4763NF1Pathogenic-1RCV000200925; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172953956429553787nana-C0027831 162200 Neurofibromatosis, type 1;
NC_000017.10:g.(?_29540877)_(29563299_?)dup4763NF1Likely pathogenic-1RCV000824670; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954087729563299nana-
NM_000267.3(NF1):c.1393-9T>C4763NF1Likely benignrs1314978150RCV000632595; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954146029541460TC17:g.29541460T>CClinGen:CA625468523
NM_000267.3(NF1):c.1393-2dup4763NF1Uncertain significancers1394021280RCV000599029|RCV000694620; NMedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954146629541467TTA17:g.29541466_29541467insAClinGen:CA658798761
NM_001042492.3(NF1):c.1393-3_1393-2del4763NF1Likely pathogenic-1RCV001235825; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954146629541467TTAT17:g.29541466_29541467del-
NM_000267.3(NF1):c.1393-2A>G4763NF1Likely pathogenicrs1555612266RCV000582848; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954146729541467AG17:g.29541467A>GClinGen:CA399001399
NM_000267.3(NF1):c.1393-2A>T4763NF1Likely pathogenicrs1555612266RCV000692983; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954146729541467AT17:g.29541467A>T-
NM_000267.3(NF1):c.1393_1394delAG4763NF1Pathogenicrs1597698310RCV000809363|RCV001011307; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172954146729541468TAGT17:g.29541467_29541468del-
NM_000267.3(NF1):c.1393-1G>T4763NF1Likely pathogenicrs1131691131RCV000492402|RCV000551562; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954146829541468GT17:g.29541468G>TClinGen:CA399001402C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1393-1G>C4763NF1Likely pathogenicrs1131691131RCV000659986; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954146829541468GC17:g.29541468G>C-
NM_000267.3(NF1):c.1393-1G>A4763NF1Likely pathogenicrs1131691131RCV000704410; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954146829541468GA17:g.29541468G>A-C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.1394del (p.Ser465fs)4763NF1Pathogenic-1RCV001234570; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954147029541470AGA17:g.29541470_29541470del-
NM_000267.3(NF1):c.1400del (p.Thr467fs)4763NF1Pathogenicrs1135402808RCV000497080; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954147629541476ACA17:g.29541476_29541476delClinGen:CA645373086C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1400_1415del (p.Thr467fs)4763NF1Pathogenicrs1555612270RCV000581163; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954147629541491ACATTTAAAGAAAAAGTA17:g.29541476_29541491delClinGen:CA658684010C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1414_1440dup (p.Val472_Lys480dup)4763NF1Uncertain significancers1597698326RCV000819729; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954147629541477CCATTTAAAGAAAAAGTAACAAGCCTTAA17:g.29541476_29541477insATTTAAAGAAAAAGTAACAAGCCTTAA-
NM_000267.3(NF1):c.1405A>G (p.Lys469Glu)4763NF1Uncertain significancers1555612271RCV000632467; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954148129541481AG17:g.29541481A>GClinGen:CA399001433
NM_001042492.3(NF1):c.1406A>G (p.Lys469Arg)4763NF1Uncertain significance-1RCV001045744; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954148229541482AG17:g.29541482A>G-
NM_001042492.3(NF1):c.1408G>T (p.Glu470Ter)4763NF1Pathogenic/Likely pathogenicrs1597698330RCV001011422|RCV001054653|RCV001192726; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0021060,MedGen:CN166718, Orphanet:536391172954148429541484GT17:g.29541484G>T-
NM_001042492.3(NF1):c.1413del (p.Lys471_Val472insTer)4763NF1Pathogenic-1RCV001253268; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954148529541485GAG17:g.29541485_29541485del-
NM_000267.3(NF1):c.1410A>C (p.Glu470Asp)4763NF1Uncertain significancers786203090RCV000166241|RCV000809613; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954148629541486AC17:g.29541486A>CClinGen:CA195351
NM_000267.3(NF1):c.1413_1414delinsT (p.Lys471fs)4763NF1Likely pathogenicrs1555612273RCV000659987; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954148929541490AGT17:g.29541490_29541490del-
NM_000267.3(NF1):c.1423dup (p.Leu475fs)4763NF1Pathogenicrs1555612274RCV000632369; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954149729541498GGC17:g.29541497_29541498insCClinGen:CA658798762
NM_001042492.3(NF1):c.1421G>C (p.Ser474Thr)4763NF1Uncertain significance-1RCV001215601; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954149729541497GC17:g.29541497G>C-
NM_001042492.3(NF1):c.1422C>T (p.Ser474=)4763NF1Likely benignrs1597698349RCV000976179; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954149829541498CT17:g.29541498C>T-
NM_001042492.3(NF1):c.1426A>G (p.Lys476Glu)4763NF1Uncertain significance-1RCV001051977; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954150229541502AG17:g.29541502A>G-
NM_001042492.3(NF1):c.1431T>A (p.Phe477Leu)4763NF1Uncertain significance-1RCV001055250; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954150729541507TA17:g.29541507T>A-
NM_000267.3(NF1):c.1444A>G (p.Thr482Ala)4763NF1Uncertain significancers770201871RCV000266747|RCV000303184|RCV000357860|RCV000361439|RCV000568934; NMONDO:MONDO:0008078,MedGen:C1834235,OMIM:162210, Orphanet:636|MONDO:MONDO:0011035,MedGen:C2931482,OMIM:601321, Orphanet:638|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0008672,MedGen:C0553586,OMIM:193520, Orphanet:3444|MONDO:MO172954152029541520AG17:g.29541520A>GClinGen:CA8485787
NM_001042492.3(NF1):c.1450C>T (p.Leu484=)4763NF1Likely benignrs876657544RCV000214704|RCV000230221|RCV001011651; NMedGen:CN169374|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172954152629541526CT17:g.29541526C>TClinGen:CA10577031
NM_000267.3(NF1):c.1453G>T (p.Glu485Ter)4763NF1Pathogenicrs1131691610RCV000493049|RCV001240173; NMedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954152929541529GT17:g.29541529G>TClinGen:CA399001544CN517202 not provided;
NM_000267.3(NF1):c.1456A>T (p.Thr486Ser)4763NF1Uncertain significancers1060500305RCV000465380; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954153229541532AT17:g.29541532A>TClinGen:CA16615438
NM_000267.3(NF1):c.1457C>T (p.Thr486Ile)4763NF1Uncertain significancers1019393337RCV000803652; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954153329541533CT17:g.29541533C>T-
NM_000267.3(NF1):c.1458A>G (p.Thr486=)4763NF1Likely benignrs878853866RCV000232864; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954153429541534AG17:g.29541534A>GClinGen:CA10583471C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1460G>A (p.Arg487Lys)4763NF1Uncertain significancers1135402809RCV000497138; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954153629541536GA17:g.29541536G>AClinGen:CA399001557
NM_000267.3(NF1):c.1462del (p.Ser488fs)4763NF1Pathogenicrs1135402810RCV000497235; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954153729541537GAG17:g.29541537_29541537delClinGen:CA645373087C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.1465T>G (p.Tyr489Asp)4763NF1Uncertain significance-1RCV001044577; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954154129541541TG17:g.29541541T>G-
NM_000267.3(NF1):c.1466A>G (p.Tyr489Cys)4763NF1Pathogenicrs137854557RCV000000382|RCV000492667|RCV000757556|RCV001009573|RCV001257527; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|Human Phenotype Ontology:HP:0009736,MedGen:C4024216; MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|Human Pheno172954154229541542AG17:g.29541542A>GClinGen:CA325499,UniProtKB:P21359#VAR_032465,OMIM:613113.0023C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1469_1472del (p.Lys490fs)4763NF1Pathogenicrs1135402811RCV000497174; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954154329541546ATAAGA17:g.29541543_29541546delClinGen:CA645373088C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1469_1470insTTAT (p.Lys490fs)4763NF1Pathogenicrs1060500307RCV000476612; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954154529541546AATTAT17:g.29541545_29541546insTTATClinGen:CA16615161
NM_000267.3(NF1):c.1469A>G (p.Lys490Arg)4763NF1Uncertain significancers1060500260RCV000474322; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954154529541545AG17:g.29541545A>GClinGen:CA16615439
NM_000267.3(NF1):c.1472A>G (p.Tyr491Cys)4763NF1Uncertain significancers199474757RCV000059152|RCV000564567|RCV000703856; NMedGen:CN517202|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954154829541548AG17:g.29541548A>GClinGen:CA219388,UniProtKB:P21359#VAR_021734,UniProtKB/Swiss-Prot:VAR_021734C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.1477_1481del (p.Leu493fs)4763NF1Pathogenic-1RCV001062865; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954154929541553ATCTTCA17:g.29541549_29541553del-
NM_000267.3(NF1):c.1477C>G (p.Leu493Val)4763NF1Uncertain significancers1135402812RCV000497030; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954155329541553CG17:g.29541553C>GClinGen:CA399001598
NM_000267.3(NF1):c.1479C>G (p.Leu493=)4763NF1Likely benignrs139653388RCV000204003|RCV000215807; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172954155529541555CG17:g.29541555C>GClinGen:CA348278
NM_000267.3(NF1):c.1480T>A (p.Leu494Met)4763NF1Uncertain significancers878853867RCV000227789; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954155629541556TA17:g.29541556T>AClinGen:CA10583472
NM_000267.3(NF1):c.1490del (p.Val497fs)4763NF1Likely pathogenicrs1555612286RCV000659988; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954156629541566GTG17:g.29541566_29541566del-
NM_000267.3(NF1):c.1495C>T (p.Leu499=)4763NF1Likely benignrs764095472RCV000163791|RCV000920490; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954157129541571CT17:g.29541571C>TClinGen:CA189188C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1496T>C (p.Leu499Pro)4763NF1Uncertain significancers1555612288RCV000632384|RCV001011788; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172954157229541572TC17:g.29541572T>CClinGen:CA399001640
NM_000267.3(NF1):c.1496T>G (p.Leu499Arg)4763NF1Pathogenic/Likely pathogenicrs1555612288RCV000659989; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954157229541572TG17:g.29541572T>G-
NM_001042492.3(NF1):c.1499T>A (p.Ile500Asn)4763NF1Uncertain significance-1RCV001036201; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954157529541575TA17:g.29541575T>A-
NM_000267.3(NF1):c.1510C>A (p.Pro504Thr)4763NF1Uncertain significancers1597698495RCV000798340|RCV001011956; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172954158629541586CA17:g.29541586C>A-
NM_000267.3(NF1):c.1514del (p.Lys505fs)4763NF1Pathogenicrs1555612289RCV000548382; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954158829541588CAC17:g.29541588_29541588delClinGen:CA658656586C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.1513A>G (p.Lys505Glu)4763NF1Likely pathogenic-1RCV001041596; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954158929541589AG17:g.29541589A>G-
NM_000267.3(NF1):c.1525dup (p.Cys509fs)4763NF1Pathogenicrs1135402813RCV000497090; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954159829541599CCT17:g.29541598_29541599insTClinGen:CA645373089C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1522C>T (p.Leu508Phe)4763NF1Uncertain significancers1597698512RCV000794183; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954159829541598CT17:g.29541598C>T-
NM_001042492.3(NF1):c.1522del (p.Leu508fs)4763NF1Pathogenic-1RCV001060965; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954159829541598GCG17:g.29541598_29541598del-
NM_000267.3(NF1):c.1523T>C (p.Leu508Pro)4763NF1Pathogenicrs137854558RCV000000383; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954159929541599TC17:g.29541599T>CClinGen:CA251467,UniProtKB:P21359#VAR_010991,OMIM:613113.0024C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1525del (p.Cys509fs)4763NF1Pathogenicrs1135402813RCV000703057; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954159929541599CTC17:g.29541599_29541599del-
NM_001042492.3(NF1):c.1526G>A (p.Cys509Tyr)4763NF1Uncertain significancers1597698521RCV001012017|RCV001069104; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954160229541602GA17:g.29541602G>A-
NM_000267.3(NF1):c.1527+1G>T4763NF1Pathogenicrs1060500331RCV000461603; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954160429541604GT17:g.29541604G>TClinGen:CA16615446
NM_000267.3(NF1):c.1527+1G>C4763NF1Pathogenicrs1060500331RCV000497180; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954160429541604GC17:g.29541604G>CClinGen:CA399001712C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.1527+4_1527+7del4763NF1Likely pathogenicrs1555612294RCV000529073|RCV001012019; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172954160429541607TGTAAT17:g.29541604_29541607delClinGen:CA645571236C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1527+1G>A4763NF1Pathogenic/Likely pathogenicrs1060500331RCV000599578|RCV000632460; NMedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954160429541604GA17:g.29541604G>AClinGen:CA399001711C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1527+2dup4763NF1Conflicting interpretations of pathogenicityrs1597698533RCV000803206|RCV001267421; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MeSH:D030342,MedGen:C0950123172954160429541605GGT17:g.29541604_29541605insT-
NM_000267.3(NF1):c.1527+2T>C4763NF1Likely pathogenicrs1064796700RCV000659990; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954160529541605TC17:g.29541605T>C-
NM_001042492.3(NF1):c.1527+3A>C4763NF1Uncertain significance-1RCV001047748; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954160629541606AC17:g.29541606A>C-
NM_000267.3(NF1):c.1527+5G>A4763NF1Conflicting interpretations of pathogenicityrs1060500352RCV000460682; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954160829541608GA17:g.29541608G>AClinGen:CA16615165
NM_000267.3(NF1):c.1527+5G>C4763NF1Uncertain significancers1060500352RCV000541390; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954160829541608GC17:g.29541608G>CClinGen:CA658656589C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1527+7A>T4763NF1Likely benignrs1555612295RCV000632534; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954161029541610AT17:g.29541610A>TClinGen:CA658798766C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1527+443_3709-761dup4763NF1Pathogenic-1RCV000200871; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954204629561868nana-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1527+1159C>T4763NF1Uncertain significancers878853868RCV000229504; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954276229542762CT17:g.29542762C>TClinGen:CA10583473C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1527+1509_1641+1137del4763NF1Pathogenic-1RCV000200944; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954311229547273nanaClinGen:CA277597C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1528-960_1761del4763NF1Pathogenic-1RCV000200890; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954506329550501nanaClinGen:CA277549C0027831 162200 Neurofibromatosis, type 1;
NC_000017.11:g.(?_31218985)_(31222471_?)del4763NF1Pathogenic-1RCV001033729; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954600329549489nana-1-
NC_000017.11:g.(?_31218985)_(31374175_?)del4763NF1Pathogenic-1RCV001032896; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954600329701193nana-1-
NM_000267.3(NF1):c.1528-10T>C4763NF1Likely benignrs376174484RCV000196509; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954601329546013TC17:g.29546013T>CClinGen:CA336481C0027831 162200 Neurofibromatosis, type 1;
NC_000017.11:g.(?_31218995)_(31374165_?)del4763NF1Pathogenic-1RCV000806570; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954601329701183nana-
NM_000267.3(NF1):c.1528-9T>C4763NF1Likely benignrs1060503916RCV000471915; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954601429546014TC17:g.29546014T>CClinGen:CA16615163
NC_000017.10:g.(?_29546017)_(29585526_?)dup4763NF1Uncertain significance-1RCV000533122; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954601729585526nana-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1528-3C>T4763NF1Uncertain significancers1060500294RCV000463084|RCV001012021; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172954602029546020CT17:g.29546020C>TClinGen:CA16615449
NM_001042492.3(NF1):c.1528-2A>G4763NF1Likely pathogenic-1RCV001234067; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954602129546021AG17:g.29546021A>G-
NM_000267.3(NF1):c.1528-1G>T4763NF1Conflicting interpretations of pathogenicityrs876660595RCV000576086|RCV000989785; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954602229546022GT17:g.29546022G>TClinGen:CA399001810C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1529A>C (p.Asn510Thr)4763NF1Uncertain significancers876660091RCV000706132; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954602429546024AC17:g.29546024A>C-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1540C>T (p.Gln514Ter)4763NF1Pathogenicrs1316926587RCV000659991; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954603529546035CT17:g.29546035C>T-
NM_000267.3(NF1):c.1541_1542del (p.Gln514fs)4763NF1Pathogenicrs267606600RCV000000374|RCV000164295|RCV000414730|RCV001001001; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MedGen:CN169374172954603629546037CAGC17:g.29546036_29546037delClinGen:CA190564,OMIM:613113.0014C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1541A>C (p.Gln514Pro)4763NF1Conflicting interpretations of pathogenicityrs775369084RCV000222304|RCV000233491; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954603629546036AC17:g.29546036A>CClinGen:CA8485806C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1541del (p.Gln514fs)4763NF1Pathogenicrs1555612815RCV000520958|RCV000659992; NMedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954603629546036CAC17:g.29546036_29546036delClinGen:CA658656590C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1545G>A (p.Gly515=)4763NF1Likely benignrs876658203RCV000213955|RCV000869541; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954604029546040GA17:g.29546040G>AClinGen:CA10580226C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1548C>T (p.Pro516=)4763NF1Likely benignrs768883989RCV000165212|RCV000200233; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954604329546043CT17:g.29546043C>TClinGen:CA192784C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1548C>G (p.Pro516=)4763NF1Likely benignrs768883989RCV000215600|RCV000681319|RCV001087139; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954604329546043CG17:g.29546043C>GClinGen:CA338131
NM_000267.3(NF1):c.1549G>A (p.Glu517Lys)4763NF1Uncertain significancers587778548RCV000121626|RCV000132222|RCV000195429|RCV000681180; NMedGen:CN169374|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202172954604429546044GA17:g.29546044G>AClinGen:CA161005C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1549G>T (p.Glu517Ter)4763NF1Pathogenicrs587778548RCV000632515; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954604429546044GT17:g.29546044G>TClinGen:CA399001856C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1553C>T (p.Thr518Ile)4763NF1Uncertain significancers587782696RCV000132136|RCV000681295|RCV000693666; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954604829546048CT17:g.29546048C>TClinGen:CA169328C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.1555del (p.Gln519fs)4763NF1Pathogenic-1RCV001061848; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954604829546048ACA17:g.29546048_29546048del-
NM_000267.3(NF1):c.1554C>A (p.Thr518=)4763NF1Likely benignrs876660849RCV000462162|RCV000571494|RCV000613787; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MedGen:CN169374172954604929546049CA17:g.29546049C>AClinGen:CA16615164
NM_001042492.3(NF1):c.1555C>T (p.Gln519Ter)4763NF1Pathogenic-1RCV001039275; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954605029546050CT17:g.29546050C>T-
NM_000267.3(NF1):c.1561del (p.Ser521fs)4763NF1Pathogenicrs1135402814RCV000497035; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954605629546056CAC17:g.29546056_29546056delClinGen:CA645372615
NM_001042492.3(NF1):c.1564dup (p.Thr522fs)4763NF1Pathogenic-1RCV001064493; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954605829546059TTA17:g.29546058_29546059insA-
NM_000267.3(NF1):c.1569A>G (p.Ala523=)4763NF1Likely benignrs1555612830RCV000632590; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954606429546064AG17:g.29546064A>GClinGen:CA499226727
NM_000267.3(NF1):c.1570G>T (p.Glu524Ter)4763NF1Pathogenicrs1135402815RCV000497127|RCV001012232; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172954606529546065GT17:g.29546065G>TClinGen:CA399001902C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.1573T>A (p.Leu525Ile)4763NF1Uncertain significance-1RCV001069189; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954606829546068TA17:g.29546068T>A-
NM_000267.3(NF1):c.1579A>T (p.Thr527Ser)4763NF1Uncertain significancers1567843874RCV000696834; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954607429546074AT17:g.29546074A>T-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1581A>C (p.Thr527=)4763NF1Likely benignrs1060503907RCV000456467; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954607629546076AC17:g.29546076A>CClinGen:CA16615168
NM_000267.3(NF1):c.1585C>T (p.Leu529Phe)4763NF1Uncertain significancers1135402816RCV000497216; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954608029546080CT17:g.29546080C>TClinGen:CA399001938
NM_000267.3(NF1):c.1587C>T (p.Leu529=)4763NF1Likely benignrs786203041RCV000166175|RCV000532646|RCV000599970; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN169374172954608229546082CT17:g.29546082C>TClinGen:CA195175C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1588G>A (p.Val530Ile)4763NF1Conflicting interpretations of pathogenicityrs145191978RCV000129860|RCV000205363|RCV000489208|RCV000761180; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202|Human Phenotype Ontology:HP:0004833,Human Phenotype Ontology:HP:0004845,MedGen:C0023465; MedGen:C0457334172954608329546083GA17:g.29546083G>AClinGen:CA165238C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1593A>G (p.Gln531=)4763NF1Likely benignrs773712266RCV000166195|RCV000233876; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954608829546088AG17:g.29546088A>GClinGen:CA195216C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1593A>C (p.Gln531His)4763NF1Uncertain significancers773712266RCV000231005; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954608829546088AC17:g.29546088A>CClinGen:CA10583474
NM_000267.3(NF1):c.1595T>C (p.Leu532Pro)4763NF1Pathogenicrs199474737RCV000059154|RCV000168173; NMedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954609029546090TC17:g.29546090T>CClinGen:CA219397,UniProtKB:P21359#VAR_032466,UniProtKB/Swiss-Prot:VAR_032466C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1595T>G (p.Leu532Arg)4763NF1Pathogenicrs199474737RCV000227710; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954609029546090TG17:g.29546090T>GClinGen:CA10583475
NM_000267.3(NF1):c.1598T>G (p.Val533Gly)4763NF1Likely pathogenicrs1555612857RCV000659993; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954609329546093TG17:g.29546093T>G-
NM_000267.3(NF1):c.1599C>G (p.Val533=)4763NF1Benign/Likely benignrs369458366RCV000163792|RCV000206359|RCV000606948; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN169374172954609429546094CG17:g.29546094C>GClinGen:CA189193C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1600C>T (p.Pro534Ser)4763NF1Uncertain significancers1555612858RCV000540676; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954609529546095CT17:g.29546095C>TClinGen:CA399001965C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1603C>T (p.Gln535Ter)4763NF1Pathogenicrs1567843917RCV000693256|RCV001009574; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636; Human Phenotype Ontology:HP:0009736,MedGen:C4024216172954609829546098CT17:g.29546098C>T-
NM_001042492.3(NF1):c.1606_1607del (p.Ser536fs)4763NF1Pathogenic-1RCV001239689; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954610129546102GTCG17:g.29546101_29546102del-
NM_000267.3(NF1):c.1607C>A (p.Ser536Ter)4763NF1Pathogenicrs1555612859RCV000659994; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954610229546102CA17:g.29546102C>A-
NM_000267.3(NF1):c.1607C>G (p.Ser536Ter)4763NF1Likely pathogenicrs1555612859RCV000659995; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954610229546102CG17:g.29546102C>G-
NM_001042492.3(NF1):c.1607C>T (p.Ser536Leu)4763NF1Uncertain significance-1RCV001041143; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954610229546102CT17:g.29546102C>T-
NM_001042492.3(NF1):c.1607_1608CA[2] (p.Met538fs)4763NF1Pathogenic-1RCV001069042; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954610229546103TCAT17:g.29546102_29546103del-
NM_000267.3(NF1):c.1609C>T (p.His537Tyr)4763NF1Uncertain significancers786203860RCV000167353|RCV000706994; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954610429546104CT17:g.29546104C>TClinGen:CA198074C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1613del (p.Met538fs)4763NF1Pathogenicrs1135402817RCV000497039; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954610829546108ATA17:g.29546108_29546108delClinGen:CA645372616C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1615C>G (p.Pro539Ala)4763NF1Uncertain significancers1060500366RCV000463111; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954611029546110CG17:g.29546110C>GClinGen:CA16615169
NM_000267.3(NF1):c.1618G>T (p.Glu540Ter)4763NF1Pathogenicrs1567843930RCV000703087; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954611329546113GT17:g.29546113G>T-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1619del (p.Glu540fs)4763NF1Pathogenicrs1567843934RCV000687049; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954611429546114GAG17:g.29546114_29546114del-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1620G>T (p.Glu540Asp)4763NF1Uncertain significancers766748586RCV000166167|RCV000553024; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954611529546115GT17:g.29546115G>TClinGen:CA195153C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.1623T>A (p.Ile541=)4763NF1Likely benignrs1597703569RCV000899234|RCV001012451; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172954611829546118TA17:g.29546118T>A-
NM_000267.3(NF1):c.1627C>T (p.Gln543Ter)4763NF1Pathogenicrs894292181RCV000568252|RCV000698954; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954612229546122CT17:g.29546122C>TClinGen:CA289359163
NM_001042492.3(NF1):c.1636A>G (p.Met546Val)4763NF1Uncertain significance-1RCV001044247; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954613129546131AG17:g.29546131A>G-
NM_001042492.3(NF1):c.1639dup (p.Glu547fs)4763NF1Pathogenic-1RCV001052222; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954613229546133TTG17:g.29546132_29546133insG-
NM_000267.3(NF1):c.1641+1G>A4763NF1Likely pathogenicrs1555612866RCV000529214|RCV000786797; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202172954613729546137GA17:g.29546137G>AClinGen:CA399002191C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1641+2del4763NF1Likely pathogenicrs1135402818RCV000497130; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954613829546138GTG17:g.29546138_29546138delClinGen:CA645372617C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1641+2T>C4763NF1Likely pathogenicrs1555612867RCV000659996; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954613829546138TC17:g.29546138T>C-
NM_000267.3(NF1):c.1641+3A>G4763NF1Uncertain significancers754159326RCV000546664; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954613929546139AG17:g.29546139A>GClinGen:CA8485809C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.1641+4A>C4763NF1Uncertain significance-1RCV001202739; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954614029546140AC17:g.29546140A>C-
NM_001042492.3(NF1):c.1641+5G>C4763NF1Uncertain significance-1RCV001222994; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954614129546141GC17:g.29546141G>C-
NM_000267.3(NF1):c.1641+7G>C4763NF1Likely benignrs1060503887RCV000465917; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954614329546143GC17:g.29546143G>CClinGen:CA16615574
NM_000267.3(NF1):c.1641+8G>C4763NF1Likely benignrs758022528RCV000477089; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954614429546144GC17:g.29546144G>CClinGen:CA16615170
NM_000267.3(NF1):c.1641+156_3975-2222del4763NF1Pathogenic-1RCV000200929; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954629229573780nana-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1642-449A>G4763NF1Uncertain significancers863224655RCV000197971; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954841929548419AG17:g.29548419A>GClinGen:CA337564C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.1642-10A>G4763NF1Conflicting interpretations of pathogenicityrs1597706578RCV001007741; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954885829548858AG17:g.29548858A>G-
NM_000267.3(NF1):c.1642-9A>G4763NF1Uncertain significancers1597706581RCV000794495; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954885929548859AG17:g.29548859A>G-
NM_000267.3(NF1):c.1642-8A>G4763NF1Pathogenicrs267606602RCV000000380|RCV000190422; NHuman Phenotype Ontology:HP:0012209,MONDO:MONDO:0011908,MedGen:C0349639,OMIM:607785, Orphanet:86834|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954886029548860AG17:g.29548860A>GClinGen:CA114185,OMIM:613113.0021C0349639 607785 Juvenile myelomonocytic leukemia;
NM_001042492.3(NF1):c.1642-7A>G4763NF1Pathogenicrs1597706592RCV001007742; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954886129548861AG17:g.29548861A>G-
NM_000267.3(NF1):c.1642-3C>G4763NF1Conflicting interpretations of pathogenicityrs1597706610RCV000803500|RCV001091256; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202172954886529548865CG17:g.29548865C>G-
NM_000267.3(NF1):c.1642-2A>T4763NF1Pathogenicrs1597706620RCV000819523; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954886629548866AT17:g.29548866A>T-
NM_000267.3(NF1):c.1642-1G>A4763NF1Pathogenic/Likely pathogenicrs1555613185RCV000659997; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954886729548867GA17:g.29548867G>A-
NM_001042492.3(NF1):c.1642G>T (p.Ala548Ser)4763NF1Uncertain significance-1RCV001034792; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954886829548868GT17:g.29548868G>T-
NM_000267.3(NF1):c.1643C>T (p.Ala548Val)4763NF1Uncertain significancers1567844997RCV000692742|RCV001012548; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172954886929548869CT17:g.29548869C>T-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1646T>C (p.Leu549Pro)4763NF1Pathogenic/Likely pathogenicrs199474758RCV000059155|RCV000632472; NMedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954887229548872TC17:g.29548872T>CClinGen:CA219401,UniProtKB:P21359#VAR_021735,UniProtKB/Swiss-Prot:VAR_021735C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.1646del (p.Leu549fs)4763NF1Pathogenic-1RCV001227758; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954887229548872CTC17:g.29548872_29548872del-
NM_000267.3(NF1):c.1649T>C (p.Leu550Pro)4763NF1Uncertain significancers886052798RCV000263054|RCV000277617|RCV000318328|RCV000354441; NMONDO:MONDO:0008672,MedGen:C0553586,OMIM:193520, Orphanet:3444|MONDO:MONDO:0011035,MedGen:C2931482,OMIM:601321, Orphanet:638|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0008078,MedGen:C1834235,OMIM:162210, Orphanet:636172954887529548875TC17:g.29548875T>CClinGen:CA10639323
NM_000267.3(NF1):c.1650G>C (p.Leu550=)4763NF1Likely benignrs1555613190RCV000681286|RCV001012574|RCV001085611; NMedGen:CN517202|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954887629548876GC17:g.29548876G>CClinGen:CA499228172C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1655T>G (p.Leu552Arg)4763NF1Uncertain significancers1555613193RCV000659998; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954888129548881TG17:g.29548881T>G-
NM_000267.3(NF1):c.1658A>G (p.His553Arg)4763NF1Pathogenic/Likely pathogenicrs1064794274RCV000480683|RCV000632424; NMedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954888429548884AG17:g.29548884A>GClinGen:CA16620358C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1660C>T (p.Gln554Ter)4763NF1Pathogenic/Likely pathogenicrs953440640RCV000659999|RCV000756430; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202172954888629548886CT17:g.29548886C>T-
NM_000267.3(NF1):c.1661A>G (p.Gln554Arg)4763NF1Uncertain significancers863224656RCV000199877|RCV000221342|RCV000681098; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MedGen:CN517202172954888729548887AG17:g.29548887A>GClinGen:CA338936C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.1663_1666del (p.Leu555fs)4763NF1Pathogenic-1RCV001241802; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954888729548890CAGTTC17:g.29548887_29548890del-
NM_000267.3(NF1):c.1662G>T (p.Gln554His)4763NF1Uncertain significancers147594815RCV000223315|RCV000230263|RCV000681090; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202172954888829548888GT17:g.29548888G>TClinGen:CA8485823C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1667_1670del (p.Asp556fs)4763NF1Pathogenicrs1135402819RCV000497191; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954889029548893TTAGAT17:g.29548890_29548893delClinGen:CA645373091C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1670G>A (p.Ser557Asn)4763NF1Uncertain significancers1567845046RCV000702479|RCV001012661; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172954889629548896GA17:g.29548896G>A-C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.1671del (p.Ser557fs)4763NF1Pathogenic-1RCV001231775; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954889729548897GCG17:g.29548897_29548897del-
NM_000267.3(NF1):c.1677T>C (p.Asp559=)4763NF1Likely benignrs1209447028RCV000530562; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954890329548903TC17:g.29548903T>CClinGen:CA499228319C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1680del (p.Leu560fs)4763NF1Pathogenicrs1567845069RCV000706151; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954890629548906TGT17:g.29548906_29548906del-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1683G>A (p.Trp561Ter)4763NF1Pathogenicrs1135402820RCV000497046; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954890929548909GA17:g.29548909G>AClinGen:CA399002298C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.1687C>T (p.Pro563Ser)4763NF1Uncertain significance-1RCV001241083; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954891329548913CT17:g.29548913C>T-
NM_001042492.3(NF1):c.1689T>C (p.Pro563=)4763NF1Likely benignrs1445925500RCV000920099; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954891529548915TC17:g.29548915T>C-
NM_001042492.3(NF1):c.1691_1692del (p.Asp564fs)4763NF1Pathogenic-1RCV001223579; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954891729548918GATG17:g.29548917_29548918del-
NM_000267.3(NF1):c.1692T>G (p.Asp564Glu)4763NF1Uncertain significancers1597706718RCV000809943; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954891829548918TG17:g.29548918T>G-
NM_000267.3(NF1):c.1699G>A (p.Val567Ile)4763NF1Uncertain significancers1555613200RCV000543177; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954892529548925GA17:g.29548925G>AClinGen:CA399002335
NM_000267.3(NF1):c.1701A>G (p.Val567=)4763NF1Likely benignrs786203819RCV000167292|RCV000560540; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954892729548927AG17:g.29548927A>GClinGen:CA197936C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1703A>G (p.Glu568Gly)4763NF1Uncertain significancers1597706730RCV000800336; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954892929548929AG17:g.29548929A>G-
NM_000267.3(NF1):c.1707A>G (p.Thr569=)4763NF1Likely benignrs1060503898RCV000469592; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954893329548933AG17:g.29548933A>GClinGen:CA16615581
NM_000267.3(NF1):c.1710T>C (p.Phe570=)4763NF1Likely benignrs1462741584RCV000572316|RCV000953894; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954893629548936TC17:g.29548936T>CClinGen:CA499228591
NM_000267.3(NF1):c.1714del (p.Glu572fs)4763NF1Pathogenicrs876660135RCV000221288|RCV000697442; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954893829548938TGT17:g.29548938_29548938delClinGen:CA10580230C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.1712G>A (p.Trp571Ter)4763NF1Pathogenic-1RCV001044567; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954893829548938GA17:g.29548938G>A-
NM_000267.3(NF1):c.1713G>A (p.Trp571Ter)4763NF1Pathogenicrs863224489RCV000198156; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954893929548939GA17:g.29548939G>AClinGen:CA337698C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1714_1721+5del4763NF1Uncertain significancers1135402821RCV000497108; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954894029548952GGAGATTAGGTATAG17:g.29548940_29548952delClinGen:CA645373092C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1717A>G (p.Ile573Val)4763NF1Uncertain significancers1597706766RCV000800786; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954894329548943AG17:g.29548943A>G-
NM_000267.3(NF1):c.1721G>A (p.Ser574Asn)4763NF1Pathogenic/Likely pathogenicrs1555613206RCV000497645|RCV000538065|RCV000574543|RCV000626735; NMedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|Human Phenotype Ontology:HP:0007416,Human Phenotype Ontology:HP:0007565,MedGen:C1861975,OMIM:114030, Orphanet:2678172954894729548947GA17:g.29548947G>AClinGen:CA399002388C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1721+1G>T4763NF1Pathogenicrs1131691096RCV000492359|RCV000557084; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954894829548948GT17:g.29548948G>TClinGen:CA399002392
NM_001042492.3(NF1):c.1721+1G>A4763NF1Pathogenicrs1131691096RCV000549086; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954894829548948GA17:g.29548948G>AClinGen:CA399002391C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1721+2T>G4763NF1Likely pathogenicrs1567845116RCV000697667; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954894929548949TG17:g.29548949T>G-C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.1721+2T>A4763NF1Likely pathogenic-1RCV001043543; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954894929548949TA17:g.29548949T>A-
NM_001042492.3(NF1):c.1721+3dup4763NF1Uncertain significance-1RCV001039279; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954894929548950TTA17:g.29548949_29548950insA-
NM_001042492.3(NF1):c.1721+4T>A4763NF1Uncertain significance-1RCV001045273; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954895129548951TA17:g.29548951T>A-
NM_000267.3(NF1):c.1721+5A>G4763NF1Conflicting interpretations of pathogenicityrs876658961RCV000222086|RCV000603076|RCV001067676; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MedGen:CN169374|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172954895229548952AG17:g.29548952A>GClinGen:CA10580231C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.1722-26T>C4763NF1Pathogenicrs1597708542RCV001007712; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955043629550436TC17:g.29550436T>C-
NM_001042492.3(NF1):c.1722-20_1722-17del4763NF1Pathogenicrs1597708558RCV001007730; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955044029550443CAATGC17:g.29550440_29550443del-
NM_001042492.3(NF1):c.1722-11T>G4763NF1Pathogenic-1RCV001093649; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955045129550451TG17:g.29550451T>G-
NM_000267.3(NF1):c.1722-9T>G4763NF1Uncertain significancers1567845805RCV000686786; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955045329550453TG17:g.29550453T>G-C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.1722-8_1722-3delinsAAAA4763NF1Pathogenicrs1597708581RCV001007731; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955045429550459TACTGCAAAA17:g.29550455_29550459del-
NM_000267.3(NF1):c.1722-6C>G4763NF1Likely benignrs878853869RCV000227044; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955045629550456CG17:g.29550456C>GClinGen:CA10583476
NM_000267.3(NF1):c.1722-6C>T4763NF1Likely benignrs878853869RCV000632623; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955045629550456CT17:g.29550456C>TClinGen:CA658798774C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.1722-3C>A4763NF1Pathogenicrs770211384RCV001007752; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955045929550459CA17:g.29550459C>A-
NM_000267.3(NF1):c.1722-2A>G4763NF1Pathogenicrs763983337RCV000495999; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955046029550460AG17:g.29550460A>GClinGen:CA399003934C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1724C>G (p.Ser575Ter)4763NF1Pathogenicrs915463951RCV000689166; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955046429550464CG17:g.29550464C>G-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1726C>T (p.Gln576Ter)4763NF1Pathogenicrs1060500278RCV000459704|RCV000478871; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202172955046629550466CT17:g.29550466C>TClinGen:CA16615167
NM_001042492.3(NF1):c.1728_1729del (p.Gln576fs)4763NF1Pathogenic-1RCV001241676; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955046729550468CAAC17:g.29550467_29550468del-
NM_000267.3(NF1):c.1738dup (p.Tyr580fs)4763NF1Pathogenicrs786204255RCV000168460; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955047229550473CCT17:g.29550472_29550473insTClinGen:CA334783
NM_000267.3(NF1):c.1733T>C (p.Leu578Pro)4763NF1Conflicting interpretations of pathogenicityrs199474774RCV000572081|RCV001064262; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955047329550473TC17:g.29550473T>CClinGen:CA399004013
NM_000267.3(NF1):c.1734T>C (p.Leu578=)4763NF1Likely benignrs876658128RCV000213679|RCV000681361|RCV001088968; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955047429550474TC17:g.29550474T>CClinGen:CA10580232C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.1741A>G (p.Ile581Val)4763NF1Uncertain significance-1RCV001235250; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955048129550481AG17:g.29550481A>G-
NM_000267.3(NF1):c.1744T>G (p.Cys582Gly)4763NF1Uncertain significancers1597708661RCV000812301; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955048429550484TG17:g.29550484T>G-
NM_000267.3(NF1):c.1748A>G (p.Lys583Arg)4763NF1Pathogenic/Likely pathogenicrs199474760RCV000059158|RCV000458151|RCV001266321; NMedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MeSH:D030342,MedGen:C0950123172955048829550488AG17:g.29550488A>GClinGen:CA219413,UniProtKB:P21359#VAR_021738,UniProtKB/Swiss-Prot:VAR_021738C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1751A>T (p.Lys584Ile)4763NF1Uncertain significancers1567845855RCV000701646; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955049129550491AT17:g.29550491A>T-C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.1753_1759del (p.Leu585fs)4763NF1Pathogenic-1RCV001038170; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955049229550498AATTAACTA17:g.29550492_29550498del-
NM_000267.3(NF1):c.1756_1759del (p.Thr586fs)4763NF1Pathogenicrs786202782RCV000165769|RCV000467300|RCV000484704|RCV000787330; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202|MONDO:MONDO:0016755,MeSH:D009455,MedGen:C0027830, Orphanet:252183172955049429550497TTAACT17:g.29550494_29550497delClinGen:CA194177
NM_000267.3(NF1):c.1754T>G (p.Leu585Ter)4763NF1Pathogenicrs775670722RCV000681411|RCV001253392; NMedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955049429550494TG17:g.29550494T>G-CN517202 not provided;
NM_000267.3(NF1):c.1756A>C (p.Thr586Pro)4763NF1Uncertain significancers876659242RCV000219393|RCV001221423; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955049629550496AC17:g.29550496A>CClinGen:CA10580233C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1756A>G (p.Thr586Ala)4763NF1Uncertain significancers876659242RCV000824504; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955049629550496AG17:g.29550496A>G-
NM_000267.3(NF1):c.1759A>C (p.Ser587Arg)4763NF1Uncertain significancers1597708695RCV000794506|RCV001013051; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172955049929550499AC17:g.29550499A>C-
NM_001042492.3(NF1):c.1759A>G (p.Ser587Gly)4763NF1Uncertain significance-1RCV001061876; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955049929550499AG17:g.29550499A>G-
NM_001042492.3(NF1):c.1759_1760insTAGTT (p.Ser587fs)4763NF1Pathogenic-1RCV001051668; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955049929550500AATAGTT17:g.29550499_29550500insTAGTT-
NM_000267.3(NF1):c.1764T>C (p.His588=)4763NF1Likely benignrs1229784876RCV000561649|RCV000632559|RCV001199855; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN169374172955050429550504TC17:g.29550504T>CClinGen:CA499229768C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1765C>T (p.Gln589Ter)4763NF1Pathogenicrs1282299543RCV000695424; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955050529550505CT17:g.29550505C>T-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1769T>C (p.Met590Thr)4763NF1Uncertain significancers761559887RCV000464426|RCV000780546|RCV001013086; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN169374|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172955050929550509TC17:g.29550509T>CClinGen:CA8485850
NM_000267.3(NF1):c.1771C>G (p.Leu591Val)4763NF1Uncertain significancers767247726RCV000463207; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955051129550511CG17:g.29550511C>GClinGen:CA8485851
NM_000267.3(NF1):c.1775G>A (p.Ser592Asn)4763NF1Conflicting interpretations of pathogenicityrs760256377RCV000166463|RCV000692156; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955051529550515GA17:g.29550515G>AClinGen:CA195938C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1780A>G (p.Thr594Ala)4763NF1Uncertain significancers1555613419RCV000550689; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955052029550520AG17:g.29550520A>GClinGen:CA399004296
NM_000267.3(NF1):c.1783_1784del (p.Glu595fs)4763NF1Pathogenicrs786204059RCV000167922|RCV001002339; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN169374172955052229550523CAGC17:g.29550522_29550523delClinGen:CA334004C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1783G>T (p.Glu595Ter)4763NF1Pathogenicrs1597708728RCV000811770; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955052329550523GT17:g.29550523G>T-
NM_001042492.3(NF1):c.1788T>G (p.Ile596Met)4763NF1Uncertain significance-1RCV001231691; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955052829550528TG17:g.29550528T>G-
NM_001042492.3(NF1):c.1789C>T (p.Leu597Phe)4763NF1Uncertain significance-1RCV001064444; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955052929550529CT17:g.29550529C>T-
NM_001042492.3(NF1):c.1793A>G (p.Lys598Arg)4763NF1Uncertain significance-1RCV001056320; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955053329550533AG17:g.29550533A>G-
NM_001042492.3(NF1):c.1793A>C (p.Lys598Thr)4763NF1Uncertain significance-1RCV001209291; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955053329550533AC17:g.29550533A>C-
NM_000267.3(NF1):c.1796G>A (p.Trp599Ter)4763NF1Pathogenicrs1131691130RCV000492421|RCV001217607; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955053629550536GA17:g.29550536G>AClinGen:CA399004390C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1797G>A (p.Trp599Ter)4763NF1Pathogenicrs1567845906RCV000703721|RCV001171932; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202172955053729550537GA17:g.29550537G>A-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1801_1803del (p.Arg601del)4763NF1Likely pathogenicrs1555613421RCV000658093|RCV001249574; NMedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955054029550542TGCGT17:g.29550540_29550542del-
NM_000267.3(NF1):c.1801C>T (p.Arg601Trp)4763NF1Uncertain significancers587782592RCV000131934|RCV000470005; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955054129550541CT17:g.29550541C>TClinGen:CA168912C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.1804dup (p.Glu602fs)4763NF1Pathogenicrs1597708762RCV000816975; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955054129550542CCG17:g.29550541_29550542insG-
NM_000267.3(NF1):c.1802G>A (p.Arg601Gln)4763NF1Uncertain significancers1060500288RCV000472905|RCV000681095; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202172955054229550542GA17:g.29550542G>AClinGen:CA16615173
NM_000267.3(NF1):c.1804G>C (p.Glu602Gln)4763NF1Uncertain significancers1060500322RCV000465827; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955054429550544GC17:g.29550544G>CClinGen:CA16615583
NM_000267.3(NF1):c.1806A>G (p.Glu602=)4763NF1Likely benignrs370454753RCV000165897|RCV000195612; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955054629550546AG17:g.29550546A>GClinGen:CA194466C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.1810T>C (p.Leu604=)4763NF1Benign/Likely benignrs142712751RCV000163286|RCV000197954|RCV000216728|RCV000222209|RCV000292735|RCV000329254|RCV000387235|RCV000679376; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0013692,MedGen:C3280492,OMIM:614327, Orphanet:289539|MedGen:CN169374|MONDO:MONDO:0008078,MedGen:C1834235,OMIM:162210, Orphanet:636172955055029550550TC17:g.29550550T>CClinGen:CA187915C0553586 193520 Café-au-lait macules with pulmonary stenosis;
NM_000267.3(NF1):c.1815del (p.Cys606fs)4763NF1Pathogenicrs1567845935RCV000704845; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955055529550555TCT17:g.29550555_29550555del-
NM_000267.3(NF1):c.1818C>A (p.Cys606Ter)4763NF1Pathogenicrs1567845937RCV000694023; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955055829550558CA17:g.29550558C>A-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1826A>G (p.Lys609Arg)4763NF1Uncertain significancers1597708810RCV000816587; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955056629550566AG17:g.29550566A>G-
NM_001042492.3(NF1):c.1830_1833del (p.Leu612fs)4763NF1Pathogenic-1RCV001240190; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955056829550571ATTTCA17:g.29550568_29550571del-
NM_000267.3(NF1):c.1839_1844del (p.Asn614_Lys615del)4763NF1Uncertain significancers1597708816RCV000824480; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955057629550581TTAAAAAT17:g.29550576_29550581del-
NM_001042492.3(NF1):c.1836_1837insSVAelement4763NF1Pathogenic-1RCV001089795; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955057629550577nana-1-
NM_000267.3(NF1):c.1845+1_1845+5del4763NF1Pathogenicrs1135402822RCV000497051; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955058229550586ATAAGGA17:g.29550582_29550586delClinGen:CA645373090C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1845G>T (p.Lys615Asn)4763NF1Conflicting interpretations of pathogenicityrs1131691080RCV000492781|RCV000549833|RCV000680814; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202172955058529550585GT17:g.29550585G>TClinGen:CA399004780C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1845G>A (p.Lys615=)4763NF1Uncertain significancers1131691080RCV000702016; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955058529550585GA17:g.29550585G>A-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1845+1G>A4763NF1Pathogenicrs1567845945RCV000702952; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955058629550586GA17:g.29550586G>A-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1845+2T>C4763NF1Likely pathogenicrs1555613430RCV000660000; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955058729550587TC17:g.29550587T>C-
NM_001042492.3(NF1):c.1845+2T>A4763NF1Pathogenic-1RCV001065101; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955058729550587TA17:g.29550587T>A-
NM_001042492.3(NF1):c.1845+3A>C4763NF1Uncertain significance-1RCV001058455; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955058829550588AC17:g.29550588A>C-
NM_000267.3(NF1):c.1845+537_4661+331del4763NF1Pathogenic-1RCV000200921; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955112229589206nana-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1846-496_2410-645delinsTAGC4763NF1Pathogenic-1RCV000200874; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955161729555398AGGAATCCAGTAATGAATTCATAGTGCCCTGGTAGGCATAGTCACTCTTGTGACATACTTGGTGTATATACATACCAGAGTTAATTACTGGTCCAGAAGAACTTAATCTCTAGC17:g.29551618_29551716delClinGen:CA277535C0027831 162200 Neurofibromatosis, type 1;
NC_000017.11:g.(?_31225075)_(31236281_?)del4763NF1Pathogenic-1RCV001032301; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955209329563299nana-1-
NC_000017.11:g.(?_31225075)_(31360723_?)del4763NF1Pathogenic-1RCV001032069; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955209329687741nana-1-
NM_000267.3(NF1):c.1846-8T>A4763NF1Uncertain significancers886052799RCV000289328|RCV000344366|RCV000383785|RCV000394022; NMONDO:MONDO:0011035,MedGen:C2931482,OMIM:601321, Orphanet:638|MONDO:MONDO:0008672,MedGen:C0553586,OMIM:193520, Orphanet:3444|MONDO:MONDO:0008078,MedGen:C1834235,OMIM:162210, Orphanet:636|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955210529552105TA17:g.29552105T>AClinGen:CA10648992
NM_000267.3(NF1):c.1846-5T>C4763NF1Uncertain significancers1567846600RCV000704723; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955210829552108TC17:g.29552108T>C-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1846-3T>A4763NF1Uncertain significancers1555613541RCV000794889; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955211029552110TA17:g.29552110T>A-
NM_000267.3(NF1):c.1846-2A>G4763NF1Uncertain significancers1567846609RCV000692911; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955211129552111AG17:g.29552111A>G-C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.1846-1G>T4763NF1Uncertain significance-1RCV001219663; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955211229552112GT17:g.29552112G>T-
NM_000267.3(NF1):c.1846C>G (p.Gln616Glu)4763NF1Uncertain significancers1555613543RCV000632334|RCV001013394; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172955211329552113CG17:g.29552113C>GClinGen:CA399005003C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1846C>T (p.Gln616Ter)4763NF1Likely pathogenicrs1555613543RCV000660001; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955211329552113CT17:g.29552113C>T-
NM_000267.3(NF1):c.1849G>A (p.Ala617Thr)4763NF1Uncertain significancers1131691135RCV000492708|RCV000686488; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955211629552116GA17:g.29552116G>AClinGen:CA399005015C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.1849_1850delinsTA (p.Ala617Ter)4763NF1Pathogenic-1RCV001049349; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955211629552117GCTANC_000017.10:g.29552116_29552117delinsTA-
NM_000267.3(NF1):c.1850C>A (p.Ala617Glu)4763NF1Uncertain significancers1461412558RCV000795955; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955211729552117CA17:g.29552117C>A-
NM_001042492.3(NF1):c.1854_1857del (p.Asp618fs)4763NF1Pathogenic-1RCV001223498; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955211829552121CAGATC17:g.29552118_29552121del-
NM_001042492.3(NF1):c.1854del (p.Asp618fs)4763NF1Pathogenicrs1597710342RCV000989786; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955212129552121ATA17:g.29552121_29552121del-
NM_001042492.3(NF1):c.1854T>G (p.Asp618Glu)4763NF1Uncertain significance-1RCV001221836; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955212129552121TG17:g.29552121T>G-
NM_000267.3(NF1):c.1855A>G (p.Arg619Gly)4763NF1Uncertain significancers587781821RCV000130098|RCV000471843|RCV000681033; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202172955212229552122AG17:g.29552122A>GClinGen:CA165700C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1857_1863del (p.Arg619fs)4763NF1Pathogenicrs1567846634RCV000706925; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955212429552130GAAGTTCCG17:g.29552124_29552130del-C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.1859_1861del (p.Ser620_Ser621delinsThr)4763NF1Uncertain significance-1RCV001241974; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955212629552128AGTTA17:g.29552126_29552128del-
NM_001042492.3(NF1):c.1861del (p.Ser621fs)4763NF1Pathogenicrs1597710358RCV000799495; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955212729552127GTG17:g.29552127_29552127del-
NM_000267.3(NF1):c.1862C>T (p.Ser621Phe)4763NF1Uncertain significancers760346063RCV000525700; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955212929552129CT17:g.29552129C>TClinGen:CA399005080C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1866T>C (p.Cys622=)4763NF1Conflicting interpretations of pathogenicityrs753245823RCV000231851|RCV000561704|RCV000612264|RCV001122062|RCV001122063|RCV001122064; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MedGen:CN169374|MONDO:MONDO:0011035,MedGen:C2931482,OMIM:601321, Orphanet:638|MONDO:MONDO:0008078,MedGen:C1834235,OMIM:162210, Orphanet:636|MO172955213329552133TC17:g.29552133T>CClinGen:CA8485875C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1866T>A (p.Cys622Ter)4763NF1Pathogenicrs753245823RCV000497140; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955213329552133TA17:g.29552133T>AClinGen:CA399005095C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1867C>T (p.His623Tyr)4763NF1Uncertain significancers759555122RCV000459580|RCV001013453; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172955213429552134CT17:g.29552134C>TClinGen:CA8485876
NM_000267.3(NF1):c.1868A>G (p.His623Arg)4763NF1Uncertain significancers1555613555RCV000538260|RCV001013457; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172955213529552135AG17:g.29552135A>GClinGen:CA399005106C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.1868del (p.His623fs)4763NF1Pathogenic-1RCV001049442; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955213529552135CAC17:g.29552135_29552135del-
NM_000267.3(NF1):c.1869C>T (p.His623=)4763NF1Likely benignrs1555613556RCV000555705|RCV000573895; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172955213629552136CT17:g.29552136C>TClinGen:CA499231003C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1870T>C (p.Phe624Leu)4763NF1Uncertain significancers765060733RCV000220571|RCV000474617; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955213729552137TC17:g.29552137T>CClinGen:CA8485877C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1871T>C (p.Phe624Ser)4763NF1Uncertain significancers1597710397RCV000819884; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955213829552138TC17:g.29552138T>C-
NM_000267.3(NF1):c.1875C>T (p.Leu625=)4763NF1Likely benignrs974172157RCV000531898|RCV001013494; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172955214229552142CT17:g.29552142C>TClinGen:CA289361947C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1882dup (p.Tyr628fs)4763NF1Pathogenicrs1555613558RCV000539630; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955214329552144CCT17:g.29552143_29552144insTClinGen:CA499231071
NM_000267.3(NF1):c.1877T>C (p.Leu626Pro)4763NF1Uncertain significancers752591958RCV000698515|RCV001013502; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172955214429552144TC17:g.29552144T>C-
NM_001042492.3(NF1):c.1879T>A (p.Phe627Ile)4763NF1Uncertain significance-1RCV001216295; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955214629552146TA17:g.29552146T>A-
NM_000267.3(NF1):c.1883_1885delinsCC (p.Tyr628fs)4763NF1Pathogenicrs1135402823RCV000497244; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955215029552152ACGCC17:g.29552151_29552152delClinGen:CA645372619C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1884C>T (p.Tyr628=)4763NF1Likely benignrs555635097RCV000163345|RCV000465140; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955215129552151CT17:g.29552151C>TClinGen:CA188039C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1884C>A (p.Tyr628Ter)4763NF1Pathogenicrs555635097RCV000552255|RCV001013534; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172955215129552151CA17:g.29552151C>AClinGen:CA399005169C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.1884del (p.Phe627_Tyr628insTer)4763NF1Pathogenic-1RCV001045101; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955215129552151ACA17:g.29552151_29552151del-
NM_000267.3(NF1):c.1885G>A (p.Gly629Arg)4763NF1Pathogenicrs199474738RCV000059160|RCV000130191|RCV000206280|RCV000506837|RCV001009575; NMedGen:CN517202|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN169374|Human Phenotype Ontology:HP:0009736,MedGen:C4024216; MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet172955215229552152GA17:g.29552152G>AClinGen:CA165914,UniProtKB:P21359#VAR_002653,UniProtKB/Swiss-Prot:VAR_002653C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.1888del (p.Gly629_Val630insTer)4763NF1Pathogenic-1RCV001238344; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955215229552152CGC17:g.29552152_29552152del-
NM_000267.3(NF1):c.1886G>T (p.Gly629Val)4763NF1Uncertain significancers1597710440RCV000814234; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955215329552153GT17:g.29552153G>T-
NM_000267.3(NF1):c.1887G>A (p.Gly629=)4763NF1Likely benignrs1555613561RCV000632565; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955215429552154GA17:g.29552154G>AClinGen:CA499231218C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1888G>A (p.Val630Ile)4763NF1Uncertain significancers751795238RCV000206181|RCV000761108|RCV001013565; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0006033,MedGen:C2986658, Orphanet:497188|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172955215529552155GA17:g.29552155G>AClinGen:CA350243
NM_000267.3(NF1):c.1889T>A (p.Val630Glu)4763NF1Uncertain significancers1135402824RCV000497057; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955215629552156TA17:g.29552156T>AClinGen:CA399005186C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.1891G>A (p.Gly631Arg)4763NF1Conflicting interpretations of pathogenicityrs757424379RCV000163708|RCV000632504; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955215829552158GA17:g.29552158G>AClinGen:CA189000C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1892G>A (p.Gly631Glu)4763NF1Uncertain significancers876660272RCV000218849|RCV000793803; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955215929552159GA17:g.29552159G>AClinGen:CA10580234
NM_000267.3(NF1):c.1892G>C (p.Gly631Ala)4763NF1Uncertain significancers876660272RCV000812616; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955215929552159GC17:g.29552159G>C-
NM_000267.3(NF1):c.1894T>A (p.Cys632Ser)4763NF1Uncertain significancers370789267RCV000121630|RCV000220588|RCV000234708|RCV000712402; NMedGen:CN169374|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202172955216129552161TA17:g.29552161T>AClinGen:CA161025C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1895G>A (p.Cys632Tyr)4763NF1Uncertain significancers1567846698RCV000697211|RCV001013522; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172955216229552162GA17:g.29552162G>A-
NM_001042492.3(NF1):c.1895del (p.Cys632fs)4763NF1Pathogenicrs1597710497RCV000818297; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955216229552162TGT17:g.29552162_29552162del-
NM_001042492.3(NF1):c.1896dup (p.Asp633Ter)4763NF1Pathogenic-1RCV001055951; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955216229552163GGT17:g.29552162_29552163insT-
NM_000267.3(NF1):c.1900A>G (p.Ile634Val)4763NF1Conflicting interpretations of pathogenicityrs745906742RCV000467659|RCV000570055|RCV000681096; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MedGen:CN517202172955216729552167AG17:g.29552167A>GClinGen:CA8485879
NM_000267.3(NF1):c.1901T>C (p.Ile634Thr)4763NF1Likely benignrs527563505RCV000217933|RCV000459283; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955216829552168TC17:g.29552168T>CClinGen:CA8485880C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1902T>A (p.Ile634=)4763NF1Likely benignrs1555613566RCV000533248; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955216929552169TA17:g.29552169T>AClinGen:CA499231342
NM_001042492.3(NF1):c.1906T>C (p.Ser636Pro)4763NF1Uncertain significance-1RCV001051701; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955217329552173TC17:g.29552173T>C-
NM_000267.3(NF1):c.1907C>T (p.Ser636Phe)4763NF1Uncertain significancers780412565RCV000545833; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955217429552174CT17:g.29552174C>TClinGen:CA399005259C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1907C>G (p.Ser636Cys)4763NF1Uncertain significancers780412565RCV000571573|RCV000796467; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955217429552174CG17:g.29552174C>GClinGen:CA8485881
NM_000267.3(NF1):c.1907C>A (p.Ser636Tyr)4763NF1Uncertain significancers780412565RCV000695546; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955217429552174CA17:g.29552174C>A-
NM_000267.3(NF1):c.1910G>C (p.Ser637Thr)4763NF1Uncertain significancers749745247RCV000566350|RCV000792307; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955217729552177GC17:g.29552177G>CClinGen:CA8485882
NM_000267.3(NF1):c.1912G>T (p.Gly638Ter)4763NF1Pathogenicrs1555613567RCV000632304; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955217929552179GT17:g.29552179G>TClinGen:CA399005278C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1916A>G (p.Asn639Ser)4763NF1Uncertain significancers1060500275RCV000472632; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955218329552183AG17:g.29552183A>GClinGen:CA16615586
NM_000267.3(NF1):c.1917T>C (p.Asn639=)4763NF1Likely benignrs876659976RCV000222977|RCV000477597; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955218429552184TC17:g.29552184T>CClinGen:CA10580235C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1918dup (p.Thr640fs)4763NF1Pathogenicrs1135402825RCV000497146; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955218429552185TTA17:g.29552184_29552185insAClinGen:CA645372620C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1919C>T (p.Thr640Ile)4763NF1Uncertain significancers1555613573RCV000787332|RCV000811606|RCV001013696; NMONDO:MONDO:0016755,MeSH:D009455,MedGen:C0027830, Orphanet:252183|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172955218629552186CT17:g.29552186C>T-
NM_000267.3(NF1):c.1921A>G (p.Ser641Gly)4763NF1Uncertain significancers769154907RCV000214938|RCV000558090; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955218829552188AG17:g.29552188A>GClinGen:CA8485883C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1921A>T (p.Ser641Cys)4763NF1Uncertain significancers769154907RCV000707578; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955218829552188AT17:g.29552188A>T-C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.1924C>T (p.Gln642Ter)4763NF1Pathogenic-1RCV001224358; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955219129552191CT17:g.29552191C>T-
NM_001042492.3(NF1):c.1931C>G (p.Ser644Cys)4763NF1Uncertain significance-1RCV001042391; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955219829552198CG17:g.29552198C>G-
NM_000267.3(NF1):c.1933A>G (p.Met645Val)4763NF1Benignrs146051850RCV000121627|RCV000130724|RCV000206514|RCV000286004|RCV000301396|RCV000341061|RCV000680336; NMedGen:CN169374|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0011035,MedGen:C2931482,OMIM:601321, Orphanet:638|MONDO:MONDO:0008078,MedGen:C1834235,OMIM:162210, Orphanet:636|MO172955220029552200AG17:g.29552200A>GClinGen:CA161010C0553586 193520 Café-au-lait macules with pulmonary stenosis;
NM_000267.3(NF1):c.1936G>T (p.Asp646Tyr)4763NF1Uncertain significancers142079728RCV000215309|RCV001238664; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955220329552203GT17:g.29552203G>TClinGen:CA8485884C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1939C>T (p.His647Tyr)4763NF1Uncertain significancers776251084RCV000228534|RCV000572609; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172955220629552206CT17:g.29552206C>TClinGen:CA8485885
NM_001042492.3(NF1):c.1942G>T (p.Glu648Ter)4763NF1Pathogenic-1RCV001219001; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955220929552209GT17:g.29552209G>T-
NM_000267.3(NF1):c.1944A>G (p.Glu648=)4763NF1Likely benignrs1465016257RCV000573720|RCV000632573; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955221129552211AG17:g.29552211A>GClinGen:CA499231681
NM_001042492.3(NF1):c.1946_1950dup (p.Leu651fs)4763NF1Pathogenic-1RCV001215715; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955221229552213GGAATTA17:g.29552212_29552213insAATTA-
NM_000267.3(NF1):c.1949T>A (p.Leu650Ter)4763NF1Pathogenicrs1135402826RCV000497234; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955221629552216TA17:g.29552216T>AClinGen:CA399005472C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.1950del (p.Leu650fs)4763NF1Pathogenicrs1597710658RCV000989787; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955221729552217TAT17:g.29552217_29552217del-
NM_000267.3(NF1):c.1954C>T (p.Arg652Cys)4763NF1Uncertain significancers786202436RCV000165246|RCV000685531; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955222129552221CT17:g.29552221C>TClinGen:CA192854C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1955G>A (p.Arg652His)4763NF1Uncertain significancers587778549RCV000121629|RCV000477324|RCV001013832; NMedGen:CN169374|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172955222229552222GA17:g.29552222G>AClinGen:CA161020C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.1955del (p.Arg652fs)4763NF1Pathogenicrs1597710690RCV001013831|RCV001244879; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955222229552222CGC17:g.29552222_29552222del-
NM_001042492.3(NF1):c.1955_1956del (p.Arg652fs)4763NF1Pathogenic-1RCV001048599; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955222229552223CGTC17:g.29552222_29552223del-
NM_001042492.3(NF1):c.1956T>G (p.Arg652=)4763NF1Likely benignrs1429522155RCV000936213; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955222329552223TG17:g.29552223T>G-
NM_000267.3(NF1):c.1957A>G (p.Thr653Ala)4763NF1Uncertain significancers1597710712RCV000797229; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955222429552224AG17:g.29552224A>G-
NM_000267.3(NF1):c.1960C>T (p.Pro654Ser)4763NF1Uncertain significancers765281937RCV000232520|RCV001013857; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172955222729552227CT17:g.29552227C>TClinGen:CA8485886
NM_001042492.3(NF1):c.1960C>G (p.Pro654Ala)4763NF1Uncertain significance-1RCV001068450; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955222729552227CG17:g.29552227C>G-
NM_001042492.3(NF1):c.1962T>C (p.Pro654=)4763NF1Likely benignrs1555613595RCV000940320; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955222929552229TC17:g.29552229T>C-
NM_000267.3(NF1):c.1966G>A (p.Ala656Thr)4763NF1Uncertain significancers1555613598RCV000529749; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955223329552233GA17:g.29552233G>AClinGen:CA399005531
NM_001042492.3(NF1):c.1967C>A (p.Ala656Asp)4763NF1Uncertain significance-1RCV001226533; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955223429552234CA17:g.29552234C>A-
NM_001042492.3(NF1):c.1969T>G (p.Ser657Ala)4763NF1Uncertain significance-1RCV001248657; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955223629552236TG17:g.29552236T>G-
NM_000267.3(NF1):c.1972C>T (p.Leu658Phe)4763NF1Uncertain significancers763901597RCV000220178|RCV000466869; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955223929552239CT17:g.29552239C>TClinGen:CA8485889C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1974C>T (p.Leu658=)4763NF1Likely benignrs751318331RCV000166499|RCV000872673; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955224129552241CT17:g.29552241C>TClinGen:CA196032C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1974C>A (p.Leu658=)4763NF1Likely benignrs751318331RCV000219277|RCV000242668|RCV000632576; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MedGen:CN169374|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955224129552241CA17:g.29552241C>AClinGen:CA8485890C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1975C>T (p.Arg659Trp)4763NF1Uncertain significancers757512142RCV000163436|RCV000205526; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955224229552242CT17:g.29552242C>TClinGen:CA188275C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.1976G>A (p.Arg659Gln)4763NF1Conflicting interpretations of pathogenicityrs151138158RCV000163421|RCV000547195|RCV000825676; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN169374172955224329552243GA17:g.29552243G>AClinGen:CA188240
NM_001042492.3(NF1):c.1977G>A (p.Arg659=)4763NF1Likely benignrs1597710788RCV000979161|RCV001013817; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172955224429552244GA17:g.29552244G>A-
NM_000267.3(NF1):c.1984A>T (p.Lys662Ter)4763NF1Pathogenicrs1597710793RCV000794341; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955225129552251AT17:g.29552251A>T-
NM_000267.3(NF1):c.1985A>G (p.Lys662Arg)4763NF1Uncertain significancers578141234RCV000226087|RCV001013912; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172955225229552252AG17:g.29552252A>GClinGen:CA8485891C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.1987G>A (p.Gly663Arg)4763NF1Conflicting interpretations of pathogenicityrs140653372RCV000163499|RCV000206471|RCV000415075|RCV001124832|RCV001124833|RCV001124834; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|10 conditions|MONDO:MONDO:0008078,MedGen:C1834235,OMIM:162210, Orphanet:636|MONDO:MONDO:0011035,MedGen:C2931482,OMIM:601321, Orphanet:638|MOND172955225429552254GA17:g.29552254G>AClinGen:CA188459C1849688 Abnormal electroretinogram;
NM_001042492.3(NF1):c.1989del (p.Asn664fs)4763NF1Pathogenicrs1202226733RCV000989788; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955225429552254AGA17:g.29552254_29552254del-
NM_000267.3(NF1):c.1988_2410-218delinsTGTC4763NF1Pathogenic-1RCV000200903; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955225529555825GGAACTCCTCTATGGTCAGCTTCTTCTGTACTTTTTCTGTATCATTTTATGTGCTCTGTTTGTTTTCTGAATGAAATTTGGTAAATTTCATCTAGGTAATATAGTGTAATTGTC17:g.29552256_29552354delClinGen:CA277561C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.1988G>A (p.Gly663Glu)4763NF1Uncertain significance-1RCV001048142; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955225529552255GA17:g.29552255G>A-
NM_000267.3(NF1):c.1991A>G (p.Asn664Ser)4763NF1Uncertain significancers756145065RCV000456743; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955225829552258AG17:g.29552258A>GClinGen:CA8485892
NM_001042492.3(NF1):c.1992dup (p.Ser665fs)4763NF1Pathogenicrs1597710824RCV001009576; NHuman Phenotype Ontology:HP:0009736,MedGen:C4024216; MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955225829552259AAC17:g.29552258_29552259insC-
NM_001042492.3(NF1):c.1994C>T (p.Ser665Phe)4763NF1Conflicting interpretations of pathogenicityrs145891889RCV000121628|RCV000129662|RCV000200171|RCV000587577|RCV001124835|RCV001124836|RCV001124837; NMedGen:CN169374|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202|MONDO:MONDO:0008078,MedGen:C1834235,OMIM:162210, Orphanet:636|MONDO:MONDO:0011035,MedGen:C2931482,OMIM:601321172955226129552261CT17:g.29552261C>TClinGen:CA161015,UniProtKB:P21359#VAR_021739C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.1995del (p.Ser666fs)4763NF1Pathogenic-1RCV001202737; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955226129552261TCT17:g.29552261_29552261del-
NM_001042492.3(NF1):c.1997C>T (p.Ser666Phe)4763NF1Uncertain significance-1RCV001057670; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955226429552264CT17:g.29552264C>T-
NM_000267.3(NF1):c.1999A>G (p.Met667Val)4763NF1Uncertain significancers749833271RCV000166077|RCV000197513; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955226629552266AG17:g.29552266A>GClinGen:CA194931C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.2001G>A (p.Met667Ile)4763NF1Uncertain significancers1597710853RCV000814440; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955226829552268GA17:g.29552268G>A-
NM_001042492.3(NF1):c.2001+1G>A4763NF1Likely pathogenic-1RCV001229423; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955226929552269GA17:g.29552269G>A-
NM_000267.3(NF1):c.2001+7T>C4763NF1Likely benignrs878853870RCV000230056; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955227529552275TC17:g.29552275T>CClinGen:CA10583477
NM_000267.3(NF1):c.2002-9G>T4763NF1Likely benignrs376197466RCV000679378|RCV001088657; NMedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955344429553444GT17:g.29553444G>TClinGen:CA349868
NM_001042492.3(NF1):c.2002-8A>T4763NF1Likely benignrs1318674321RCV000873319; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955344529553445AT17:g.29553445A>T-
NM_001042492.3(NF1):c.2002-4_2002-3del4763NF1Conflicting interpretations of pathogenicityrs786203664RCV000167074|RCV000476620; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955344629553447ACTA17:g.29553446_29553447delClinGen:CA197431C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.2002-5C>G4763NF1Uncertain significancers1165625614RCV000572165|RCV001203080; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955344829553448CG17:g.29553448C>GClinGen:CA658656601
NM_000267.3(NF1):c.2002-4_2010del4763NF1Likely pathogenicrs878853871RCV000231778; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955344929553461CTCAGGATAGTGCAC17:g.29553449_29553461delClinGen:CA10583478
NM_001042492.3(NF1):c.2002-2A>G4763NF1Likely pathogenic-1RCV001244877; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955345129553451AG17:g.29553451A>G-
NM_000267.3(NF1):c.2002-1G>A4763NF1Pathogenic/Likely pathogenicrs1555613743RCV000578644|RCV000660002; NMedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955345229553452GA17:g.29553452G>AClinGen:CA398981984C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.2006G>A (p.Ser669Asn)4763NF1Uncertain significance-1RCV001040892; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955345729553457GA17:g.29553457G>A-
NM_001042492.3(NF1):c.2007T>C (p.Ser669=)4763NF1Likely benignrs750622783RCV000928116; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955345829553458TC17:g.29553458T>C-
NM_000267.3(NF1):c.2010A>G (p.Ala670=)4763NF1Likely benignrs786202440RCV000165252|RCV000632536; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955346129553461AG17:g.29553461A>GClinGen:CA192873C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.2010del (p.Ala671fs)4763NF1Likely pathogenicrs1597712251RCV000786905; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955346129553461CAC17:g.29553461_29553461del-
NM_000267.3(NF1):c.2014G>A (p.Gly672Arg)4763NF1Uncertain significancers786202632RCV000165538|RCV000508132|RCV000700067; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MedGen:CN169374|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955346529553465GA17:g.29553465G>AClinGen:CA193636
NM_000267.3(NF1):c.2015G>T (p.Gly672Val)4763NF1Uncertain significancers371817372RCV000132074|RCV000476573; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955346629553466GT17:g.29553466G>TClinGen:CA169205C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.2018G>A (p.Cys673Tyr)4763NF1Uncertain significancers878853872RCV000226748; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955346929553469GA17:g.29553469G>AClinGen:CA10583479
NM_000267.3(NF1):c.2019C>T (p.Cys673=)4763NF1Likely benignrs146624509RCV000164223|RCV000632548; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955347029553470CT17:g.29553470C>TClinGen:CA190380C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.2019C>A (p.Cys673Ter)4763NF1Pathogenicrs146624509RCV001009577; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636; Human Phenotype Ontology:HP:0009736,MedGen:C4024216172955347029553470CA17:g.29553470C>A-
NM_000267.3(NF1):c.2020A>G (p.Ser674Gly)4763NF1Uncertain significancers1555613753RCV000632298|RCV001014116; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172955347129553471AG17:g.29553471A>GClinGen:CA398982026
NM_001042492.3(NF1):c.2022C>T (p.Ser674=)4763NF1Benignrs2230851RCV000130488|RCV000218285|RCV000680333|RCV001081129; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955347329553473CT17:g.29553473C>TClinGen:CA166523C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.2023G>A (p.Gly675Arg)4763NF1Uncertain significancers779546178RCV000213385|RCV000559747|RCV000681229|RCV001125813|RCV001125814|RCV001125815; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202|MONDO:MONDO:0011035,MedGen:C2931482,OMIM:601321, Orphanet:638|MONDO:MONDO:0008078,MedGen:C1834235,OMIM:162210, Orphanet:636|MO172955347429553474GA17:g.29553474G>AClinGen:CA10580240C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.2033dup (p.Ile679fs)4763NF1Pathogenicrs587781807RCV000130078|RCV000204850|RCV000265986|RCV001009578; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202|Human Phenotype Ontology:HP:0009736,MedGen:C4024216; MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955347729553478AAC17:g.29553477_29553478insCClinGen:CA165662C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.2(NF1):c.2033del (p.Pro678fs)4763NF1Pathogenicrs587781807RCV000492337|RCV000558816; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955347829553478ACA17:g.29553478_29553478delClinGen:CA8485910C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.2027C>T (p.Thr676Ile)4763NF1Uncertain significancers1294581001RCV001014125|RCV001030571|RCV001046280; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0003582,MeSH:D061325,MedGen:C0677776,OMIM:PS604370, Orphanet:145|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955347829553478CT17:g.29553478C>T-
NM_000267.3(NF1):c.2028C>G (p.Thr676=)4763NF1Likely benignrs878853873RCV000229300|RCV000571117; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172955347929553479CG17:g.29553479C>GClinGen:CA10583480
NM_000267.3(NF1):c.2031C>G (p.Pro677=)4763NF1Likely benignrs753177596RCV000535639|RCV001014143; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172955348229553482CG17:g.29553482C>GClinGen:CA499443623C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.2032C>A (p.Pro678Thr)4763NF1Uncertain significancers758691069RCV000166265|RCV000200062; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955348329553483CA17:g.29553483C>AClinGen:CA195401C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.2032C>T (p.Pro678Ser)4763NF1Uncertain significancers758691069RCV000164974|RCV000543709; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955348329553483CT17:g.29553483C>TClinGen:CA192203C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.2032C>G (p.Pro678Ala)4763NF1Uncertain significancers758691069RCV000213376|RCV000464265; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955348329553483CG17:g.29553483C>GClinGen:CA8485912C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.2033C>T (p.Pro678Leu)4763NF1Conflicting interpretations of pathogenicityrs17881753RCV000034581|RCV000121631|RCV000130295|RCV000200179; NMedGen:CN517202|MedGen:CN169374|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955348429553484CT17:g.29553484C>TClinGen:CA161030,UniProtKB:P21359#VAR_022255C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.2034G>A (p.Pro678=)4763NF1Benignrs2285892RCV000162648|RCV000219876|RCV000296834|RCV000356219|RCV000371357|RCV000400800|RCV000589553; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MedGen:CN169374|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0008672,MedGen:C0553586,OMIM:193520, Orphanet:3444|MONDO:MONDO:0008078,MedGen:C1834235,OMIM:162210, Orphanet:636|M172955348529553485GA17:g.29553485G>AClinGen:CA186633C0553586 193520 Café-au-lait macules with pulmonary stenosis;
NM_000267.3(NF1):c.2034delinsCA (p.Ile679fs)4763NF1Pathogenicrs1064796331RCV000485853|RCV000497093; NMedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955348529553485GCA17:g.29553485_29553486insAClinGen:CA16620360C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.2035dup (p.Ile679fs)4763NF1Likely pathogenicrs1555613773RCV000660003; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955348529553486GGA17:g.29553485_29553486insA-
NM_000267.3(NF1):c.2034del (p.Ile679fs)4763NF1Pathogenicrs1567847384RCV000697005; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955348529553485CGC17:g.29553485_29553485del-C0027831 162200 Neurofibromatosis, type 1;
NM_001042492.3(NF1):c.2034G>T (p.Pro678=)4763NF1Likely benignrs2285892RCV000975715|RCV001014089; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172955348529553485GT17:g.29553485G>T-
NM_001042492.3(NF1):c.2034_2035delinsAG (p.Ile679Val)4763NF1Uncertain significance-1RCV001214179; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955348529553486GAAGNC_000017.10:g.29553485_29553486delinsAG-
NM_000267.3(NF1):c.2038T>C (p.Cys680Arg)4763NF1Uncertain significancers1555613775RCV000632342; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955348929553489TC17:g.29553489T>CClinGen:CA398982056C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.2041del (p.Arg681fs)4763NF1Pathogenicrs1567847398RCV000696461; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955349129553491GCG17:g.29553491_29553491del-C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.2041C>T (p.Arg681Ter)4763NF1Pathogenicrs768638173RCV000168265|RCV000414746|RCV000415426|RCV000567277|RCV000999937|RCV001257528; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MedGen:CN517202|Human Phenotype Ontology:HP:0000957,Human Phenotype Ontology:HP:0005601,Human Phenotype Ontology:HP:0007454,MedGen:C0221263; Human Phenotype Ontology:HP:0000997,MedGen:C1860335; 172955349229553492CT17:g.29553492C>TClinGen:CA334507C1860335 Axillary freckling;
NM_000267.3(NF1):c.2042G>A (p.Arg681Gln)4763NF1Uncertain significancers786201768RCV000164229|RCV000205161; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955349329553493GA17:g.29553493G>AClinGen:CA190397C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.2045_2049dup (p.Gln684fs)4763NF1Pathogenicrs1597712398RCV000815548; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955349429553495AACAAGC17:g.29553494_29553495insCAAGC-
NM_001042492.3(NF1):c.2044C>T (p.Gln682Ter)4763NF1Pathogenicrs1597712392RCV001009579|RCV001223770; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636; Human Phenotype Ontology:HP:0009736,MedGen:C4024216|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955349529553495CT17:g.29553495C>T-
NM_000267.3(NF1):c.2045A>C (p.Gln682Pro)4763NF1Uncertain significancers1304889984RCV000575967|RCV000791506; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955349629553496AC17:g.29553496A>CClinGen:CA398982070C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.2049_2083del (p.Gln684fs)4763NF1Pathogenic-1RCV001051126; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955349929553533GCCCAGACCAAACTAGAAGTGGCCCTGTACATGTTTG17:g.29553499_29553533del-
NM_001042492.3(NF1):c.2050C>T (p.Gln684Ter)4763NF1Pathogenic-1RCV001238898; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955350129553501CT17:g.29553501C>T-
NM_000267.3(NF1):c.2054C>G (p.Thr685Ser)4763NF1Uncertain significancers876658190RCV000216178|RCV000233280; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955350529553505CG17:g.29553505C>GClinGen:CA10580241C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.2061A>G (p.Leu687=)4763NF1Likely benignrs143671377RCV000223002|RCV000615800|RCV000681392|RCV001078833; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955351229553512AG17:g.29553512A>GClinGen:CA336861C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.2064dup (p.Val689fs)4763NF1Pathogenicrs1555613786RCV000528061; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955351329553514GGA17:g.29553513_29553514insAClinGen:CA658656604C0027831 162200 Neurofibromatosis, type 1;
NM_000267.3(NF1):c.2062G>T (p.Glu688Ter)4763NF1Pathogenicrs1555613784RCV000632501; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955351329553513GT17:g.29553513G>TClinGen:CA398982133
NM_001042492.3(NF1):c.2062G>C (p.Glu688Gln)4763NF1Uncertain significancers1555613784RCV001014214|RCV001062773; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955351329553513GC17:g.29553513G>C-
NM_001042492.3(NF1):c.2064del (p.Val689fs)4763NF1Pathogenic-1RCV001039634; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955351429553514GAG17:g.29553514_29553514del-
NM_001042492.3(NF1):c.2064A>T (p.Glu688Asp)4763NF1Uncertain significance-1RCV001240704; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955351529553515AT17:g.29553515A>T-
NM_000267.3(NF1):c.2065G>A (p.Val689Met)4763NF1Uncertain significancers771784652RCV000472940|RCV000563593; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172955351629553516GA17:g.29553516G>AClinGen:CA8485915
NM_000267.3(NF1):c.2071del (p.Leu691fs)4763NF1Pathogenicrs1060500364RCV000477103; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955352029553520GCG17:g.29553520_29553520delClinGen:CA16615455
NM_001042492.3(NF1):c.2069C>T (p.Ala690Val)4763NF1Uncertain significance-1RCV001038830; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955352029553520CT17:g.29553520C>T-
NM_000267.3(NF1):c.2072T>C (p.Leu691Pro)4763NF1Uncertain significancers1131691132RCV000492230|RCV000705843; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955352329553523TC17:g.29553523T>CClinGen:CA398982164C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.2072T>G (p.Leu691Arg)4763NF1Uncertain significancers1131691132RCV000536374; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955352329553523TG17:g.29553523T>GClinGen:CA398982165
NM_000267.3(NF1):c.2073G>C (p.Leu691=)4763NF1Likely benignrs756988894RCV000166724|RCV000943377; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955352429553524GC17:g.29553524G>CClinGen:CA196573C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.2077A>G (p.Met693Val)4763NF1Uncertain significancers1555613794RCV000549001|RCV000575226|RCV000681177; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MedGen:CN517202172955352829553528AG17:g.29553528A>GClinGen:CA398982181
NM_001042492.3(NF1):c.2078T>C (p.Met693Thr)4763NF1Uncertain significance-1RCV001218579; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955352929553529TC17:g.29553529T>C-
NM_001042492.3(NF1):c.2080T>C (p.Phe694Leu)4763NF1Uncertain significancers1597712476RCV001014363|RCV001212284; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955353129553531TC17:g.29553531T>C-
NM_000267.3(NF1):c.2084T>C (p.Leu695Pro)4763NF1Pathogenicrs199474761RCV000059161|RCV000810919; NMedGen:CN517202|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955353529553535TC17:g.29553535T>CClinGen:CA219421,UniProtKB:P21359#VAR_021740,UniProtKB/Swiss-Prot:VAR_021740
NM_000267.3(NF1):c.2085G>A (p.Leu695=)4763NF1Likely benignrs1060503889RCV000469557|RCV000567255; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162172955353629553536GA17:g.29553536G>AClinGen:CA16615588
NM_001042492.3(NF1):c.2086_2088del (p.Trp696del)4763NF1Pathogenic-1RCV001172241; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955353629553538TGTGT17:g.29553536_29553538del-
NM_001042492.3(NF1):c.2092C>G (p.Pro698Ala)4763NF1Uncertain significance-1RCV001061440; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955354329553543CG17:g.29553543C>G-
NM_000267.3(NF1):c.2094T>C (p.Pro698=)4763NF1Likely benignrs1555613798RCV000573541|RCV000868897; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955354529553545TC17:g.29553545T>CClinGen:CA499443738C0027672 Hereditary cancer-predisposing syndrome;
NM_000267.3(NF1):c.2097C>T (p.Asp699=)4763NF1Likely benignrs547905840RCV000524865; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955354829553548CT17:g.29553548C>TClinGen:CA8485916
NM_000267.3(NF1):c.2098A>G (p.Thr700Ala)4763NF1Uncertain significancers1555613801RCV000568913|RCV000632397|RCV001030572; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636|MONDO:MONDO:0003582,MeSH:D061325,MedGen:C0677776,OMIM:PS604370, Orphanet:145172955354929553549AG17:g.29553549A>GClinGen:CA398982252C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.2099C>G (p.Thr700Ser)4763NF1Uncertain significance-1RCV001216847; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955355029553550CG17:g.29553550C>G-
NM_000267.3(NF1):c.2101G>A (p.Glu701Lys)4763NF1Uncertain significancers1597712510RCV000818622; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955355229553552GA17:g.29553552G>A-
NM_001042492.3(NF1):c.2105C>T (p.Ala702Val)4763NF1Uncertain significance-1RCV001232998; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955355629553556CT17:g.29553556C>T-
NM_000267.3(NF1):c.2116G>A (p.Ala706Thr)4763NF1Uncertain significancers876658232RCV000222829|RCV001071634; NMONDO:MONDO:0015356,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:636172955356729553567GA17:g.29553567G>AClinGen:CA10580244C0027672 Hereditary cancer-predisposing syndrome;
NM_001042492.3(NF1):c.2122del (p.Ser708fs)4763NF1Pathogenicrs1597712535RCV000800684; NMONDO:MONDO:0018975,MedGen:C0027831,OMIM:162200, Orphanet:63617