MSeqDR Mitochondrial Disease Portal


 
*:HP: HPO terms, UMDF: 1= Disease, ND: NAMDC terms.
  Most Studied  CPEO, Complex I Deficiency, COXPD1, Leigh, LHON, MELAS, MERRF, Myopathy, SANDO
Disease Browser
Parent Node:
expand
Neoplastic Syndromes, Hereditary (D009386)
..Starting node
..expand
Birt-Hogg-Dube Syndrome (D058249)

       Child Nodes:



 Sister Nodes: 
..expandAdenomatous Polyposis Coli (D011125) Child10
..expandBasal Cell Nevus Syndrome (D001478) Child1
..expandBirt-Hogg-Dube Syndrome (D058249)
..expandCancer, Familial, with In Vitro Radioresistance (C566179)
..expandCollagenoma, Familial Cutaneous (C562925)
..expandColorectal Neoplasms, Hereditary Nonpolyposis (D003123) Child10
..expandDiaphyseal medullary stenosis with malignant fibrous histiocytoma (C536169)
..expandDysplastic Nevus Syndrome (D004416)
..expandExostoses, Multiple Hereditary (D005097) Child14
..expandFamilial cylindromatosis (C536611)
..expandGenochondromatosis (C563215)
..expandHamartoma Syndrome, Multiple (D006223) Child10
..expandHemangioma, capillary infantile (C535860)
..expandHereditary Breast and Ovarian Cancer Syndrome (D061325)
..expandHereditary leiomyomatosis and renal cell cancer (C535516)
..expandJuvenile polyposis syndrome (C537702)
..expandLi-Fraumeni Syndrome (D016864) Child4
..expandMelanoma-Pancreatic Cancer Syndrome (C563985)
..expandMeningioma, familial (C537443)
..expandMultiple Endocrine Neoplasia (D009377) Child6
..expandMyelocytic leukemia-like syndrome, familial, chronic (C536093)
..expandNeurofibromatoses (D017253) Child13  LSDB C:1
..expandParagangliomas 2 (C566646)
..expandParagangliomas 3 (C565335)
..expandPeutz-Jeghers Syndrome (D010580)
..expandProstate Cancer, Hereditary, 12 (C567510)
..expandTuberous Sclerosis (D014402) Child4
..expandTurcot syndrome (C536928)
..expandWilms Tumor (D009396) Child10
   

Human Disease MESH is developed by UMLS.
Further data from MedGen, OMIM,ClinVar, CTD
Term ID:1376
Name:Birt-Hogg-Dube Syndrome
Definition:Autosomal dominant neoplastic syndrome characterised by genodermatosis, lung cysts, spontaneous and recurrent PNEUMOTHORAX; and RENAL CANCER. It is associated with mutations in the folliculin protein gene (FLCN protein).
Alternative IDs:DO:DOID:0050676|OMIM:135150
ParentIDs:MESH:D009386
TreeNumbers:C04.700.212 |C16.320.700.212
Synonyms:BHD |Birt Hogg Dube Syndrome |Birt-Hogg-Dub茅 Syndrome |Fibrofolliculomas with Trichodiscomas and Acrochordons |Hornstein-Birt-Hogg-Dub茅 Syndrome |Hornstein-Knickenberg Syndrome
Slim Mappings:Cancer|Genetic disease (inborn)
Reference: MedGen: D058249
MeSH: D058249
OMIM: 135150;
MSeqDR LSDB:  
Genes: FLCN; FLNB;
Phenotypes
1 HP:0000006Autosomal dominant inheritance
2 HP:0001438Abnormality of abdomen morphology
3 HP:0001595Abnormality of the hair
4 HP:0030436Fibrofolliculoma
5 HP:0001012Multiple lipomas
6 HP:0005584Renal cell carcinoma
7 HP:0000107Renal cyst
8 HP:0009726Renal neoplasm
9 HP:0002108Spontaneous pneumothorax
Disease Causing ClinVar Variants
Variation_NameGeneIDGeneSymbolClinicalSignificancedbSNPRCVaccessionTestedInGTRPhenotypeIDsChromosomeStartStopHGVS_cHGVS_pHGVS_gOtherIDsDisease_ClinVar
NC_000017.10:g.(?_17107268)_(17125891_?)del201163FLCNPathogenic-1RCV001972794; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171710726817125891nana-1-
NM_144997.7(FLCN):c.*1403T>C201163FLCNBenignrs7218795RCV000349750|RCV000387911; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903171711556617115566AGNC_000017.10:g.17115566A>GClinGen:CA10648673C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.*1336G>T201163FLCNBenignrs7218992RCV000296451|RCV000335139; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903171711563317115633CANC_000017.10:g.17115633C>AClinGen:CA10649602C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.*1273C>T201163FLCNUncertain significancers886052654RCV000299995|RCV000402543; NMONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711569617115696GANC_000017.10:g.17115696G>AClinGen:CA10649604C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.*1182dup201163FLCNBenignrs199535675RCV000338407|RCV000395101; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|Human Phenotype Ontology:HP:0002108,MedGen:C0149781171711578617115787CCTNC_000017.10:g.17115789dupClinGen:CA10639007C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.*1179dup201163FLCNUncertain significancers397932764RCV000303405|RCV000360525; NHuman Phenotype Ontology:HP:0002108,MedGen:C0149781|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711578917115790TTANC_000017.10:g.17115815dupClinGen:CA10644955C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.*1179T>A201163FLCNUncertain significancers540609895RCV000268440|RCV000307216; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903171711579017115790ATNC_000017.10:g.17115790A>TClinGen:CA10648676C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.*1101C>G201163FLCNUncertain significancers543608114RCV001123456|RCV001123457; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903171711586817115868GC17:g.17115868G>C-
NM_144997.7(FLCN):c.*1035T>C201163FLCNUncertain significancers566019526RCV001123458|RCV001123459; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903171711593417115934AG17:g.17115934A>G-
NM_144997.7(FLCN):c.*967T>C201163FLCNUncertain significancers886052656RCV000271930|RCV000364150; NMONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711600217116002AGNC_000017.10:g.17116002A>GClinGen:CA10639008C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.*956A>G201163FLCNBenignrs141650706RCV000329527|RCV000367873; NMONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711601317116013TCNC_000017.10:g.17116013T>CClinGen:CA10639012C0346010 135150 Multiple fibrofolliculomas;
NC_000017.10:g.(?_17116047)_(17118400_?)del201163FLCNPathogenic-1RCV000556904; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711604717118400nana-C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.*915G>T201163FLCNUncertain significancers1021480303RCV001124547|RCV001124548; NMONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711605417116054CA17:g.17116054C>A-
NM_144997.7(FLCN):c.*914C>T201163FLCNBenignrs7223831RCV000275670|RCV000333032; NMONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711605517116055GANC_000017.10:g.17116055G>AClinGen:CA10644956C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.*911G>A201163FLCNBenign/Likely benignrs571893996RCV000279245|RCV000371446; NMONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711605817116058CTNC_000017.10:g.17116058C>TClinGen:CA10648683C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.*887T>C201163FLCNUncertain significancers886052657RCV000318016|RCV000374976; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903171711608217116082AGNC_000017.10:g.17116082A>GClinGen:CA10648684C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.*846C>T201163FLCNUncertain significancers2046796611RCV001125558|RCV001125559; NMONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711612317116123GA17:g.17116123G>A-
NM_144997.7(FLCN):c.*739C>T201163FLCNUncertain significancers558952732RCV000291981|RCV000346842; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903171711623017116230GANC_000017.10:g.17116230G>AClinGen:CA10649607C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.*695_*696del201163FLCNUncertain significancers886052658RCV000288343|RCV000404206; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|Human Phenotype Ontology:HP:0002108,MedGen:C0149781171711627317116274CCGCNC_000017.10:g.17116273_17116274delClinGen:CA10648686C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.*695C>T201163FLCNUncertain significancers775700421RCV000343208|RCV000398097; NMONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711627417116274GANC_000017.10:g.17116274G>AClinGen:CA10648691C0346010 135150 Multiple fibrofolliculomas;
NC_000017.10:g.(?_17116310)_(17117959_?)del201163FLCNPathogenic-1RCV001975247; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711631017117959nana-1-
NM_144997.7(FLCN):c.*634A>C201163FLCNUncertain significancers199572622RCV000303567|RCV000358326; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903171711633517116335TGNC_000017.10:g.17116335T>GClinGen:CA10648692C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.*557T>C201163FLCNBenignrs3803761RCV000299845|RCV000398100|RCV001618565; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MedGen:CN517202171711641217116412AGNC_000017.10:g.17116412A>GClinGen:CA10644961C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.*528G>A201163FLCNConflicting interpretations of pathogenicityrs184006653RCV000259949|RCV000354725; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903171711644117116441CTNC_000017.10:g.17116441C>TClinGen:CA10648693C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.*526T>C201163FLCNBenign/Likely benignrs574547835RCV000333489|RCV000369499; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903171711644317116443AGNC_000017.10:g.17116443A>GClinGen:CA10644964C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.*442T>C201163FLCNBenign/Likely benignrs7224213RCV000274789|RCV000329930|RCV001778910; NMONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171711652717116527AGNC_000017.10:g.17116527A>GClinGen:CA10644967C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.*425G>A201163FLCNBenignrs7224335RCV000290214|RCV000384649|RCV001712109; NMONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171711654417116544CTNC_000017.10:g.17116544C>TClinGen:CA10639013C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.*393G>A201163FLCNBenign/Likely benignrs12602675RCV000326621|RCV000381204|RCV001778911; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MedGen:CN517202171711657617116576CTNC_000017.10:g.17116576C>TClinGen:CA10639016C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.*379G>A201163FLCNConflicting interpretations of pathogenicityrs117436649RCV000286267|RCV000341273; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903171711659017116590CTNC_000017.10:g.17116590C>TClinGen:CA10648695C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.*356G>T201163FLCNBenignrs7224474RCV000283171|RCV000406287|RCV001690068; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MedGen:CN517202171711661317116613CANC_000017.10:g.17116613C>AClinGen:CA10648696C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.*340G>A201163FLCNUncertain significancers886052659RCV000338172|RCV000405367; NMONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711662917116629CTNC_000017.10:g.17116629C>TClinGen:CA10648699C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.*339C>T201163FLCNUncertain significancers1312482683RCV001125646|RCV001125645; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903171711663017116630GA17:g.17116630G>A-
NM_144997.7(FLCN):c.*333C>T201163FLCNUncertain significancers750896108RCV000298301|RCV000353246; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903171711663617116636GANC_000017.10:g.17116636G>AClinGen:CA10649610C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.*290C>T201163FLCNUncertain significancers886052660RCV000312827|RCV000396072; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903171711667917116679GANC_000017.10:g.17116679G>AClinGen:CA10644970C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.*224G>A201163FLCNUncertain significancers541003301RCV000273030|RCV000367612; NMONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711674517116745CTNC_000017.10:g.17116745C>TClinGen:CA10639019C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.*178A>G201163FLCNConflicting interpretations of pathogenicityrs145430714RCV000309138|RCV000363873; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903171711679117116791TCNC_000017.10:g.17116791T>CClinGen:CA10639022C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.*178A>C201163FLCNUncertain significancers145430714RCV001127739|RCV001127740; NMONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711679117116791TG17:g.17116791T>G-
NM_144997.7(FLCN):c.*140C>T201163FLCNUncertain significancers2046810998RCV001127741|RCV001127742; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903171711682917116829GA17:g.17116829G>A-
NM_144997.7(FLCN):c.*29G>A201163FLCNUncertain significancers1189817112RCV001127743|RCV001127744; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903171711694017116940CT17:g.17116940C>T-
NC_000017.10:g.(?_17116959)_(17124952_?)dup201163FLCNUncertain significance-1RCV000822548; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711695917124952nana-
NC_000017.10:g.(?_17116959)_(17136215_?)dup201163FLCNUncertain significance-1RCV000816620; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711695917136215nana-
NC_000017.11:g.(?_17213645)_(17237188_?)del201163FLCNPathogenic-1RCV000796125; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711695917140502nana-
NC_000017.11:g.(?_17213645)_(17213866_?)del201163FLCNPathogenic-1RCV000822550; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711695917117180nana-
NC_000017.10:g.(?_17116959)_(17140502_?)dup201163FLCNUncertain significance-1RCV000792143; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711695917140502nana-
NC_000017.10:g.(?_17116963)_(17120502_?)dup201163FLCNUncertain significance-1RCV000635598; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711696317120502nana-C0346010 135150 Multiple fibrofolliculomas;
NC_000017.10:g.(?_17116963)_(17131457_?)dup201163FLCNUncertain significance-1RCV000635599; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711696317131457nana-C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.*4G>A201163FLCNConflicting interpretations of pathogenicityrs770795599RCV001121959|RCV001121960; NMONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711696517116965CT17:g.17116965C>T-
NC_000017.11:g.(?_17213655)_(17213866_?)dup201163FLCNUncertain significance-1RCV001033619; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711696917117180nana-1-
NC_000017.11:g.(?_17213655)_(17232901_?)dup201163FLCNUncertain significance-1RCV001031757; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711696917136215nana-1-
NC_000017.11:g.(?_17213655)_(17237188_?)dup201163FLCNUncertain significance-1RCV001032138; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711696917140502nana-1-
NC_000017.10:g.(?_17116969)_(17117180_?)del201163FLCNPathogenic-1RCV001388765; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711696917117180nana-1-
NC_000017.10:g.(?_17116969)_(17140502_?)del201163FLCNPathogenic-1RCV001388764; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711696917140502nana-1-
NC_000017.10:g.(?_17116969)_(17120506_?)dup201163FLCNUncertain significance-1RCV001950707; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711696917120506nana-1-
NC_000017.10:g.(?_17116969)_(17119827_?)del201163FLCNPathogenic-1RCV001956076; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711696917119827nana-1-
NM_144997.7(FLCN):c.1737C>T (p.Asn579=)201163FLCNLikely benignrs767345167RCV000635589|RCV001452904; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711697217116972GA17:g.17116972G>AClinGen:CA8415905C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1737C>G (p.Asn579Lys)201163FLCNUncertain significancers767345167RCV001308500; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711697217116972GC17116972-
NM_144997.7(FLCN):c.1733G>A (p.Arg578Gln)201163FLCNUncertain significancers1048214486RCV001012941|RCV001231605; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711697617116976CT17:g.17116976C>T-
NM_144997.7(FLCN):c.1732C>T (p.Arg578Trp)201163FLCNUncertain significancers775107483RCV000806704|RCV001766682; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0005575,MedGen:C0346629,OMIM:114500171711697717116977GA17:g.17116977G>A-
NM_144997.7(FLCN):c.1730C>T (p.Ser577Phe)201163FLCNUncertain significancers2046815038RCV001056149; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711697917116979GA17:g.17116979G>A-
NM_144997.7(FLCN):c.1729T>C (p.Ser577Pro)201163FLCNUncertain significance-1RCV001926898; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711698017116980AG17116980-
NM_144997.7(FLCN):c.1728G>T (p.Glu576Asp)201163FLCNUncertain significance-1RCV001916705; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711698117116981CA17116981-
NM_144997.7(FLCN):c.1725G>A (p.Ser575=)201163FLCNLikely benignrs760307957RCV000878973; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711698417116984CT17:g.17116984C>T-
NM_144997.7(FLCN):c.1724C>T (p.Ser575Leu)201163FLCNUncertain significance-1RCV001369254; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711698517116985GA17116985-
NM_144997.7(FLCN):c.1721C>T (p.Ala574Val)201163FLCNUncertain significancers2046815401RCV001214711; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711698817116988GA17:g.17116988G>A-
NM_144997.7(FLCN):c.1718C>T (p.Thr573Ile)201163FLCNUncertain significance-1RCV001361156; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711699117116991GA17116991-
NM_144997.7(FLCN):c.1717A>G (p.Thr573Ala)201163FLCNUncertain significancers758901704RCV000797511; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711699217116992TC17:g.17116992T>C-
NM_144997.7(FLCN):c.1717A>T (p.Thr573Ser)201163FLCNUncertain significancers758901704RCV001309793; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711699217116992TA17116992-
NM_144997.7(FLCN):c.1715C>A (p.Pro572His)201163FLCNUncertain significancers1567804824RCV000809531; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711699417116994GT17:g.17116994G>T-
NM_144997.7(FLCN):c.1714C>G (p.Pro572Ala)201163FLCNUncertain significancers1456319670RCV000548547; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711699517116995GC17:g.17116995G>CClinGen:CA398529796C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1714C>T (p.Pro572Ser)201163FLCNUncertain significancers1456319670RCV000813277; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711699517116995GA17:g.17116995G>A-
NM_144997.7(FLCN):c.1710C>T (p.Arg570=)201163FLCNLikely benign-1RCV001495099; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711699917116999GA17116999-
NM_144997.7(FLCN):c.1709G>A (p.Arg570His)201163FLCNUncertain significancers201056799RCV000213870|RCV000701876|RCV001555199; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171711700017117000CT17:g.17117000C>TClinGen:CA8415911C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1709G>T (p.Arg570Leu)201163FLCNUncertain significancers201056799RCV001347686; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711700017117000CA17117000-
NM_144997.7(FLCN):c.1708C>T (p.Arg570Cys)201163FLCNUncertain significancers752161850RCV001012834|RCV001242710; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711700117117001GA17:g.17117001G>A-
NM_144997.7(FLCN):c.1707C>T (p.Val569=)201163FLCNLikely benignrs1597573624RCV000926778|RCV001494345; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711700217117002GA17:g.17117002G>A-
NM_144997.7(FLCN):c.1706T>C (p.Val569Ala)201163FLCNUncertain significance-1RCV001973773; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711700317117003AG17117003-
NM_144997.7(FLCN):c.1704G>A (p.Thr568=)201163FLCNLikely benignrs147554296RCV000477542|RCV000564432|RCV001704576; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202171711700517117005CTNC_000017.10:g.17117005C>TClinGen:CA8415913C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1704G>C (p.Thr568=)201163FLCNLikely benign-1RCV001405644; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711700517117005CG17117005-
NM_144997.7(FLCN):c.1703C>T (p.Thr568Met)201163FLCNUncertain significancers781733528RCV000538027; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711700617117006GA17:g.17117006G>AClinGen:CA8415914C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1702A>G (p.Thr568Ala)201163FLCNUncertain significancers748337450RCV000218570|RCV001337259; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711700717117007TC17:g.17117007T>CClinGen:CA8415915C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1700C>T (p.Ser567Phe)201163FLCNUncertain significancers1466102804RCV001207804; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711700917117009GA17:g.17117009G>A-
NM_144997.7(FLCN):c.1695C>G (p.Leu565=)201163FLCNLikely benign-1RCV001455279; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711701417117014GC17117014-
NM_144997.7(FLCN):c.1692C>T (p.His564=)201163FLCNBenign/Likely benignrs201810397RCV000164247|RCV000229534|RCV001704194; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171711701717117017GA17:g.17117017G>AClinGen:CA190442C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1690C>T (p.His564Tyr)201163FLCNUncertain significancers1555606350RCV000570237|RCV001352408; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711701917117019GANC_000017.10:g.17117019G>AClinGen:CA398529843C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1689del (p.His564fs)201163FLCNUncertain significancers1314645884RCV000694143|RCV001012734; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171711702017117020GTGNC_000017.10:g.17117020del-C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1685A>G (p.Lys562Arg)201163FLCNUncertain significancers749359334RCV000561170|RCV001853772; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711702417117024TC17:g.17117024T>CClinGen:CA8415917C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1682A>T (p.Tyr561Phe)201163FLCNUncertain significancers2046817737RCV001240522; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711702717117027TA17:g.17117027T>A-
NM_144997.7(FLCN):c.1679C>T (p.Thr560Ile)201163FLCNUncertain significancers1597573772RCV000798002; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711703017117030GA17:g.17117030G>A-
NM_144997.7(FLCN):c.1677G>A (p.Lys559=)201163FLCNLikely benign-1RCV002092594; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711703217117032CT17117032-
NM_144997.7(FLCN):c.1676A>G (p.Lys559Arg)201163FLCNUncertain significance-1RCV002002766; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711703317117033TC17117033-
NM_144997.7(FLCN):c.1669C>T (p.Leu557=)201163FLCNLikely benignrs878855215RCV000226773; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711704017117040GA17:g.17117040G>AClinGen:CA10583450C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1658G>A (p.Trp553Ter)201163FLCNConflicting interpretations of pathogenicityrs879255684RCV000239662; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711705117117051CTNC_000017.10:g.17117051C>TClinGen:CA10586245C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1657T>C (p.Trp553Arg)201163FLCNPathogenic/Likely pathogenicrs1131690833RCV000492176|RCV000690635|RCV001584204; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171711705217117052AG17:g.17117052A>GClinGen:CA398529920C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1656C>T (p.Phe552=)201163FLCNLikely benign-1RCV001433389; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711705317117053GA17117053-
NM_144997.7(FLCN):c.1655T>A (p.Phe552Tyr)201163FLCNUncertain significance-1RCV001956647; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711705417117054AT17117054-
NM_144997.7(FLCN):c.1647G>A (p.Leu549=)201163FLCNLikely benignrs978355107RCV001012520|RCV001394554; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711706217117062CT17:g.17117062C>T-
NM_144997.7(FLCN):c.1645C>G (p.Leu549Val)201163FLCNUncertain significancers1555606373RCV000635557; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711706417117064GC17:g.17117064G>CClinGen:CA398529946C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1643A>C (p.Lys548Thr)201163FLCNUncertain significancers2046819323RCV001345530; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711706617117066TG17117066-
NM_144997.7(FLCN):c.1641C>A (p.Val547=)201163FLCNLikely benignrs1235496125RCV000544770|RCV001495285; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711706817117068GT17:g.17117068G>TClinGen:CA498163092C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1639G>T (p.Val547Phe)201163FLCNUncertain significance-1RCV001917971; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711707017117070CA17117070-
NM_144997.7(FLCN):c.1637A>G (p.Asn546Ser)201163FLCNUncertain significancers775149348RCV000570961|RCV000635566; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711707217117072TC17:g.17117072T>CClinGen:CA8415923C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1635C>G (p.Asp545Glu)201163FLCNUncertain significancers760329266RCV000163471|RCV000231877|RCV001539507|RCV001762360; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202|MONDO:MONDO:0005575,MedGen:C0346629,OMIM:114500171711707417117074GC17:g.17117074G>CClinGen:CA188379C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1629GGA[1] (p.Glu544del)201163FLCNUncertain significance-1RCV001996716; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711707517117077GTCCG17117074-
NM_144997.7(FLCN):c.1633G>A (p.Asp545Asn)201163FLCNUncertain significancers2046820384RCV001205284; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711707617117076CT17:g.17117076C>T-
NM_144997.7(FLCN):c.1627G>A (p.Glu543Lys)201163FLCNUncertain significancers776389684RCV000702226|RCV001012478; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171711708217117082CT17:g.17117082C>T-C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1626C>T (p.Ser542=)201163FLCNLikely benignrs1433647771RCV000864200|RCV001012471|RCV001546051; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202171711708317117083GA17:g.17117083G>A-
NM_144997.7(FLCN):c.1623G>A (p.Ala541=)201163FLCNLikely benignrs185419942RCV000461179|RCV001012450; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171711708617117086CTNC_000017.10:g.17117086C>TClinGen:CA8415926C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1607_1622del (p.Leu536fs)201163FLCNUncertain significancers1597574088RCV000806769; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711708717117102CGCACCCAGGATGCTCAC17:g.17117087_17117102del-
NM_144997.7(FLCN):c.1622C>T (p.Ala541Val)201163FLCNUncertain significancers764899882RCV001348429; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711708717117087GA17117087-
NM_144997.7(FLCN):c.1619dup (p.Ala541fs)201163FLCNPathogenic-1RCV001953906; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711708917117090AAC17117089-
NM_144997.7(FLCN):c.1619G>A (p.Gly540Asp)201163FLCNUncertain significancers1402955238RCV000635564; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711709017117090CT17:g.17117090C>TClinGen:CA398530002C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1616dup (p.Ala541fs)201163FLCNPathogenic-1RCV001390199; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711709217117093CCA17117092-
NM_144997.7(FLCN):c.1614C>T (p.Ile538=)201163FLCNLikely benignrs1597574133RCV000938103|RCV001467616; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711709517117095GA17:g.17117095G>A-
NM_144997.7(FLCN):c.1612A>C (p.Ile538Leu)201163FLCNUncertain significance-1RCV002047324; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711709717117097TG17117097-
NM_144997.7(FLCN):c.1612A>G (p.Ile538Val)201163FLCNUncertain significance-1RCV001994962; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711709717117097TC17117097-
NM_144997.7(FLCN):c.1605G>C (p.Leu535=)201163FLCNLikely benign-1RCV001416322; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711710417117104CG17117104-
NM_144997.7(FLCN):c.1599_1600dup (p.Lys534fs)201163FLCNUncertain significancers1439151268RCV000530010; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711710817117109TTTC17:g.17117108_17117109insTCClinGen:CA658656529C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1600A>G (p.Lys534Glu)201163FLCNUncertain significance-1RCV002047032; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711710917117109TC17117109-
NM_144997.7(FLCN):c.1599G>C (p.Gln533His)201163FLCNUncertain significancers190965235RCV000702195; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711711017117110CGNC_000017.10:g.17117110C>G-C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1599G>A (p.Gln533=)201163FLCNLikely benign-1RCV002154697; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711711017117110CT17117110-
NM_144997.7(FLCN):c.1597_1598del (p.Gln533fs)201163FLCNConflicting interpretations of pathogenicityrs876660810RCV000219888|RCV001244466; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711711117117112CTGC17:g.17117111_17117112delClinGen:CA10580167C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1597C>T (p.Gln533Ter)201163FLCNPathogenicrs398124532RCV000082632|RCV000820903; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711711217117112GANC_000017.10:g.17117112G>AClinGen:CA224163CN517202 not provided;
NM_144997.7(FLCN):c.1594A>C (p.Thr532Pro)201163FLCNUncertain significancers753023144RCV001012340|RCV001860702; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711711517117115TG17:g.17117115T>G-
NM_144997.7(FLCN):c.1589A>G (p.Glu530Gly)201163FLCNUncertain significance-1RCV001933733; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711712017117120TC17117120-
NM_144997.7(FLCN):c.1584del (p.Glu530fs)201163FLCNPathogenic/Likely pathogenicrs1131690827RCV000492254|RCV000657381|RCV001851346; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711712517117125TGTNC_000017.10:g.17117127delClinGen:CA645369642C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1579_1580insA (p.Arg527fs)201163FLCNConflicting interpretations of pathogenicityrs753009073RCV000239620|RCV001012269; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171711712917117130CCT17:g.17117129_17117130insTClinGen:CA8415933C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1580G>A (p.Arg527Gln)201163FLCNConflicting interpretations of pathogenicityrs777826268RCV000560552|RCV000565191|RCV001121961; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903171711712917117129CT17:g.17117129C>TClinGen:CA8415934C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1579C>T (p.Arg527Ter)201163FLCNPathogenic/Likely pathogenicrs879255683RCV000479484|RCV000239694|RCV001012272; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171711713017117130GANC_000017.10:g.17117130G>AClinGen:CA10586246
NM_144997.7(FLCN):c.1579C>A (p.Arg527=)201163FLCNLikely benign-1RCV001484354; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711713017117130GT17117130-
NM_144997.7(FLCN):c.1577G>A (p.Ser526Asn)201163FLCNUncertain significance-1RCV001886987; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711713217117132CT17117132-
NM_144997.7(FLCN):c.1576A>G (p.Ser526Gly)201163FLCNUncertain significancers2046823044RCV001324282; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711713317117133TC17117133-
NM_144997.7(FLCN):c.1575C>T (p.Asp525=)201163FLCNLikely benign-1RCV002095148; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711713417117134GA17117134-
NM_144997.7(FLCN):c.1574A>G (p.Asp525Gly)201163FLCNUncertain significancers2046823116RCV001245966; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711713517117135TC17:g.17117135T>C-
NM_144997.7(FLCN):c.1571T>G (p.Val524Gly)201163FLCNUncertain significancers2046823273RCV001327412; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711713817117138AC17117138-
NM_144997.7(FLCN):c.1568A>G (p.Lys523Arg)201163FLCNUncertain significance-1RCV001863638; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711714117117141TC17117141-
NM_144997.7(FLCN):c.1565C>G (p.Thr522Ser)201163FLCNUncertain significancers1597574324RCV001206002; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711714417117144GC17:g.17117144G>C-
NM_144997.7(FLCN):c.1565C>A (p.Thr522Asn)201163FLCNUncertain significancers1597574324RCV001326483; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711714417117144GT17117144-
NM_144997.7(FLCN):c.1559A>G (p.Lys520Arg)201163FLCNUncertain significancers142288285RCV000808791|RCV001292936; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903171711715017117150TC17:g.17117150T>C-
NM_144997.7(FLCN):c.1552C>A (p.Leu518Ile)201163FLCNUncertain significance-1RCV002027954; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711715717117157GT17117157-
NM_144997.7(FLCN):c.1549del (p.Val517fs)201163FLCNLikely pathogenicrs1597574368RCV001029847; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711716017117160ACA17:g.17117160_17117160del-
NM_144997.7(FLCN):c.1548G>A (p.Lys516=)201163FLCNLikely benign-1RCV002079620; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711716117117161CT17117161-
NM_144997.7(FLCN):c.1547A>G (p.Lys516Arg)201163FLCNUncertain significancers2046824022RCV001349162|RCV001751684; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171711716217117162TC17117162-
NM_144997.7(FLCN):c.1543G>A (p.Val515Met)201163FLCNUncertain significancers1415483886RCV000563515|RCV001208437; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711716617117166CTNC_000017.10:g.17117166C>TClinGen:CA398530530C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1539C>T (p.Asn513=)201163FLCNUncertain significancers2046824297RCV001038265; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711717017117170GA17:g.17117170G>A-
NM_144997.7(FLCN):c.1539-2A>G201163FLCNLikely pathogenicrs878855214RCV000230210|RCV000498117; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171711717217117172TCNC_000017.10:g.17117172T>CClinGen:CA10583451
NM_144997.7(FLCN):c.1539-6C>T201163FLCNLikely benignrs779028759RCV000530849|RCV001545011; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171711717617117176GA17:g.17117176G>AClinGen:CA8415937C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1539-11G>C201163FLCNLikely benign-1RCV002113524; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711718117117181CG17117181-
NM_144997.7(FLCN):c.1539-16_1539-12del201163FLCNConflicting interpretations of pathogenicityrs398124531RCV000082631|RCV002055228; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711718217117186CCAAAAC17:g.17117182_17117186delClinGen:CA224162CN169374 not specified;
NM_144997.7(FLCN):c.1539-16T>G201163FLCNBenign-1RCV002124714; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711718617117186AC17117186-
NM_144997.7(FLCN):c.1539-19T>C201163FLCNLikely benign-1RCV002149765; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711718917117189AG17117189-
NM_144997.7(FLCN):c.1538+14T>G201163FLCNBenign/Likely benignrs112111994RCV000153244|RCV000269445|RCV000324507|RCV001610463; NMedGen:CN169374|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171711828517118285AC17:g.17118285A>CClinGen:CA180041C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1538+10_1538+11del201163FLCNLikely benign-1RCV001421860; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711828817118289ACTA17118287-
NM_144997.7(FLCN):c.1538+10A>C201163FLCNBenignrs12451312RCV000552576; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711828917118289TGNC_000017.10:g.17118289T>GClinGen:CA8415950C0346010 135150 Multiple fibrofolliculomas;
NC_000017.11:g.(?_17214975)_(17215326_?)del201163FLCNPathogenic-1RCV001033082; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711828917118640nana-1-
NM_144997.7(FLCN):c.1538+8A>G201163FLCNLikely benign-1RCV001433584; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711829117118291TC17118291-
NM_144997.7(FLCN):c.1538+6C>A201163FLCNUncertain significancers1597578548RCV001220688; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711829317118293GT17:g.17118293G>T-
NM_144997.7(FLCN):c.1538+5G>C201163FLCNUncertain significancers2046865948RCV001214791; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711829417118294CG17:g.17118294C>G-
NM_144997.7(FLCN):c.1538+2T>C201163FLCNLikely pathogenic-1RCV001533142; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711829717118297AG17118297-
NM_144997.7(FLCN):c.1538+1G>A201163FLCNLikely pathogenicrs2046866025RCV001206966; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711829817118298CT17:g.17118298C>T-
NM_144997.7(FLCN):c.1177-169_1538del201163FLCNPathogenic-1RCV000791534; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711829917119986CTTCATCCACTCCTCCTTGAGGCAGACGAGGCACTGGTCCACCACATCCACAGACAGGTTCTGGTTGGTCAGAGCCGCTTCAATCTTATTCAGGATGGTGGGGCCCACTGC17:g.17118299_17118397del-
NM_144997.7(FLCN):c.1536G>T (p.Met512Ile)201163FLCNUncertain significancers1303612288RCV000812075; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711830117118301CA17:g.17118301C>A-
NM_144997.7(FLCN):c.1533G>A (p.Trp511Ter)201163FLCNPathogenicrs398124530RCV000082630|RCV000239664; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711830417118304CT17:g.17118304C>TClinGen:CA224159C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1532G>A (p.Trp511Ter)201163FLCNPathogenicrs879255682RCV000239621|RCV000756170; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171711830517118305CT17:g.17118305C>TClinGen:CA10586247C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1531T>C (p.Trp511Arg)201163FLCNUncertain significancers1555606948RCV000531932; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711830617118306AG17:g.17118306A>GClinGen:CA398530693C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1525GAG[1] (p.Glu510del)201163FLCNPathogenic/Likely pathogenicrs879255681RCV000489596|RCV000239692; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711830717118309ACTCA17:g.17118307_17118309delClinGen:CA10586248C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1528del (p.Glu510fs)201163FLCNPathogenicrs879255680RCV000239647; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711830917118309TCTNC_000017.10:g.17118310delClinGen:CA10586249C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1522_1524del (p.Lys508del)201163FLCNPathogenic/Likely pathogenicrs398124529RCV000082629|RCV000239713; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711831317118315CCTTC17:g.17118313_17118315delClinGen:CA224156C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1523A>G (p.Lys508Arg)201163FLCNConflicting interpretations of pathogenicityrs199643834RCV000034790|RCV000217068|RCV000573630|RCV001086352|RCV001121962; NMedGen:CN517202|MedGen:CN169374|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903171711831417118314TC17:g.17118314T>CClinGen:CA211431,UniProtKB:Q8NFG4#VAR_066029CN221571 Birt-Hogg-Dub syndrome;
NM_144997.7(FLCN):c.1521C>A (p.Leu507=)201163FLCNLikely benign-1RCV001440052; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711831617118316GT17118316-
NM_144997.7(FLCN):c.1521C>G (p.Leu507=)201163FLCNLikely benign-1RCV002197357; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711831617118316GC17118316-
NM_144997.7(FLCN):c.1520T>C (p.Leu507Pro)201163FLCNUncertain significancers1567807022RCV000695179; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711831717118317AG17:g.17118317A>G-C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1519C>T (p.Leu507Phe)201163FLCNUncertain significancers1360467783RCV000804274|RCV001011887; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171711831817118318GA17:g.17118318G>A-
NM_144997.7(FLCN):c.1515C>T (p.Val505=)201163FLCNLikely benignrs1388452217RCV001011876|RCV001451156; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711832217118322GA17:g.17118322G>A-
NM_144997.7(FLCN):c.1513G>A (p.Val505Ile)201163FLCNUncertain significancers376715412RCV000475725|RCV000572433; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171711832417118324CTNC_000017.10:g.17118324C>TClinGen:CA8415952C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1512C>T (p.Leu504=)201163FLCNLikely benignrs757471403RCV000635579|RCV001011974; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171711832517118325GA17:g.17118325G>AClinGen:CA8415953C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1509C>T (p.Cys503=)201163FLCNLikely benignrs927844338RCV000600657|RCV000878776|RCV001409903; NMedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711832817118328GA17:g.17118328G>AClinGen:CA288305078CN169374 not specified;
NM_144997.7(FLCN):c.1508G>C (p.Cys503Ser)201163FLCNUncertain significance-1RCV001929670; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711832917118329CG17118329-
NM_144997.7(FLCN):c.1506G>A (p.Gln502=)201163FLCNLikely benign-1RCV002103837; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711833117118331CT17118331-
NM_144997.7(FLCN):c.1503C>T (p.Asp501=)201163FLCNLikely benignrs1447641168RCV000553358; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711833417118334GANC_000017.10:g.17118334G>AClinGen:CA498421024C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1495G>A (p.Val499Met)201163FLCNUncertain significancers2046868336RCV001064586; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711834217118342CT17:g.17118342C>T-
NM_144997.7(FLCN):c.1493A>T (p.Asp498Val)201163FLCNUncertain significancers2046868475RCV001213888; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711834417118344TA17:g.17118344T>A-
NM_144997.7(FLCN):c.1487_1490dup (p.Asp498fs)201163FLCNPathogenicrs879255679RCV000239688; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711834617118347CCACAGNC_000017.10:g.17118347ACAG[3]ClinGen:CA10586250C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1491G>C (p.Val497=)201163FLCNLikely benign-1RCV002098610; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711834617118346CG17118346-
NM_144997.7(FLCN):c.1488T>C (p.Ser496=)201163FLCNLikely benign-1RCV001445882; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711834917118349AG17118349-
NM_144997.7(FLCN):c.1487C>G (p.Ser496Cys)201163FLCNUncertain significancers750535468RCV000805142|RCV001011827; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171711835017118350GC17:g.17118350G>C-
NM_144997.7(FLCN):c.1487C>T (p.Ser496Phe)201163FLCNUncertain significancers750535468RCV001309418; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711835017118350GA17118350-
NM_144997.7(FLCN):c.1485G>C (p.Leu495=)201163FLCNLikely benign-1RCV001475449; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711835217118352CG17118352-
NM_144997.7(FLCN):c.1482C>T (p.Asn494=)201163FLCNConflicting interpretations of pathogenicityrs1597578831RCV001011814|RCV001124730|RCV001124731; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711835517118355GA17:g.17118355G>A-
NM_144997.7(FLCN):c.1477C>T (p.Gln493Ter)201163FLCNPathogenic-1RCV001384375; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711836017118360GA17118360-
NM_144997.7(FLCN):c.1476C>T (p.Asn492=)201163FLCNLikely benignrs779837933RCV001011708|RCV001443057; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711836117118361GA17:g.17118361G>A-
NM_144997.7(FLCN):c.1475del (p.Asn492fs)201163FLCNPathogenic-1RCV002035302; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711836217118362GTG17118361-
NM_144997.7(FLCN):c.1470G>A (p.Leu490=)201163FLCNLikely benignrs1306737502RCV000528121; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711836717118367CT17:g.17118367C>TClinGen:CA498421058C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1468C>G (p.Leu490Val)201163FLCNUncertain significance-1RCV001870537; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711836917118369GC17118369-
NM_144997.7(FLCN):c.1466C>T (p.Ala489Val)201163FLCNUncertain significance-1RCV001952791; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711837117118371GA17118371-
NM_144997.7(FLCN):c.1465G>A (p.Ala489Thr)201163FLCNUncertain significancers757222242RCV001294147|RCV001776175; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171711837217118372CT17118372-
NM_144997.7(FLCN):c.1464G>A (p.Ala488=)201163FLCNBenign/Likely benignrs747029882RCV000231403|RCV000573319|RCV001707565; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202171711837317118373CT17:g.17118373C>TClinGen:CA8415958C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1464G>C (p.Ala488=)201163FLCNLikely benign-1RCV001469492; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711837317118373CG17118373-
NM_144997.7(FLCN):c.1463C>T (p.Ala488Val)201163FLCNConflicting interpretations of pathogenicityrs200660337RCV000475144|RCV000571344|RCV001124732|RCV001591093; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MedGen:CN517202171711837417118374GANC_000017.10:g.17118374G>AClinGen:CA8415959C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1462G>A (p.Ala488Thr)201163FLCNUncertain significancers1597578917RCV001011700|RCV001860680; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711837517118375CT17:g.17118375C>T-
NM_144997.7(FLCN):c.1461A>G (p.Glu487=)201163FLCNLikely benignrs1597578928RCV001011693|RCV001474675; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711837617118376TC17:g.17118376T>C-
NM_144997.7(FLCN):c.1451_1458dup (p.Glu487fs)201163FLCNPathogenicrs757197845RCV000549849; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711837817118379CCAATCTTATNC_000017.10:g.17118379_17118386dupClinGen:CA8415960C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1457T>C (p.Ile486Thr)201163FLCNUncertain significancers1555607026RCV000538586; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711838017118380AGNC_000017.10:g.17118380A>GClinGen:CA398530984C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1453A>G (p.Lys485Glu)201163FLCNUncertain significancers1448703959RCV001061105; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711838417118384TC17:g.17118384T>C-
NM_144997.7(FLCN):c.1451A>G (p.Asn484Ser)201163FLCNUncertain significancers1010980331RCV000635555; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711838617118386TC17:g.17118386T>CClinGen:CA288305215C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1451del (p.Asn484fs)201163FLCNPathogenicrs1567807238RCV000698319; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711838617118386ATA17:g.17118386_17118386del-C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1447C>T (p.Leu483=)201163FLCNLikely benign-1RCV001469570; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711839017118390GA17118390-
NM_144997.7(FLCN):c.1444A>G (p.Ile482Val)201163FLCNUncertain significancers1440165382RCV000707212; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711839317118393TC17:g.17118393T>C-C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1442C>T (p.Thr481Ile)201163FLCNUncertain significancers781081891RCV000794267; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711839517118395GA17:g.17118395G>A-
NM_144997.7(FLCN):c.1441A>C (p.Thr481Pro)201163FLCNUncertain significancers2046870886RCV001070354; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711839617118396TG17:g.17118396T>G-
NM_144997.7(FLCN):c.1440del (p.Thr481fs)201163FLCNPathogenicrs1597579055RCV000822765; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711839717118397TGT17:g.17118397_17118397del-
NM_144997.7(FLCN):c.1440C>T (p.Pro480=)201163FLCNLikely benignrs1597579041RCV001011596|RCV001395878; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711839717118397GA17:g.17118397G>A-
NM_144997.7(FLCN):c.1439C>A (p.Pro480His)201163FLCNUncertain significancers745720578RCV000799799; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711839817118398GT17:g.17118398G>T-
NM_144997.7(FLCN):c.1437C>T (p.Gly479=)201163FLCNLikely benign-1RCV002197486; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711840017118400GA17118400-
NM_144997.7(FLCN):c.1434G>A (p.Val478=)201163FLCNUncertain significancers1131690834RCV000492321|RCV001319149; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711840317118403CTNC_000017.10:g.17118403C>TClinGen:CA498421180C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1433-2A>G201163FLCNPathogenic/Likely pathogenicrs398124528RCV000082628|RCV000166694|RCV000796649; NMedGen:CN517202|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711840617118406TCNC_000017.10:g.17118406T>CClinGen:CA196500C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1433-2A>C201163FLCNLikely pathogenic-1RCV001379564; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711840617118406TG17118406-
NM_144997.7(FLCN):c.1433-3C>T201163FLCNUncertain significance-1RCV001978522; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711840717118407GA17118407-
NM_144997.7(FLCN):c.1433-5C>A201163FLCNConflicting interpretations of pathogenicityrs781046590RCV000570303|RCV001401401; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711840917118409GTNC_000017.10:g.17118409G>TClinGen:CA625314016C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1433-6C>A201163FLCNUncertain significancers747745989RCV001227740; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711841017118410GT17:g.17118410G>T-
NM_144997.7(FLCN):c.1433-25_1433-9dup201163FLCNLikely benignrs778841914RCV000466755; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711841217118413GGAAGGGCAGGGGCAGAGCNC_000017.10:g.17118422_17118438dupClinGen:CA8415963C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1433-8C>T201163FLCNLikely benign-1RCV001473839; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711841217118412GA17118412-
NM_144997.7(FLCN):c.1433-20_1433-10del201163FLCNLikely benign-1RCV002103794; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711841417118424AAGGGCAGGGGCA17118413-
NM_144997.7(FLCN):c.1433-13C>T201163FLCNLikely benign-1RCV002093341; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711841717118417GA17118417-
NM_144997.7(FLCN):c.1433-14G>C201163FLCNLikely benign-1RCV002136401; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711841817118418CG17118418-
NM_144997.7(FLCN):c.1433-38A>G201163FLCNBenignrs34235236RCV000239644|RCV001000238|RCV001610546; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN169374|MedGen:CN517202171711844217118442TC17:g.17118442T>CClinGen:CA8415976C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1432+19_1432+20del201163FLCNLikely benign-1RCV002098428; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711847917118480ACTA17118478-
NM_144997.7(FLCN):c.1432+16C>A201163FLCNLikely benign-1RCV002220506; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711848317118483GT17118483-
NM_144997.7(FLCN):c.1432+15G>A201163FLCNLikely benign-1RCV002138029; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711848417118484CT17118484-
NM_144997.7(FLCN):c.1432+12dup201163FLCNBenign-1RCV002132555; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711848617118487TTG17118486-
NM_144997.7(FLCN):c.1432+13A>C201163FLCNLikely benign-1RCV002129459; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711848617118486TG17118486-
NM_144997.7(FLCN):c.1432+12C>T201163FLCNLikely benign-1RCV002102330; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711848717118487GA17118487-
NM_144997.7(FLCN):c.1432+10C>G201163FLCNLikely benignrs1216451293RCV000975922|RCV001503807; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711848917118489GC17:g.17118489G>C-
NM_144997.7(FLCN):c.1432+10C>A201163FLCNLikely benign-1RCV002121824; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711848917118489GT17118489-
NM_144997.7(FLCN):c.1432+9C>T201163FLCNLikely benignrs751683346RCV000871631|RCV001488831; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711849017118490GA17:g.17118490G>A-
NM_144997.7(FLCN):c.1432+9C>A201163FLCNLikely benign-1RCV001457037; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711849017118490GT17118490-
NM_144997.7(FLCN):c.1432+8C>T201163FLCNLikely benignrs201898226RCV000535879; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711849117118491GA17:g.17118491G>AClinGen:CA8416000C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1432+7G>T201163FLCNLikely benign-1RCV001469692; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711849217118492CA17118492-
NM_144997.7(FLCN):c.1432+7G>A201163FLCNLikely benign-1RCV002168592; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711849217118492CT17118492-
NM_144997.7(FLCN):c.1432+5G>C201163FLCNUncertain significancers786203179RCV000166378|RCV001038275; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711849417118494CG17:g.17118494C>GClinGen:CA195700C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1432+4G>C201163FLCNUncertain significancers373547953RCV000539355; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711849517118495CG17:g.17118495C>GClinGen:CA8416001C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1432+3G>T201163FLCNUncertain significancers752730139RCV000821798|RCV001011551; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171711849617118496CA17:g.17118496C>A-
NM_144997.7(FLCN):c.1432+1G>A201163FLCNPathogenic/Likely pathogenicrs755959303RCV000492464|RCV001000813|RCV000254996|RCV000239711; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711849817118498CTNC_000017.10:g.17118498C>TClinGen:CA10586251
NM_144997.7(FLCN):c.1432+1G>C201163FLCNLikely pathogenic-1RCV002000839; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711849817118498CG17118498-
NM_144997.7(FLCN):c.1430G>A (p.Arg477Gln)201163FLCNUncertain significancers748878853RCV000266163|RCV000379332|RCV000414396|RCV000765332|RCV001011546|RCV001764290; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|Human Phenotype Ontology:HP:0002108,MedGen:C0149781|MedGen:CN517202|MONDO:MONDO:0007763,MedGen:CN074294,OMIM:144700, Orphanet:422526; MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711850117118501CTNC_000017.10:g.17118501C>TClinGen:CA8416005
NM_144997.7(FLCN):c.1429C>T (p.Arg477Ter)201163FLCNPathogenicrs879255678RCV000239684|RCV000762980|RCV000567617|RCV000507127|RCV000256142; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122; MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903; MONDO:MONDO:0007763,MedGen:CN074294,OMIM:144700, Orphanet:422526; MONDO171711850217118502GANC_000017.10:g.17118502G>AClinGen:CA10586252
NM_144997.7(FLCN):c.1428C>G (p.Asp476Glu)201163FLCNConflicting interpretations of pathogenicityrs756944795RCV000321128|RCV000375788|RCV000571724; NMONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171711850317118503GC17:g.17118503G>CClinGen:CA8416006C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1424C>A (p.Ala475Glu)201163FLCNUncertain significance-1RCV001368676; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711850717118507GT17118507-
NM_144997.7(FLCN):c.1424C>T (p.Ala475Val)201163FLCNUncertain significance-1RCV001938400; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711850717118507GA17118507-
NM_144997.7(FLCN):c.1420G>A (p.Ala474Thr)201163FLCNUncertain significancers2046876810RCV001346281; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711851117118511CT17118511-
NM_144997.7(FLCN):c.1419A>C (p.Val473=)201163FLCNLikely benignrs141036419RCV000925528|RCV001811539; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171711851217118512TG17:g.17118512T>G-
NM_144997.7(FLCN):c.1418T>C (p.Val473Ala)201163FLCNConflicting interpretations of pathogenicityrs144883828RCV000460964|RCV000575471|RCV001721499; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202171711851317118513AGNC_000017.10:g.17118513A>GClinGen:CA8416008C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1417G>A (p.Val473Ile)201163FLCNUncertain significancers1597579765RCV000795936; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711851417118514CT17:g.17118514C>T-
NM_144997.7(FLCN):c.1416T>C (p.Pro472=)201163FLCNLikely benignrs1420039293RCV000635584|RCV001011465|RCV001506563; NMedGen:CN517202|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711851517118515AG17:g.17118515A>GClinGen:CA498421247C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1415C>T (p.Pro472Leu)201163FLCNUncertain significancers1180118315RCV000635532|RCV001011458; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171711851617118516GA17:g.17118516G>AClinGen:CA398531129C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1414C>G (p.Pro472Ala)201163FLCNBenign/Likely benignrs151312899RCV000228627|RCV000568886|RCV001697686; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202171711851717118517GC17:g.17118517G>CClinGen:CA8416009C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1414C>T (p.Pro472Ser)201163FLCNUncertain significancers151312899RCV001227936; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711851717118517GA17:g.17118517G>A-
NM_144997.7(FLCN):c.1407T>C (p.Ser469=)201163FLCNLikely benign-1RCV002079437; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711852417118524AG17118524-
NM_144997.7(FLCN):c.1403C>T (p.Thr468Ile)201163FLCNUncertain significancers2046877587RCV001065629; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711852817118528GA17:g.17118528G>A-
NM_144997.7(FLCN):c.1397del (p.Val466fs)201163FLCNPathogenicrs2046877798RCV001071417; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711853417118534CAC17:g.17118534_17118534del-
NM_144997.7(FLCN):c.1397T>C (p.Val466Ala)201163FLCNUncertain significance-1RCV001777098|RCV001868821; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711853417118534AG17118534-
NM_144997.7(FLCN):c.1392G>A (p.Glu464=)201163FLCNLikely benign-1RCV001460733; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711853917118539CT17118539-
NM_144997.7(FLCN):c.1391A>C (p.Glu464Ala)201163FLCNUncertain significancers2046878030RCV001317737; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711854017118540TG17118540-
NM_144997.7(FLCN):c.1390G>A (p.Glu464Lys)201163FLCNUncertain significancers1471793185RCV001204191; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711854117118541CT17:g.17118541C>T-
NM_144997.7(FLCN):c.1389C>G (p.Tyr463Ter)201163FLCNPathogenicrs137852929RCV000003534|RCV000166580|RCV000255586|RCV000781382; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903171711854217118542GCNC_000017.10:g.17118542G>CClinGen:CA196224,OMIM:607273.0005
NM_144997.7(FLCN):c.1389C>T (p.Tyr463=)201163FLCNLikely benignrs137852929RCV000225850|RCV001011326|RCV001707564; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202171711854217118542GA17:g.17118542G>AClinGen:CA8416011C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1389C>A (p.Tyr463Ter)201163FLCNPathogenicrs137852929RCV000492426|RCV000239639; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711854217118542GT17:g.17118542G>TClinGen:CA10586253C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1387T>C (p.Tyr463His)201163FLCNConflicting interpretations of pathogenicityrs770077517RCV000457253|RCV000561721|RCV001354212; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202171711854417118544AGNC_000017.10:g.17118544A>GClinGen:CA8416012C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1385A>T (p.Lys462Met)201163FLCNUncertain significance-1RCV001766308|RCV001868684; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711854617118546TA17118546-
NM_144997.7(FLCN):c.1382G>A (p.Ser461Asn)201163FLCNUncertain significancers1397579538RCV000692977; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711854917118549CTNC_000017.10:g.17118549C>T-C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1379_1380del (p.Leu460fs)201163FLCNPathogenicrs1064793128RCV000485073|RCV000492502|RCV000702300; NMedGen:CN517202|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711855117118552TGAT17:g.17118551_17118552delClinGen:CA16620337C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1380C>T (p.Leu460=)201163FLCNLikely benignrs773581294RCV000869768|RCV001011281; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171711855117118551GA17:g.17118551G>A-
NM_144997.7(FLCN):c.1379T>C (p.Leu460Pro)201163FLCNUncertain significancers112196863RCV000551704; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711855217118552AG17:g.17118552A>GClinGen:CA288305654C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1376C>T (p.Ser459Phe)201163FLCNUncertain significancers377468280RCV000536695|RCV001011229; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171711855517118555GANC_000017.10:g.17118555G>AClinGen:CA8416014C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1376C>G (p.Ser459Cys)201163FLCNUncertain significance-1RCV001881031; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711855517118555GC17118555-
NM_144997.7(FLCN):c.1375T>G (p.Ser459Ala)201163FLCNUncertain significancers1229110607RCV000800120; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711855617118556AC17:g.17118556A>C-
NM_144997.7(FLCN):c.1375T>C (p.Ser459Pro)201163FLCNUncertain significancers1229110607RCV001339524; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711855617118556AG17118556-
NM_144997.7(FLCN):c.1358_1374del (p.Gly453fs)201163FLCNPathogenicrs1555607179RCV000635553; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711855717118573ACTGGTCATCCTCACACCANC_000017.10:g.17118558_17118574delClinGen:CA658798732C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1373A>G (p.Gln458Arg)201163FLCNUncertain significancers150439088RCV000558097|RCV001011243|RCV001775852; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202171711855817118558TC17:g.17118558T>CClinGen:CA8416015C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1365G>T (p.Glu455Asp)201163FLCNUncertain significancers1050188504RCV001011060|RCV001048128; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711856617118566CA17:g.17118566C>A-
NM_144997.7(FLCN):c.1365G>C (p.Glu455Asp)201163FLCNUncertain significance-1RCV001886087; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711856617118566CG17118566-
NM_144997.7(FLCN):c.1364A>G (p.Glu455Gly)201163FLCNUncertain significancers199786696RCV000223022|RCV000687348; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711856717118567TC17:g.17118567T>CClinGen:CA8416016C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1357_1363del (p.Gly453fs)201163FLCNPathogenicrs1131690841RCV000492687|RCV001044760; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711856817118574TCACACCCT17:g.17118568_17118574delClinGen:CA498421326C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1363G>A (p.Glu455Lys)201163FLCNUncertain significancers759637055RCV000802282; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711856817118568CT17:g.17118568C>T-
NM_144997.7(FLCN):c.1360T>G (p.Cys454Gly)201163FLCNUncertain significancers767762804RCV001053244; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711857117118571AC17:g.17118571A>C-
NM_144997.7(FLCN):c.1359G>A (p.Gly453=)201163FLCNLikely benignrs752677061RCV000635582; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711857217118572CTNC_000017.10:g.17118572C>TClinGen:CA8416019C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1359del (p.Cys454fs)201163FLCNPathogenicrs1555607212RCV000635535; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711857217118572ACA17:g.17118572_17118572delClinGen:CA658798733C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1359G>C (p.Gly453=)201163FLCNLikely benign-1RCV002108543; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711857217118572CG17118572-
NM_144997.7(FLCN):c.1358G>A (p.Gly453Glu)201163FLCNUncertain significancers1555607217RCV000562308|RCV001853770; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711857317118573CTNC_000017.10:g.17118573C>TClinGen:CA398531362C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1347_1353dup (p.Val452fs)201163FLCNPathogenic-1RCV001386118; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711857717118578CCAGGGTGG17118577-
NM_144997.7(FLCN):c.1354G>A (p.Val452Met)201163FLCNUncertain significance-1RCV001947996; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711857717118577CT17118577-
NM_144997.7(FLCN):c.1353T>C (p.Pro451=)201163FLCNLikely benignrs1597580172RCV000878841|RCV002065452; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711857817118578AG17:g.17118578A>G-
NM_144997.7(FLCN):c.1352C>G (p.Pro451Arg)201163FLCNUncertain significancers2046880586RCV001323539; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711857917118579GC17118579-
NM_144997.7(FLCN):c.1333_1352del (p.Ala445fs)201163FLCNPathogenic-1RCV001385607; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711857917118598AGGGTGGAGGGTGGAACGTGCA17118578-
NM_144997.7(FLCN):c.1351C>T (p.Pro451Ser)201163FLCNUncertain significancers2046880742RCV001058907; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711858017118580GA17:g.17118580G>A-
NM_144997.7(FLCN):c.1350C>T (p.His450=)201163FLCNLikely benignrs753685944RCV000456275|RCV001559699; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171711858117118581GANC_000017.10:g.17118581G>AClinGen:CA8416022C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1346T>C (p.Leu449Pro)201163FLCNUncertain significance-1RCV001904070; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711858517118585AG17118585-
NM_144997.7(FLCN):c.1338T>C (p.Arg446=)201163FLCNLikely benign-1RCV002076822; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711859317118593AG17118593-
NM_144997.7(FLCN):c.1337G>A (p.Arg446His)201163FLCNUncertain significancers750104212RCV000809356|RCV001010835; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171711859417118594CT17:g.17118594C>T-
NM_144997.7(FLCN):c.1337G>T (p.Arg446Leu)201163FLCNUncertain significance-1RCV002000645; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711859417118594CA17118594-
NM_144997.7(FLCN):c.1336C>T (p.Arg446Cys)201163FLCNUncertain significancers200724468RCV000815599; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711859517118595GA17:g.17118595G>A-
NM_144997.7(FLCN):c.1336C>A (p.Arg446Ser)201163FLCNUncertain significancers200724468RCV001235570; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711859517118595GT17:g.17118595G>T-
NM_144997.7(FLCN):c.1318_1334dup (p.Leu449fs)201163FLCNPathogenicrs879255677RCV000239636|RCV000483674|RCV000492447; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171711859617118597TTGCGGCTGCGTGGACCTCNC_000017.10:g.17118597_17118613dupClinGen:CA10586254
NM_144997.7(FLCN):c.1333G>A (p.Ala445Thr)201163FLCNConflicting interpretations of pathogenicityrs41419545RCV000003537|RCV000034789|RCV000121112|RCV000163302|RCV000232087|RCV000336471|RCV001762032; NMONDO:MONDO:0002032,MedGen:C0699790|MedGen:CN517202|MedGen:CN169374|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:29171711859817118598CT17:g.17118598C>TClinGen:CA159795,UniProtKB:Q8NFG4#VAR_025361,OMIM:607273.0008C0699790 114500 Carcinoma of colon;
NM_144997.7(FLCN):c.1333G>C (p.Ala445Pro)201163FLCNUncertain significancers41419545RCV001350360; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711859817118598CG17118598-
NM_144997.7(FLCN):c.1332C>T (p.Ala444=)201163FLCNBenign/Likely benignrs141283741RCV000228190|RCV000296794|RCV000433262|RCV000564032|RCV001705718; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MedGen:CN169374|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202171711859917118599GA17:g.17118599G>AClinGen:CA8416027C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1332C>G (p.Ala444=)201163FLCNLikely benign-1RCV001448706; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711859917118599GC17118599-
NM_144997.7(FLCN):c.1330G>A (p.Ala444Thr)201163FLCNUncertain significancers876660342RCV000215804|RCV000803452; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711860117118601CTNC_000017.10:g.17118601C>TClinGen:CA10580169C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1327G>A (p.Ala443Thr)201163FLCNUncertain significancers535236784RCV000822472; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711860417118604CT17:g.17118604C>T-
NM_144997.7(FLCN):c.1327G>T (p.Ala443Ser)201163FLCNUncertain significance-1RCV002007000; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711860417118604CA17118604-
NM_144997.7(FLCN):c.1326C>T (p.His442=)201163FLCNLikely benignrs145004158RCV000467172|RCV000568426|RCV001538848; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202171711860517118605GANC_000017.10:g.17118605G>AClinGen:CA8416030C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1326del (p.His442fs)201163FLCNPathogenicrs1597580340RCV000814030; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711860517118605CGC17:g.17118605_17118605del-
NM_144997.7(FLCN):c.1323C>G (p.Val441=)201163FLCNLikely benign-1RCV002144551; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711860817118608GC17118608-
NM_144997.7(FLCN):c.1321del (p.Val441fs)201163FLCNPathogenic-1RCV001958597; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711861017118610ACA17118609-
NM_144997.7(FLCN):c.1318del (p.Glu440fs)201163FLCNPathogenicrs1555607273RCV000635547; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711861317118613TCT17:g.17118613_17118613delClinGen:CA658798734C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1317G>C (p.Val439=)201163FLCNLikely benign-1RCV001501632; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711861417118614CG17118614-
NM_144997.7(FLCN):c.1315G>A (p.Val439Met)201163FLCNUncertain significancers112980409RCV001010928|RCV001302679; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711861617118616CT17:g.17118616C>T-
NM_144997.7(FLCN):c.1315G>C (p.Val439Leu)201163FLCNUncertain significancers112980409RCV001314051; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711861617118616CG17118616-
NM_144997.7(FLCN):c.1314C>T (p.Ile438=)201163FLCNLikely benignrs771247255RCV000827434|RCV001085175; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711861717118617GANC_000017.10:g.17118617G>AClinGen:CA8416032C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1312A>T (p.Ile438Phe)201163FLCNUncertain significancers759743111RCV001309007; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711861917118619TA17118619-
NM_144997.7(FLCN):c.1311C>A (p.Val437=)201163FLCNLikely benignrs1002586963RCV000951710|RCV002066286; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711862017118620GT17:g.17118620G>T-
NM_144997.7(FLCN):c.1311C>T (p.Val437=)201163FLCNLikely benign-1RCV002084193; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711862017118620GA17118620-
NM_144997.7(FLCN):c.1311C>G (p.Val437=)201163FLCNLikely benign-1RCV002093125; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711862017118620GC17118620-
NM_144997.7(FLCN):c.1309G>C (p.Val437Leu)201163FLCNUncertain significancers772207015RCV000635538|RCV000765333; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|Gene:100038247,MONDO:MONDO:0012574,MedGen:C2931246,OMIM:610883, Orphanet:1713; MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122; MONDO:MONDO:0007763,MedGen:CN074294,OMIM:144700,Orphan171711862217118622CG17:g.17118622C>GClinGen:CA288305835C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1308T>C (p.Ala436=)201163FLCNLikely benign-1RCV001492868; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711862317118623AG17118623-
NM_144997.7(FLCN):c.1305del (p.Phe435fs)201163FLCNPathogenicrs398124527RCV000082627|RCV000492221|RCV000703847; NMedGen:CN517202|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711862617118626CAC17:g.17118626_17118626delClinGen:CA224155C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1305T>C (p.Phe435=)201163FLCNLikely benign-1RCV001483138; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711862617118626AG17118626-
NM_144997.7(FLCN):c.1301_1302del201163FLCNPathogenicrs1567808098RCV001269933|RCV001880199; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711862917118630ACTA17:g.17118629_17118630del-
NM_144997.7(FLCN):c.1301A>G (p.Glu434Gly)201163FLCNUncertain significancers1286890611RCV000810513; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711863017118630TC17:g.17118630T>C-
NM_144997.7(FLCN):c.1301-1G>C201163FLCNLikely pathogenicrs2046884079RCV001310193; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711863117118631CG17118631-
NM_144997.7(FLCN):c.1301-2A>G201163FLCNPathogenic/Likely pathogenicrs1555607296RCV000507517|RCV001208051; NMedGen:CN169374|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711863217118632TCNC_000017.10:g.17118632T>CClinGen:CA398531521CN169374 not specified;
NM_144997.7(FLCN):c.1301-3_1301-2del201163FLCNUncertain significancers2046884167RCV001323836; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711863217118633CTGC17118631-
NM_144997.7(FLCN):c.1301-4dup201163FLCNLikely benign-1RCV002193164; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711863317118634GGT17118633-
NM_144997.7(FLCN):c.1301-8T>C201163FLCNLikely benign-1RCV001459448; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711863817118638AG17118638-
NM_144997.7(FLCN):c.1301-17G>C201163FLCNLikely benign-1RCV002093769; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711864717118647CG17118647-
NM_144997.7(FLCN):c.1301-17del201163FLCNLikely benign-1RCV002082771; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711864717118647GCG17118646-
NM_144997.7(FLCN):c.1301-18G>A201163FLCNLikely benignrs186967236RCV000432771|RCV002063512; NMedGen:CN169374|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711864817118648CT17:g.17118648C>TClinGen:CA8416039CN169374 not specified;
NM_144997.7(FLCN):c.1301-18G>C201163FLCNLikely benign-1RCV002080616; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711864817118648CG17118648-
NM_144997.7(FLCN):c.1301-19G>A201163FLCNLikely benign-1RCV002097157; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711864917118649CT17118649-
NM_144997.7(FLCN):c.1301-20C>T201163FLCNLikely benign-1RCV002213638; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711865017118650GA17118650-
NM_144997.7(FLCN):c.1300+20G>C201163FLCNLikely benign-1RCV001980617; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711967417119674CG17119674-
NM_144997.7(FLCN):c.1300+18C>T201163FLCNLikely benign-1RCV002106941; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711967617119676GA17119676-
NM_144997.7(FLCN):c.1300+15G>A201163FLCNConflicting interpretations of pathogenicityrs751264915RCV000422709|RCV001861581; NMedGen:CN169374|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711967917119679CT17:g.17119679C>TClinGen:CA8416063CN169374 not specified;
NM_144997.7(FLCN):c.1300+14C>T201163FLCNConflicting interpretations of pathogenicityrs200823760RCV000350576|RCV000390580; NMONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711968017119680GA17:g.17119680G>AClinGen:CA8416065C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1300+13G>A201163FLCNLikely benign-1RCV002083892; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711968117119681CT17119681-
NM_144997.7(FLCN):c.1300+12C>T201163FLCNBenignrs565983064RCV001698295|RCV002063522; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711968217119682GA17:g.17119682G>AClinGen:CA8416067CN169374 not specified;
NC_000017.11:g.(?_17216370)_(17228161_?)del201163FLCNPathogenic-1RCV001032504; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711968417131475nana-1-
NM_144997.7(FLCN):c.1300+10C>A201163FLCNLikely benign-1RCV001417405; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711968417119684GT17119684-
NC_000017.10:g.(?_17119684)_(17136215_?)dup201163FLCNUncertain significance-1RCV002007106; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711968417136215nana-1-
NC_000017.10:g.(?_17119684)_(17140502_?)del201163FLCNPathogenic-1RCV001983023; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711968417140502nana-1-
NM_144997.7(FLCN):c.1300+10C>T201163FLCNLikely benign-1RCV002173474; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711968417119684GA17119684-
NM_144997.7(FLCN):c.1300+9C>G201163FLCNLikely benignrs1197783802RCV000878249; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711968517119685GC17:g.17119685G>C-
NM_144997.7(FLCN):c.1300+8C>T201163FLCNLikely benignrs936407961RCV000635596; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711968617119686GA17:g.17119686G>AClinGen:CA288307021C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1300+5G>A201163FLCNUncertain significancers746264578RCV000466503; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711968917119689CTNC_000017.10:g.17119689C>TClinGen:CA16615104C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1300+5G>C201163FLCNUncertain significancers746264578RCV001036522; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711968917119689CG17:g.17119689C>G-
NM_144997.7(FLCN):c.1300+4C>T201163FLCNUncertain significancers1207963576RCV001063632; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711969017119690GA17:g.17119690G>A-
NM_144997.7(FLCN):c.1300+4C>G201163FLCNUncertain significance-1RCV001908774; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711969017119690GC17119690-
NM_144997.7(FLCN):c.1300+1G>A201163FLCNPathogenic/Likely pathogenicrs879255676RCV000239706|RCV000492381; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171711969317119693CT17:g.17119693C>TClinGen:CA10586255C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1300+1G>C201163FLCNLikely pathogenic-1RCV002039408; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711969317119693CG17119693-
NM_144997.7(FLCN):c.1300G>T (p.Glu434Ter)201163FLCNPathogenicrs1266098984RCV000578705|RCV000807381; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711969417119694CANC_000017.10:g.17119694C>AClinGen:CA398531571
NM_144997.7(FLCN):c.1300G>A (p.Glu434Lys)201163FLCNUncertain significancers1266098984RCV001036172; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711969417119694CT17:g.17119694C>T-
NM_144997.7(FLCN):c.1298C>T (p.Ser433Leu)201163FLCNUncertain significancers1060502372RCV000458113|RCV001010579; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171711969617119696GANC_000017.10:g.17119696G>AClinGen:CA16615110C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1293CTC[1] (p.Ser433del)201163FLCNUncertain significance-1RCV002042220; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711969617119698TGAGT17119695-
NM_144997.7(FLCN):c.1294T>C (p.Ser432Pro)201163FLCNUncertain significancers1597583773RCV000811961; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711970017119700AG17:g.17119700A>G-
NM_144997.7(FLCN):c.1288G>A (p.Val430Met)201163FLCNUncertain significancers911287169RCV001010774|RCV001214732; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711970617119706CT17:g.17119706C>T-
NM_144997.7(FLCN):c.1287C>T (p.His429=)201163FLCNLikely benignrs374707789RCV000234414|RCV000567559|RCV000606929; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN169374171711970717119707GA17:g.17119707G>AClinGen:CA8416072C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1286dup (p.His429fs)201163FLCNPathogenicrs879255675RCV000413427|RCV000239666; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711970717119708GGTNC_000017.10:g.17119708dupClinGen:CA10586256
NM_144997.7(FLCN):c.1285dup (p.His429fs)201163FLCNPathogenicrs80338682RCV000003529|RCV000003530|RCV000082626|RCV000130568|RCV001762031; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MedGen:CN517202|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0005575,MedGen:C0346629,OMIM:114500171711970817119709TTG17:g.17119708_17119709insGClinGen:CA090951,OMIM:607273.0001C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1286A>C (p.His429Pro)201163FLCNUncertain significance-1RCV002034279; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711970817119708TG17119708-
NM_144997.7(FLCN):c.1285del (p.His429fs)201163FLCNPathogenicrs80338682RCV000003531|RCV000082625|RCV000492709|RCV001000611; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN169374171711970917119709TGTNC_000017.10:g.17119716delClinGen:CA224154,OMIM:607273.0002
NM_144997.7(FLCN):c.1285C>G (p.His429Asp)201163FLCNUncertain significancers375082054RCV000571150|RCV000706666; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711970917119709GCNC_000017.10:g.17119709G>CClinGen:CA398531625C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1285C>T (p.His429Tyr)201163FLCNUncertain significancers375082054RCV000567009|RCV000812782|RCV001755958; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171711970917119709GANC_000017.10:g.17119709G>AClinGen:CA8416073C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1285C>A (p.His429Asn)201163FLCNUncertain significancers375082054RCV000817804|RCV001010754; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171711970917119709GT17:g.17119709G>T-
NM_144997.7(FLCN):c.1284C>G (p.Pro428=)201163FLCNLikely benignrs942763423RCV000575299|RCV000635577; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711971017119710GCNC_000017.10:g.17119710G>CClinGen:CA288307140C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1284C>T (p.Pro428=)201163FLCNLikely benign-1RCV001419942; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711971017119710GA17119710-
NM_144997.7(FLCN):c.1283C>T (p.Pro428Leu)201163FLCNUncertain significancers199889477RCV000121110|RCV000568600|RCV000635530; NMedGen:CN169374|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711971117119711GA17:g.17119711G>AClinGen:CA159789C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1283C>A (p.Pro428His)201163FLCNUncertain significancers199889477RCV000163906|RCV000529447|RCV001544699|RCV001762364; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202|MONDO:MONDO:0005575,MedGen:C0346629,OMIM:114500171711971117119711GT17:g.17119711G>TClinGen:CA189480C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1283C>G (p.Pro428Arg)201163FLCNConflicting interpretations of pathogenicityrs199889477RCV000544195|RCV000565364|RCV001580511; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202171711971117119711GC17:g.17119711G>CClinGen:CA8416075C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1282C>G (p.Pro428Ala)201163FLCNConflicting interpretations of pathogenicityrs368880414RCV000569333|RCV001051328|RCV001755957; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171711971217119712GCNC_000017.10:g.17119712G>CClinGen:CA8416076C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1282C>A (p.Pro428Thr)201163FLCNUncertain significancers368880414RCV001341829; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711971217119712GT17119712-
NM_144997.7(FLCN):c.1282C>T (p.Pro428Ser)201163FLCNUncertain significance-1RCV002029344; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711971217119712GA17119712-
NM_144997.7(FLCN):c.1281C>G (p.Pro427=)201163FLCNConflicting interpretations of pathogenicityrs372207262RCV000311957|RCV000348103|RCV000565832|RCV000858725; NMONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202171711971317119713GC17:g.17119713G>CClinGen:CA8416077C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1281C>T (p.Pro427=)201163FLCNLikely benignrs372207262RCV000555405|RCV001010731; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171711971317119713GANC_000017.10:g.17119713G>AClinGen:CA498163243C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1280C>T (p.Pro427Leu)201163FLCNUncertain significancers766218250RCV000686185|RCV001010727; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171711971417119714GA17:g.17119714G>A-C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1279C>A (p.Pro427Thr)201163FLCNUncertain significancers773986076RCV000567390|RCV000696164; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711971517119715GT17:g.17119715G>TClinGen:CA8416079C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1278C>T (p.Ile426=)201163FLCNLikely benignrs41459448RCV000164080|RCV000476954|RCV001093242; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171711971617119716GA17:g.17119716G>AClinGen:CA189994C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1277T>C (p.Ile426Thr)201163FLCNUncertain significancers766990565RCV001053514; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711971717119717AG17:g.17119717A>G-
NM_144997.7(FLCN):c.1276A>G (p.Ile426Val)201163FLCNUncertain significancers1296086439RCV001337850; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711971817119718TC17119718-
NM_144997.7(FLCN):c.1275G>A (p.Gln425=)201163FLCNLikely benignrs1555607680RCV000545279; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711971917119719CT17:g.17119719C>TClinGen:CA498163246C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1274A>G (p.Gln425Arg)201163FLCNUncertain significancers786203348RCV000166621|RCV000635548|RCV001558726; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171711972017119720TC17:g.17119720T>CClinGen:CA196326C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1271T>C (p.Val424Ala)201163FLCNUncertain significancers752170592RCV001214989; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711972317119723AG17:g.17119723A>G-
NM_144997.7(FLCN):c.1270G>A (p.Val424Met)201163FLCNUncertain significancers1264775833RCV000572228|RCV000819536; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711972417119724CTNC_000017.10:g.17119724C>TClinGen:CA398531674C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1269C>T (p.His423=)201163FLCNBenign/Likely benignrs41464156RCV000130346|RCV000230490|RCV000308420|RCV000858339; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MedGen:CN517202171711972517119725GA17:g.17119725G>AClinGen:CA166238C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1269C>G (p.His423Gln)201163FLCNUncertain significancers41464156RCV001066856; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711972517119725GC17:g.17119725G>C-
NM_144997.7(FLCN):c.1267C>T (p.His423Tyr)201163FLCNUncertain significancers765628527RCV000706446; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711972717119727GANC_000017.10:g.17119727G>A-C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1266G>A (p.Pro422=)201163FLCNLikely benignrs751013842RCV001010633|RCV001432226; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711972817119728CT17:g.17119728C>T-
NM_144997.7(FLCN):c.1266G>T (p.Pro422=)201163FLCNLikely benign-1RCV002105227; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711972817119728CA17119728-
NM_144997.7(FLCN):c.1265C>T (p.Pro422Leu)201163FLCNUncertain significancers565447853RCV000462559|RCV001010630|RCV001584159; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202171711972917119729GANC_000017.10:g.17119729G>AClinGen:CA8416084C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1265C>G (p.Pro422Arg)201163FLCNUncertain significancers565447853RCV000706889; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711972917119729GCNC_000017.10:g.17119729G>C-C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1265del (p.Pro422fs)201163FLCNPathogenic-1RCV001972808; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711972917119729CGC17119728-
NM_144997.7(FLCN):c.1262G>A (p.Ser421Asn)201163FLCNUncertain significancers368175757RCV001045667; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711973217119732CT17:g.17119732C>T-
NM_144997.7(FLCN):c.1260C>T (p.Leu420=)201163FLCNLikely benignrs780571501RCV000887762; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711973417119734GA17:g.17119734G>A-
NM_144997.7(FLCN):c.1260C>G (p.Leu420=)201163FLCNLikely benignrs780571501RCV000904244; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711973417119734GC17:g.17119734G>C-
NM_144997.7(FLCN):c.1253_1260delinsAG (p.Leu418_Leu420delinsGln)201163FLCNUncertain significancers2046923143RCV001246331; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711973417119741GAGCCCCACT17:g.17119735_17119741del-
NM_144997.7(FLCN):c.1257G>A (p.Gly419=)201163FLCNLikely benign-1RCV001417916; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711973717119737CT17119737-
NM_144997.7(FLCN):c.1257G>T (p.Gly419=)201163FLCNLikely benign-1RCV002091737; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711973717119737CA17119737-
NM_144997.7(FLCN):c.1256G>A (p.Gly419Glu)201163FLCNUncertain significancers755177473RCV001049981; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711973817119738CT17:g.17119738C>T-
NM_144997.7(FLCN):c.1253T>C (p.Leu418Pro)201163FLCNUncertain significancers879255674RCV000493637|RCV000239663; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711974117119741AGNC_000017.10:g.17119741A>GClinGen:CA10586257C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1252del (p.Leu418fs)201163FLCNPathogenicrs864622651RCV000204355|RCV000255990|RCV000492723; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171711974217119742AGANC_000017.10:g.17119743delClinGen:CA348602
NM_144997.7(FLCN):c.1252C>T (p.Leu418=)201163FLCNLikely benignrs1060504595RCV000468247|RCV001010548; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171711974217119742GANC_000017.10:g.17119742G>AClinGen:CA16615519C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1251C>T (p.Phe417=)201163FLCNLikely benignrs980174552RCV000928229; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711974317119743GA17:g.17119743G>A-
NM_144997.7(FLCN):c.1247A>G (p.Asn416Ser)201163FLCNUncertain significancers781295687RCV001010537|RCV001228880; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711974717119747TC17:g.17119747T>C-
NM_144997.7(FLCN):c.1243T>C (p.Cys415Arg)201163FLCNUncertain significancers1567809578RCV000696473; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711975117119751AG17:g.17119751A>G-C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1242G>A (p.Arg414=)201163FLCNLikely benignrs376836624RCV000919620|RCV001426101; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711975217119752CT17:g.17119752C>T-
NM_144997.7(FLCN):c.1242G>T (p.Arg414=)201163FLCNLikely benign-1RCV001442838; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711975217119752CA17119752-
NM_144997.7(FLCN):c.1241G>A (p.Arg414Gln)201163FLCNUncertain significancers1363880753RCV001010524|RCV001059187|RCV001766826; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171711975317119753CT17:g.17119753C>T-
NM_144997.7(FLCN):c.1240C>T (p.Arg414Trp)201163FLCNUncertain significancers1226407835RCV001319590|RCV001760400; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0005575,MedGen:C0346629,OMIM:114500171711975417119754GA17119754-
NM_144997.7(FLCN):c.1236C>G (p.Ala412=)201163FLCNLikely benignrs769968368RCV000937352|RCV001494363; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711975817119758GC17:g.17119758G>C-
NM_144997.7(FLCN):c.1236C>T (p.Ala412=)201163FLCNLikely benign-1RCV001469264; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711975817119758GA17119758-
NM_144997.7(FLCN):c.1235C>A (p.Ala412Asp)201163FLCNUncertain significancers2046925178RCV001306091; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711975917119759GT17119759-
NM_144997.7(FLCN):c.1234G>T (p.Ala412Ser)201163FLCNUncertain significancers866494624RCV001235196; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711976017119760CA17:g.17119760C>A-
NM_144997.7(FLCN):c.1233G>A (p.Glu411=)201163FLCNBenignrs61750032RCV000082624|RCV000131066|RCV000268391|RCV000362997|RCV000587295; NMedGen:CN169374|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171711976117119761CT17:g.17119761C>TClinGen:CA149546C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1230G>A (p.Glu410=)201163FLCNLikely benign-1RCV001492689; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711976417119764CT17119764-
NM_144997.7(FLCN):c.1229A>G (p.Glu410Gly)201163FLCNUncertain significancers2046925649RCV001045934; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711976517119765TC17:g.17119765T>C-
NM_144997.7(FLCN):c.1228G>A (p.Glu410Lys)201163FLCNUncertain significancers763591386RCV001048010; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711976617119766CT17:g.17119766C>T-
NM_144997.7(FLCN):c.1227C>T (p.Tyr409=)201163FLCNLikely benignrs561236067RCV000866120|RCV001010435|RCV001721397; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202171711976717119767GA17:g.17119767G>AClinGen:CA8416092CN169374 not specified;
NM_144997.7(FLCN):c.1226A>G (p.Tyr409Cys)201163FLCNUncertain significancers2046925964RCV001315254; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711976817119768TC17119768-
NM_144997.7(FLCN):c.1224G>T (p.Gln408His)201163FLCNUncertain significancers774142829RCV000702759|RCV001010420|RCV001565834; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202171711977017119770CA17:g.17119770C>A-C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1223A>G (p.Gln408Arg)201163FLCNUncertain significancers1172104668RCV000635542; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711977117119771TCNC_000017.10:g.17119771T>CClinGen:CA398531854C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1222C>T (p.Gln408Ter)201163FLCNPathogenic-1RCV001953597; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711977217119772GA17119772-
NM_144997.7(FLCN):c.1219del (p.Ser407fs)201163FLCNPathogenicrs878855213RCV000228856|RCV000255255; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171711977517119775CTC17:g.17119775_17119775delClinGen:CA10583452C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1219A>G (p.Ser407Gly)201163FLCNUncertain significancers1352297460RCV001341844; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711977517119775TC17119775-
NM_144997.7(FLCN):c.1217G>C (p.Ser406Thr)201163FLCNUncertain significance-1RCV001932601; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711977717119777CG17119777-
NM_144997.7(FLCN):c.1216A>G (p.Ser406Gly)201163FLCNUncertain significancers528541881RCV000635537|RCV001010335; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171711977817119778TCNC_000017.10:g.17119778T>CClinGen:CA8416094C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1215C>G (p.Tyr405Ter)201163FLCNPathogenicrs786202541RCV000165394|RCV001219608; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711977917119779GC17:g.17119779G>CClinGen:CA193271C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1215C>T (p.Tyr405=)201163FLCNLikely benign-1RCV001446288; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711977917119779GA17119779-
NM_144997.7(FLCN):c.1213dup (p.Tyr405fs)201163FLCNPathogenicrs1131690837RCV000492570|RCV000817465; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711978017119781TTANC_000017.10:g.17119781dupClinGen:CA645369714C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1213T>C (p.Tyr405His)201163FLCNUncertain significance-1RCV001363392; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711978117119781AG17119781-
NM_144997.7(FLCN):c.1211C>A (p.Pro404Gln)201163FLCNUncertain significancers2046926816RCV001058231; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711978317119783GT17:g.17119783G>T-
NM_144997.7(FLCN):c.1209C>T (p.Ile403=)201163FLCNLikely benign-1RCV002122183; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711978517119785GA17119785-
NM_144997.7(FLCN):c.1205T>C (p.Ile402Thr)201163FLCNUncertain significancers1597584543RCV000800434; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711978917119789AG17:g.17119789A>G-
NM_144997.7(FLCN):c.1203dup (p.Ile402fs)201163FLCNPathogenicrs398124526RCV000082623|RCV000807361|RCV001292861; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903171711979017119791TTGNC_000017.10:g.17119791dupClinGen:CA224153
NM_144997.7(FLCN):c.1202G>A (p.Arg401His)201163FLCNUncertain significancers771653740RCV000792931|RCV001010203; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171711979217119792CT17:g.17119792C>T-
NM_144997.7(FLCN):c.1201C>T (p.Arg401Cys)201163FLCNConflicting interpretations of pathogenicityrs143183215RCV000233961|RCV000492247|RCV001582792; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202171711979317119793GA17:g.17119793G>AClinGen:CA8416096C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1201C>A (p.Arg401Ser)201163FLCNUncertain significance-1RCV001987780; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711979317119793GT17119793-
NM_144997.7(FLCN):c.1201C>G (p.Arg401Gly)201163FLCNUncertain significance-1RCV002016104; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711979317119793GC17119793-
NM_144997.7(FLCN):c.1199T>C (p.Val400Ala)201163FLCNUncertain significancers760079073RCV000685034|RCV001010255; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171711979517119795AG17:g.17119795A>G-C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1198G>T (p.Val400Phe)201163FLCNUncertain significancers148257120RCV000082622|RCV000472239|RCV001010250; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171711979617119796CA17:g.17119796C>AClinGen:CA224150C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1198G>A (p.Val400Ile)201163FLCNConflicting interpretations of pathogenicityrs148257120RCV000121111|RCV000166127|RCV000231168; NMedGen:CN169374|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711979617119796CT17:g.17119796C>TClinGen:CA159792C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1197C>T (p.Cys399=)201163FLCNLikely benignrs750894316RCV000473342; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711979717119797GANC_000017.10:g.17119797G>AClinGen:CA8416098C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1194C>A (p.Gly398=)201163FLCNLikely benign-1RCV002211744; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711980017119800GT17119800-
NM_144997.7(FLCN):c.1193G>C (p.Gly398Ala)201163FLCNUncertain significancers766801011RCV000530248; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711980117119801CG17:g.17119801C>GClinGen:CA8416100C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1189G>A (p.Val397Met)201163FLCNUncertain significancers752006809RCV000470218; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711980517119805CTNC_000017.10:g.17119805C>TClinGen:CA8416101C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1189G>T (p.Val397Leu)201163FLCNUncertain significance-1RCV002023670; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711980517119805CA17119805-
NM_144997.7(FLCN):c.1188del (p.Val397fs)201163FLCNPathogenicrs1567809782RCV000756171|RCV001048163; NMedGen:CN169374|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711980617119806CGCNC_000017.10:g.17119808del-
NM_144997.7(FLCN):c.1188C>T (p.Pro396=)201163FLCNLikely benignrs1025539940RCV000877641|RCV001394416; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711980617119806GA17:g.17119806G>A-
NM_144997.7(FLCN):c.1181T>C (p.Met394Thr)201163FLCNUncertain significancers1335868794RCV001064547|RCV001585968; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171711981317119813AG17:g.17119813A>G-
NM_144997.7(FLCN):c.1179del (p.Met394fs)201163FLCNPathogenicrs398124525RCV000082621|RCV000492656|RCV000691870; NMedGen:CN517202|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711981517119815TGT17:g.17119815_17119815delClinGen:CA224149C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1179C>G (p.Thr393=)201163FLCNLikely benign-1RCV002163787; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711981517119815GC17119815-
NM_144997.7(FLCN):c.1179C>A (p.Thr393=)201163FLCNLikely benign-1RCV002192457; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711981517119815GT17119815-
NM_144997.7(FLCN):c.1179C>T (p.Thr393=)201163FLCNLikely benign-1RCV002134356; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711981517119815GA17119815-
NM_144997.7(FLCN):c.1177A>G (p.Thr393Ala)201163FLCNUncertain significance-1RCV002008994; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711981717119817TC17119817-
NM_144997.7(FLCN):c.1177-5_1177-3del201163FLCNConflicting interpretations of pathogenicityrs767671406RCV000217238|RCV000217604|RCV000239690|RCV000255836; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN169374|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171711982017119822TGAGTNC_000017.10:g.17119822GGA[1]ClinGen:CA8416103
NM_144997.7(FLCN):c.1177-9C>T201163FLCNLikely benign-1RCV001431076; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711982617119826GA17119826-
NM_144997.7(FLCN):c.1177-11G>A201163FLCNLikely benign-1RCV002115161; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711982817119828CT17119828-
NM_144997.7(FLCN):c.1177-21G>A201163FLCNBenign/Likely benignrs150687840RCV000604787|RCV001511953; NMedGen:CN169374|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171711983817119838CT17:g.17119838C>TClinGen:CA8416106CN169374 not specified;
NM_144997.7(FLCN):c.1176+17C>G201163FLCNLikely benign-1RCV002104759; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712036617120366GC17120366-
NM_144997.7(FLCN):c.1176+17C>T201163FLCNLikely benign-1RCV002182557; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712036617120366GA17120366-
NM_144997.7(FLCN):c.1176+15T>C201163FLCNBenign-1RCV002078490; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712036817120368AG17120368-
NM_144997.7(FLCN):c.1176+14T>A201163FLCNLikely benignrs757366854RCV000249390|RCV002058406; NMedGen:CN169374|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712036917120369AT17:g.17120369A>TClinGen:CA8416128CN169374 not specified;
NM_144997.7(FLCN):c.1176+9A>G201163FLCNLikely benignrs1210541380RCV000866021; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712037417120374TC17:g.17120374T>C-
NM_144997.7(FLCN):c.1176+8C>T201163FLCNLikely benignrs1033129279RCV000463368; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712037517120375GANC_000017.10:g.17120375G>AClinGen:CA16615111C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1176+6A>G201163FLCNUncertain significancers2046947837RCV001202100; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712037717120377TC17:g.17120377T>C-
NM_144997.7(FLCN):c.1176+2T>A201163FLCNLikely pathogenicrs2046947920RCV001212592; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712038117120381AT17:g.17120381A>T-
NM_144997.7(FLCN):c.1176+1G>C201163FLCNLikely pathogenic-1RCV002038045; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712038217120382CG17120382-
NM_144997.7(FLCN):c.1176G>C (p.Arg392=)201163FLCNUncertain significancers2046948026RCV001202618; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712038317120383CG17:g.17120383C>G-
NM_144997.7(FLCN):c.1174C>T (p.Arg392Trp)201163FLCNUncertain significancers1060502374RCV000460332|RCV001010129; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171712038517120385GANC_000017.10:g.17120385G>AClinGen:CA16615362C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1171C>T (p.Leu391Phe)201163FLCNUncertain significancers1555607942RCV000569081|RCV001858369; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712038817120388GANC_000017.10:g.17120388G>AClinGen:CA398532106C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1168G>A (p.Val390Ile)201163FLCNUncertain significancers991762823RCV001010114|RCV001766824|RCV001239490; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0005575,MedGen:C0346629,OMIM:114500|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712039117120391CT17:g.17120391C>T-
NM_144997.7(FLCN):c.1160C>T (p.Ala387Val)201163FLCNUncertain significancers1431737113RCV000541483|RCV001010029; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171712039917120399GANC_000017.10:g.17120399G>AClinGen:CA398532150C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1160C>A (p.Ala387Asp)201163FLCNUncertain significance-1RCV001527408; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712039917120399GT17120399-
NM_144997.7(FLCN):c.1159G>C (p.Ala387Pro)201163FLCNUncertain significancers2046948689RCV001322224; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712040017120400CG17120400-
NM_144997.7(FLCN):c.1155G>T (p.Gln385His)201163FLCNLikely benignrs141250189RCV000473687|RCV000570178; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171712040417120404CANC_000017.10:g.17120404C>AClinGen:CA8416130C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1155G>A (p.Gln385=)201163FLCNLikely benignrs141250189RCV000526741; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712040417120404CTNC_000017.10:g.17120404C>TClinGen:CA498163361C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1153C>T (p.Gln385Ter)201163FLCNPathogenic-1RCV001390959; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712040617120406GA17120406-
NM_144997.7(FLCN):c.1150G>A (p.Val384Ile)201163FLCNUncertain significancers779913370RCV001042440; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712040917120409CT17:g.17120409C>T-
NM_144997.7(FLCN):c.1149C>T (p.Leu383=)201163FLCNConflicting interpretations of pathogenicityrs150752548RCV000082620|RCV000163531|RCV000723579|RCV001079714; NMedGen:CN169374|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712041017120410GA17:g.17120410G>AClinGen:CA188545C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1142_1144del (p.Val381del)201163FLCNUncertain significance-1RCV001954301; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712041517120417TCCAT17120414-
NM_144997.7(FLCN):c.1141G>A (p.Val381Met)201163FLCNUncertain significancers1347669124RCV000805211; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712041817120418CT17:g.17120418C>T-
NM_144997.7(FLCN):c.1141del (p.Val381fs)201163FLCNPathogenic-1RCV001951088; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712041817120418ACA17120417-
NM_144997.7(FLCN):c.1140C>T (p.Asp380=)201163FLCNLikely benignrs768454196RCV000552761|RCV001017436|RCV001551753; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202171712041917120419GANC_000017.10:g.17120419G>AClinGen:CA8416133C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1124_1139del (p.Ile375fs)201163FLCNPathogenicrs879255673RCV000239660; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712042017120435GTCTCTGCTTTTCCAGAG17:g.17120420_17120435delClinGen:CA10586258C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1136G>A (p.Arg379Lys)201163FLCNUncertain significancers2046949704RCV001241581; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712042317120423CT17:g.17120423C>T-
NM_144997.7(FLCN):c.1135A>G (p.Arg379Gly)201163FLCNUncertain significancers747644007RCV000635543; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712042417120424TC17:g.17120424T>CClinGen:CA8416135C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1133G>A (p.Ser378Asn)201163FLCNUncertain significancers769489773RCV000542554|RCV000568232; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171712042617120426CTNC_000017.10:g.17120426C>TClinGen:CA8416136C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1131A>G (p.Lys377=)201163FLCNLikely benignrs1597586862RCV000940234; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712042817120428TC17:g.17120428T>C-
NM_144997.7(FLCN):c.1128G>A (p.Trp376Ter)201163FLCNPathogenicrs2046950183RCV001234310; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712043117120431CT17:g.17120431C>T-
NM_144997.7(FLCN):c.1127G>A (p.Trp376Ter)201163FLCNPathogenic-1RCV002035372; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712043217120432CT17120432-
NM_144997.7(FLCN):c.1122G>C (p.Val374=)201163FLCNLikely benign-1RCV001489897; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712043717120437CG17120437-
NM_144997.7(FLCN):c.1120G>C (p.Val374Leu)201163FLCNUncertain significancers1270035315RCV001322714; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712043917120439CG17120439-
NM_144997.7(FLCN):c.1117C>T (p.Gln373Ter)201163FLCNPathogenicrs398124524RCV000082619|RCV000165348|RCV000635546; NMedGen:CN517202|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712044217120442GA17:g.17120442G>AClinGen:CA193155C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1116C>T (p.Asn372=)201163FLCNLikely benign-1RCV001447745; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712044317120443GA17120443-
NM_144997.7(FLCN):c.1115A>G (p.Asn372Ser)201163FLCNUncertain significancers1567810665RCV000687024; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712044417120444TC17:g.17120444T>C-C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1113G>A (p.Gly371=)201163FLCNLikely benignrs1555607972RCV000527535; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712044617120446CTNC_000017.10:g.17120446C>TClinGen:CA498163386C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1105C>G (p.Leu369Val)201163FLCNUncertain significance-1RCV001931618; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712045417120454GC17120454-
NM_144997.7(FLCN):c.1102G>A (p.Val368Ile)201163FLCNUncertain significancers767714543RCV000808219|RCV001017316; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171712045717120457CT17:g.17120457C>T-
NM_144997.7(FLCN):c.1101C>T (p.His367=)201163FLCNLikely benignrs1451481907RCV000955145; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712045817120458GA17:g.17120458G>A-
NM_144997.7(FLCN):c.1098G>A (p.Trp366Ter)201163FLCNPathogenicrs879255672RCV000239618|RCV001269531; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171712046117120461CT17:g.17120461C>TClinGen:CA10586259C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1087A>T (p.Met363Leu)201163FLCNUncertain significancers1313891453RCV000549290|RCV000575146; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171712047217120472TA17:g.17120472T>AClinGen:CA398532361C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1087A>G (p.Met363Val)201163FLCNUncertain significancers1313891453RCV001237779; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712047217120472TC17:g.17120472T>C-
NM_144997.7(FLCN):c.1086C>T (p.Arg362=)201163FLCNUncertain significancers2046951541RCV001314450; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712047317120473GA17120473-
NM_144997.7(FLCN):c.1085G>T (p.Arg362Leu)201163FLCNUncertain significancers559055296RCV000216453|RCV000635561|RCV001753671; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171712047417120474CA17:g.17120474C>AClinGen:CA8416140C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1085G>A (p.Arg362His)201163FLCNUncertain significancers559055296RCV000635556; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712047417120474CT17:g.17120474C>TClinGen:CA398532365C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1084C>T (p.Arg362Cys)201163FLCNUncertain significancers557336321RCV000564803|RCV000691604|RCV001127833; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903171712047517120475GA17:g.17120475G>AClinGen:CA8416141C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1080T>G (p.Ser360=)201163FLCNLikely benign-1RCV001399143; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712047917120479AC17120479-
NM_144997.7(FLCN):c.1075C>T (p.Pro359Ser)201163FLCNUncertain significancers184718358RCV001222305; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712048417120484GA17:g.17120484G>A-
NM_144997.7(FLCN):c.1072G>A (p.Ala358Thr)201163FLCNUncertain significancers2046951963RCV001217252; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712048717120487CT17:g.17120487C>T-
NM_144997.7(FLCN):c.1068G>T (p.Leu356=)201163FLCNLikely benign-1RCV001400098; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712049117120491CA17120491-
NM_144997.7(FLCN):c.1067T>C (p.Leu356Pro)201163FLCNUncertain significancers879255671RCV000239686; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712049217120492AGNC_000017.10:g.17120492A>GClinGen:CA10586260C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1066C>G (p.Leu356Val)201163FLCNUncertain significancers757313788RCV000705955|RCV001009833; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171712049317120493GC17:g.17120493G>C-C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1063-2A>G201163FLCNUncertain significance-1RCV001938113; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712049817120498TC17120498-
NM_144997.7(FLCN):c.1063-6G>T201163FLCNLikely benignrs1060504592RCV000470245; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712050217120502CANC_000017.10:g.17120502C>AClinGen:CA16615109C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1063-6G>A201163FLCNLikely benign-1RCV001397531; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712050217120502CT17120502-
NM_144997.7(FLCN):c.1063-8_1063-7del201163FLCNUncertain significancers2046952645RCV001231358; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712050317120504CAAC17:g.17120503_17120504del-
NM_144997.7(FLCN):c.1063-9C>T201163FLCNUncertain significancers750271662RCV000534226; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712050517120505GANC_000017.10:g.17120505G>AClinGen:CA8416146C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1063-10T>G201163FLCNLikely benign-1RCV001456418; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712050617120506AC17120506-
NM_144997.7(FLCN):c.1063-11C>G201163FLCNLikely benign-1RCV002111904; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712050717120507GC17120507-
NM_144997.7(FLCN):c.1063-16G>A201163FLCNLikely benign-1RCV002123542; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712051217120512CT17120512-
NM_144997.7(FLCN):c.1062+20C>T201163FLCNLikely benign-1RCV002113750; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712231317122313GA17122313-
NM_144997.7(FLCN):c.1062+20C>A201163FLCNLikely benign-1RCV002078127; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712231317122313GT17122313-
NM_144997.7(FLCN):c.1062+11G>C201163FLCNLikely benign-1RCV002086978; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712232217122322CG17122322-
NC_000017.10:g.(?_17122323)_(17136215_?)del201163FLCNPathogenic-1RCV001959052; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712232317136215nana-1-
NM_144997.7(FLCN):c.1062+8G>C201163FLCNLikely benignrs1317761101RCV000635594; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712232517122325CG17:g.17122325C>GClinGen:CA625314138C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1062+8G>A201163FLCNLikely benign-1RCV001393251; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712232517122325CT17122325-
NM_144997.7(FLCN):c.1062+7G>A201163FLCNLikely benignrs540198776RCV000528614|RCV000615060; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN169374171712232617122326CT17:g.17122326C>TClinGen:CA8416167C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1062+6C>T201163FLCNBenignrs8065832RCV000082618|RCV000239642|RCV000359369|RCV000586435; NMedGen:CN169374|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MedGen:CN517202171712232717122327GA17:g.17122327G>AClinGen:CA149545C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1062+5_1062+6delinsTT201163FLCNUncertain significance-1RCV001870625; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712232717122328GCAA17122327-
NM_144997.7(FLCN):c.1062+2T>G201163FLCNPathogenicrs886039370RCV000254745|RCV001009818|RCV000812531; NMedGen:CN517202|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712233117122331ACNC_000017.10:g.17122331A>CClinGen:CA10588640CN517202 not provided;
NM_144997.7(FLCN):c.1062+1G>A201163FLCNPathogenicrs1131690832RCV000492743|RCV001390960; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712233217122332CT17:g.17122332C>TClinGen:CA398532584C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1059G>A (p.Arg353=)201163FLCNLikely benignrs751513488RCV000166276|RCV000549982|RCV001697199; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171712233617122336CT17:g.17122336C>TClinGen:CA195435C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1058G>A (p.Arg353Lys)201163FLCNUncertain significancers2047006294RCV001317472; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712233717122337CT17122337-
NM_144997.7(FLCN):c.1055_1057del (p.Met352del)201163FLCNUncertain significance-1RCV001908293; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712233817122340CTCAC17122337-
NM_144997.7(FLCN):c.1057A>G (p.Arg353Gly)201163FLCNUncertain significance-1RCV001908566; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712233817122338TC17122338-
NM_144997.7(FLCN):c.1054_1055del (p.Met352fs)201163FLCNPathogenicrs2047006361RCV001071000; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712234017122341CATC17:g.17122340_17122341del-
NM_144997.7(FLCN):c.1053C>T (p.His351=)201163FLCNLikely benign-1RCV002204594; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712234217122342GA17122342-
NM_144997.7(FLCN):c.1051C>T (p.His351Tyr)201163FLCNUncertain significancers2047006425RCV001049665|RCV001776107; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171712234417122344GA17:g.17122344G>A-
NM_144997.7(FLCN):c.1049G>A (p.Arg350Gln)201163FLCNUncertain significancers190786280RCV000121113|RCV000535074|RCV000573718|RCV001562933; NMedGen:CN169374|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202171712234617122346CT17:g.17122346C>TClinGen:CA159798C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1048C>T (p.Arg350Trp)201163FLCNUncertain significancers1261069493RCV000567340|RCV000635560|RCV001548632; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171712234717122347GA17:g.17122347G>AClinGen:CA398532658C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1048C>G (p.Arg350Gly)201163FLCNUncertain significancers1261069493RCV000635562; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712234717122347GC17:g.17122347G>CClinGen:CA398532659C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1047C>T (p.Leu349=)201163FLCNLikely benignrs1460704611RCV000970629|RCV001017071|RCV001800906; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN169374171712234817122348GA17:g.17122348G>A-
NM_144997.7(FLCN):c.1045C>T (p.Leu349Phe)201163FLCNUncertain significance-1RCV002026488; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712235017122350GA17122350-
NM_144997.7(FLCN):c.1036_1043del (p.Phe346fs)201163FLCNPathogenicrs879255670RCV000239723; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712235217122359GGACTTGAAGNC_000017.10:g.17122356_17122363delClinGen:CA10586261C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1043C>A (p.Ser348Tyr)201163FLCNUncertain significance-1RCV001886236; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712235217122352GT17122352-
NM_144997.7(FLCN):c.1042T>A (p.Ser348Thr)201163FLCNUncertain significancers1555608487RCV000635554; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712235317122353AT17:g.17122353A>TClinGen:CA398532671C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1041G>A (p.Lys347=)201163FLCNLikely benign-1RCV001396039; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712235417122354CT17122354-
NM_144997.7(FLCN):c.1040A>G (p.Lys347Arg)201163FLCNUncertain significancers752337482RCV001202674; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712235517122355TC17:g.17122355T>C-
NM_144997.7(FLCN):c.1039A>C (p.Lys347Gln)201163FLCNUncertain significancers2047007233RCV001298432; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712235617122356TG17122356-
NM_144997.7(FLCN):c.1035C>G (p.Val345=)201163FLCNLikely benign-1RCV001902465; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712236017122360GC17122360-
NM_144997.7(FLCN):c.1033G>C (p.Val345Leu)201163FLCNUncertain significance-1RCV001930961; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712236217122362CG17122362-
NM_144997.7(FLCN):c.1030C>T (p.Pro344Ser)201163FLCNConflicting interpretations of pathogenicityrs1597591391RCV000808022|RCV001009754; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171712236517122365GA17:g.17122365G>A-
NM_144997.7(FLCN):c.1029G>A (p.Leu343=)201163FLCNLikely benign-1RCV002102572; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712236617122366CT17122366-
NM_144997.7(FLCN):c.1026G>C (p.Lys342Asn)201163FLCNLikely benign-1RCV002097503; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712236917122369CG17122369-
NM_144997.7(FLCN):c.1024A>G (p.Lys342Glu)201163FLCNUncertain significancers2047008002RCV001052116; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712237117122371TC17:g.17122371T>C-
NM_144997.7(FLCN):c.1022G>A (p.Arg341Gln)201163FLCNConflicting interpretations of pathogenicityrs375352888RCV000475669|RCV001017036|RCV001528486; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202171712237317122373CTNC_000017.10:g.17122373C>TClinGen:CA8416172C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1022G>T (p.Arg341Leu)201163FLCNUncertain significance-1RCV001373731; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712237317122373CA17122373-
NM_144997.7(FLCN):c.1021del (p.Arg341fs)201163FLCNPathogenicrs1060502368RCV000470306|RCV000485342|RCV000492409; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171712237417122374CGCNC_000017.10:g.17122377delClinGen:CA16615368C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1021C>T (p.Arg341Trp)201163FLCNConflicting interpretations of pathogenicityrs770396757RCV000566841|RCV000635539|RCV000829385; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171712237417122374GANC_000017.10:g.17122374G>AClinGen:CA8416173C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1020C>A (p.Pro340=)201163FLCNLikely benign-1RCV001395045; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712237517122375GT17122375-
NM_144997.7(FLCN):c.1017G>T (p.Gln339His)201163FLCNUncertain significancers2047008957RCV001233519; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712237817122378CA17:g.17122378C>A-
NM_144997.7(FLCN):c.1015C>T (p.Gln339Ter)201163FLCNPathogenic-1RCV001956353; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712238017122380GA17122380-
NM_144997.7(FLCN):c.1014del (p.Trp338fs)201163FLCNPathogenicrs1131690830RCV000492227|RCV001390961; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712238117122381GCG17:g.17122381_17122381delClinGen:CA645369709C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.1011C>G (p.Ser337Arg)201163FLCNUncertain significance-1RCV001896659; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712238417122384GC17122384-
NM_144997.7(FLCN):c.1011C>T (p.Ser337=)201163FLCNLikely benign-1RCV002204946; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712238417122384GA17122384-
NM_144997.7(FLCN):c.1010G>A (p.Ser337Asn)201163FLCNUncertain significance-1RCV001980728; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712238517122385CT17122385-
NM_144997.7(FLCN):c.1001G>C (p.Gly334Ala)201163FLCNUncertain significancers2047009922RCV001245818; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712239417122394CG17:g.17122394C>G-
NM_144997.7(FLCN):c.999A>T (p.Ser333=)201163FLCNLikely benign-1RCV002129080; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712239617122396TA17122396-
NM_144997.7(FLCN):c.997_998del (p.Ser333fs)201163FLCNPathogenicrs1555608515RCV000635552; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712239717122398TGAT17:g.17122397_17122398delClinGen:CA658798735C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.997T>C (p.Ser333Pro)201163FLCNUncertain significance-1RCV001904215; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712239817122398AG17122398-
NM_144997.7(FLCN):c.996C>G (p.Leu332=)201163FLCNLikely benignrs980011580RCV001019946|RCV001873324; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712239917122399GC17:g.17122399G>C-
NM_144997.7(FLCN):c.995dup (p.Ser333fs)201163FLCNPathogenic-1RCV001384269; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712239917122400GGA17122399-
NM_144997.7(FLCN):c.992C>T (p.Ser331Phe)201163FLCNConflicting interpretations of pathogenicityrs202215080RCV001019912|RCV001800930|RCV001346447; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712240317122403GA17:g.17122403G>A-
NM_144997.7(FLCN):c.987CTC[1] (p.Ser331del)201163FLCNUncertain significance-1RCV002046575; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712240317122405AGAGA17122402-
NM_144997.7(FLCN):c.991T>C (p.Ser331Pro)201163FLCNUncertain significance-1RCV001364331; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712240417122404AG17122404-
NM_144997.7(FLCN):c.990C>T (p.Ser330=)201163FLCNLikely benignrs761984486RCV000635573; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712240517122405GA17:g.17122405G>AClinGen:CA8416178C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.989C>T (p.Ser330Phe)201163FLCNUncertain significance-1RCV001872895; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712240617122406GA17122406-
NM_144997.7(FLCN):c.987del (p.Ser330fs)201163FLCNPathogenicrs878855221RCV000226049; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712240817122408AGANC_000017.10:g.17122409delClinGen:CA10583453C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.986C>T (p.Ser329Phe)201163FLCNUncertain significancers770027312RCV001036462; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712240917122409GA17:g.17122409G>A-
NM_144997.7(FLCN):c.986C>A (p.Ser329Tyr)201163FLCNUncertain significance-1RCV002004871; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712240917122409GT17122409-
NM_144997.7(FLCN):c.984G>A (p.Glu328=)201163FLCNLikely benign-1RCV002124310; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712241117122411CT17122411-
NM_144997.7(FLCN):c.982G>C (p.Glu328Gln)201163FLCNUncertain significance-1RCV001988970; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712241317122413CG17122413-
NM_144997.7(FLCN):c.981A>G (p.Ala327=)201163FLCNLikely benignrs763078516RCV000872686|RCV001439408; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712241417122414TC17:g.17122414T>C-
NM_144997.7(FLCN):c.979dup (p.Ala327fs)201163FLCNPathogenicrs1555608552RCV000550577; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712241517122416GGC17:g.17122415_17122416insCClinGen:CA658658537C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.980C>G (p.Ala327Gly)201163FLCNUncertain significance-1RCV002006033; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712241517122415GC17122415-
NM_144997.7(FLCN):c.979G>A (p.Ala327Thr)201163FLCNUncertain significancers2047011004RCV001321380; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712241617122416CT17122416-
NM_144997.7(FLCN):c.978G>A (p.Pro326=)201163FLCNLikely benignrs920594920RCV000567874|RCV000935514; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712241717122417CT17:g.17122417C>TClinGen:CA288311641C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.977C>T (p.Pro326Leu)201163FLCNConflicting interpretations of pathogenicityrs138031155RCV000264762|RCV000319945|RCV000567800|RCV000589923; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202171712241817122418GA17:g.17122418G>AClinGen:CA8416182C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.977C>G (p.Pro326Arg)201163FLCNUncertain significancers138031155RCV001053232; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712241817122418GC17:g.17122418G>C-
NM_144997.7(FLCN):c.976C>T (p.Pro326Ser)201163FLCNUncertain significancers751478971RCV000474054; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712241917122419GANC_000017.10:g.17122419G>AClinGen:CA8416183C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.974G>T (p.Gly325Val)201163FLCNUncertain significancers1278019825RCV001306966; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712242117122421CA17122421-
NM_144997.7(FLCN):c.971A>G (p.Gln324Arg)201163FLCNUncertain significancers767368450RCV000815118|RCV001019676; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171712242417122424TC17:g.17122424T>C-
NM_144997.7(FLCN):c.970C>T (p.Gln324Ter)201163FLCNPathogenic-1RCV001897169; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712242517122425GA17122425-
NM_144997.7(FLCN):c.969C>T (p.Thr323=)201163FLCNLikely benign-1RCV001444556; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712242617122426GA17122426-
NM_144997.7(FLCN):c.966G>A (p.Leu322=)201163FLCNLikely benign-1RCV001429481; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712242917122429CT17122429-
NM_144997.7(FLCN):c.964C>T (p.Leu322=)201163FLCNLikely benignrs1597591744RCV000938102; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712243117122431GA17:g.17122431G>A-
NM_144997.7(FLCN):c.961G>A (p.Glu321Lys)201163FLCNUncertain significancers2047011877RCV001061419; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712243417122434CT17:g.17122434C>T-
NM_144997.7(FLCN):c.959G>A (p.Arg320Gln)201163FLCNBenign/Likely benignrs143483053RCV000034797|RCV000121114|RCV000163434|RCV000226709|RCV000374324; NMedGen:CN517202|MedGen:CN169374|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903171712243617122436CT17:g.17122436C>TClinGen:CA159801,UniProtKB:Q8NFG4#VAR_025358C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.958C>T (p.Arg320Trp)201163FLCNUncertain significancers777456756RCV000800171; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712243717122437GA17:g.17122437G>A-
NM_144997.7(FLCN):c.927_954dup (p.Gly319fs)201163FLCNPathogenicrs398124542RCV000082645|RCV000239656|RCV000492117|RCV000781384; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903171712244017122441CCTTCTGTACTCTCTGGCAACACAGGGGCT17:g.17122440_17122441insTTCTGTACTCTCTGGCAACACAGGGGCTClinGen:CA224181,OMIM:607273.0004C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.955G>C (p.Gly319Arg)201163FLCNUncertain significancers753491072RCV000562286|RCV000687129; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712244017122440CG17:g.17122440C>GClinGen:CA8416188C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.955G>A (p.Gly319Arg)201163FLCNUncertain significancers753491072RCV001296639; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712244017122440CT17122440-
NM_144997.7(FLCN):c.952G>A (p.Glu318Lys)201163FLCNUncertain significancers756787389RCV000635565|RCV001019466; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171712244317122443CTNC_000017.10:g.17122443C>TClinGen:CA8416189C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.951A>C (p.Thr317=)201163FLCNLikely benignrs1060504594RCV000472635; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712244417122444TGNC_000017.10:g.17122444T>GClinGen:CA16615372C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.949A>T (p.Thr317Ser)201163FLCNUncertain significancers147142086RCV000809788; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712244617122446TA17:g.17122446T>A-
NM_144997.7(FLCN):c.946_947del (p.Ser316fs)201163FLCNPathogenicrs1597591875RCV000820246; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712244817122449ACTA17:g.17122448_17122449del-
NM_144997.7(FLCN):c.941C>A (p.Pro314Gln)201163FLCNUncertain significance-1RCV002049570; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712245417122454GT17122454-
NM_144997.7(FLCN):c.939G>T (p.Leu313Phe)201163FLCNUncertain significancers558365108RCV000635558; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712245617122456CA17:g.17122456C>AClinGen:CA398532961C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.939G>A (p.Leu313=)201163FLCNLikely benignrs558365108RCV000635580; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712245617122456CTNC_000017.10:g.17122456C>TClinGen:CA288311745C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.937T>C (p.Leu313=)201163FLCNLikely benignrs1432138522RCV000944242|RCV001476503; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712245817122458AG17:g.17122458A>G-
NM_144997.7(FLCN):c.937T>G (p.Leu313Val)201163FLCNUncertain significancers1432138522RCV001063666; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712245817122458AC17:g.17122458A>C-
NM_144997.7(FLCN):c.934G>C (p.Val312Leu)201163FLCNUncertain significance-1RCV001890669; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712246117122461CG17122461-
NM_144997.7(FLCN):c.932_933del (p.Pro311fs)201163FLCNPathogenicrs1555608614RCV000258912|RCV000497517; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171712246217122463CAGC17:g.17122462_17122463delClinGen:CA16043355C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.932C>T (p.Pro311Leu)201163FLCNUncertain significancers916844425RCV000703004|RCV001539928; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171712246317122463GA17:g.17122463G>A-C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.932C>G (p.Pro311Arg)201163FLCNUncertain significancers916844425RCV001232402; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712246317122463GC17:g.17122463G>C-
NM_144997.7(FLCN):c.931C>T (p.Pro311Ser)201163FLCNConflicting interpretations of pathogenicityrs140246224RCV000535547|RCV000564648|RCV001584259; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202171712246417122464GA17:g.17122464G>AClinGen:CA8416193C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.930C>T (p.Ala310=)201163FLCNLikely benign-1RCV001475648; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712246517122465GA17122465-
NM_144997.7(FLCN):c.927dup (p.Ala310fs)201163FLCNPathogenicrs879255669RCV000239698|RCV000266138; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171712246717122468CCTNC_000017.10:g.17122470dupClinGen:CA10586262
NM_144997.7(FLCN):c.928G>A (p.Ala310Thr)201163FLCNUncertain significancers748491270RCV000810434; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712246717122467CT17:g.17122467C>T-
NM_144997.7(FLCN):c.925A>G (p.Lys309Glu)201163FLCNUncertain significancers2047014102RCV001237794; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712247017122470TC17:g.17122470T>C-
NM_144997.7(FLCN):c.916GAG[2] (p.Glu308del)201163FLCNUncertain significancers1597592053RCV000796803; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712247117122473TCTCT17:g.17122471_17122473del-
NM_144997.7(FLCN):c.921G>A (p.Glu307=)201163FLCNLikely benign-1RCV001457242; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712247417122474CT17122474-
NM_144997.7(FLCN):c.920A>T (p.Glu307Val)201163FLCNUncertain significancers2047014288RCV001237793; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712247517122475TA17:g.17122475T>A-
NM_144997.7(FLCN):c.919G>A (p.Glu307Lys)201163FLCNUncertain significancers932256543RCV001058413; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712247617122476CT17:g.17122476C>T-
NM_144997.7(FLCN):c.919del (p.Glu307fs)201163FLCNPathogenic-1RCV001922269; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712247617122476TCT17122475-
NM_144997.7(FLCN):c.918G>A (p.Glu306=)201163FLCNLikely benign-1RCV002189410; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712247717122477CT17122477-
NM_144997.7(FLCN):c.915A>G (p.Glu305=)201163FLCNLikely benignrs551034228RCV000565906|RCV000871544; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712248017122480TCNC_000017.10:g.17122480T>CClinGen:CA8416195C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.913del (p.Glu305fs)201163FLCNPathogenicrs2047014823RCV001204020; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712248217122482TCT17:g.17122482_17122482del-
NM_144997.7(FLCN):c.913G>A (p.Glu305Lys)201163FLCNUncertain significance-1RCV002003063; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712248217122482CT17122482-
NM_144997.7(FLCN):c.911C>T (p.Ala304Val)201163FLCNUncertain significancers2047014907RCV001215263; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712248417122484GA17:g.17122484G>A-
NM_144997.7(FLCN):c.908A>G (p.Glu303Gly)201163FLCNUncertain significancers773482946RCV000635536; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712248717122487TC17:g.17122487T>CClinGen:CA8416196C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.905C>G (p.Ser302Cys)201163FLCNUncertain significancers1555608636RCV000635550; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712249017122490GC17:g.17122490G>CClinGen:CA398533036C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.903C>T (p.Asn301=)201163FLCNLikely benignrs1597592156RCV000919383; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712249217122492GA17:g.17122492G>A-
NM_144997.7(FLCN):c.890_893del (p.Glu297fs)201163FLCNPathogenicrs398124541RCV000082644|RCV000239720|RCV000492401; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171712250217122505GCTTTG17:g.17122502_17122505delClinGen:CA224180C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.889_890del (p.Glu297fs)201163FLCNPathogenicrs1597592246RCV000797126|RCV001269731; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171712250517122506TTCT17:g.17122505_17122506del-
NM_144997.7(FLCN):c.888A>G (p.Ser296=)201163FLCNLikely benign-1RCV001428026; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712250717122507TC17122507-
NM_144997.7(FLCN):c.887C>G (p.Ser296Ter)201163FLCNPathogenicrs1490424623RCV000692102; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712250817122508GC17:g.17122508G>C-C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.886T>A (p.Ser296Thr)201163FLCNUncertain significance-1RCV001973242; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712250917122509AT17122509-
NM_144997.7(FLCN):c.882G>A (p.Glu294=)201163FLCNLikely benignrs1555608661RCV000557217; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712251317122513CT17:g.17122513C>TClinGen:CA498163612C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.880G>A (p.Glu294Lys)201163FLCNUncertain significancers2047015977RCV001219790; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712251517122515CT17:g.17122515C>T-
NM_144997.7(FLCN):c.875T>G (p.Leu292Ter)201163FLCNPathogenicrs879255668RCV000492726|RCV000255684|RCV000239679; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712252017122520ACNC_000017.10:g.17122520A>CClinGen:CA10586263
NM_144997.7(FLCN):c.873_875del (p.Asp291_Leu292delinsGlu)201163FLCNUncertain significance-1RCV001367000; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712252017122522TAAAT17122519-
NM_144997.7(FLCN):c.874T>C (p.Leu292=)201163FLCNLikely benignrs759503601RCV000468061|RCV000574038; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171712252117122521AGNC_000017.10:g.17122521A>GClinGen:CA8416201C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.873T>G (p.Asp291Glu)201163FLCNUncertain significancers767527483RCV001018264|RCV001342685; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712252217122522AC17:g.17122522A>C-
NM_144997.7(FLCN):c.873T>C (p.Asp291=)201163FLCNLikely benign-1RCV001406520; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712252217122522AG17122522-
NM_144997.7(FLCN):c.872-1G>T201163FLCNLikely pathogenicrs1567813248RCV000761144|RCV001855937; NHuman Phenotype Ontology:HP:0033680,MONDO:MONDO:0016691,MedGen:C0334583, Orphanet:251612|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712252417122524CANC_000017.10:g.17122524C>A-
NM_144997.7(FLCN):c.872-3C>T201163FLCNUncertain significancers1555608676RCV000558016|RCV001018236; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171712252617122526GA17:g.17122526G>AClinGen:CA658658538C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.872-4G>A201163FLCNLikely benignrs752727873RCV000536612|RCV001018238; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171712252717122527CT17:g.17122527C>TClinGen:CA8416203C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.872-11_872-10del201163FLCNLikely benignrs1555608679RCV000543327; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712253317122534CAGCNC_000017.10:g.17122534_17122535delClinGen:CA658658539C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.872-11C>T201163FLCNLikely benign-1RCV002217479; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712253417122534GA17122534-
NM_144997.7(FLCN):c.872-13A>G201163FLCNBenignrs114970273RCV000253343|RCV000316382|RCV000389518|RCV000588320; NMedGen:CN169374|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171712253617122536TC17:g.17122536T>CClinGen:CA8416205C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.871+47G>A201163FLCNConflicting interpretations of pathogenicityrs142934950RCV000034796|RCV000121108|RCV000989759|RCV001762108; NMedGen:CN517202|MedGen:CN169374|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0005575,MedGen:C0346629,OMIM:114500171712480417124804CT17:g.17124804C>TClinGen:CA159785C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.871+36G>A201163FLCNBenignrs3744124RCV000034795|RCV000121107|RCV001514333; NMedGen:CN517202|MedGen:CN169374|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712481517124815CT17:g.17124815C>TClinGen:CA159783CN517202 not provided;
NM_144997.7(FLCN):c.871+20G>C201163FLCNLikely benign-1RCV002113581; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712483117124831CG17124831-
NM_144997.7(FLCN):c.871+20G>T201163FLCNLikely benign-1RCV002167127; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712483117124831CA17124831-
NM_144997.7(FLCN):c.871+16T>A201163FLCNBenign/Likely benignrs116643153RCV000034794|RCV000121109|RCV002054554; NMedGen:CN517202|MedGen:CN169374|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712483517124835AT17:g.17124835A>TClinGen:CA159787CN517202 not provided;
NM_144997.7(FLCN):c.871+13T>C201163FLCNLikely benign-1RCV002142399; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712483817124838AG17124838-
NM_144997.7(FLCN):c.871+12G>A201163FLCNLikely benign-1RCV002182096; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712483917124839CT17124839-
NC_000017.11:g.(?_17221527)_(17224153_?)del201163FLCNPathogenic-1RCV001031127; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712484117127467nana-1-
NC_000017.10:g.(?_17124841)_(17125985_?)del201163FLCNPathogenic-1RCV001388943; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712484117125985nana-1-
NM_144997.7(FLCN):c.871+8A>G201163FLCNLikely benign-1RCV002157040; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712484317124843TC17124843-
NM_144997.7(FLCN):c.871+8del201163FLCNLikely benign-1RCV002215065; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712484317124843CTC17124842-
NC_000017.11:g.(?_17221531)_(17228143_?)del201163FLCNPathogenic-1RCV000635600; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712484517131457nana-C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.871+6G>A201163FLCNUncertain significance-1RCV001948823; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712484517124845CT17124845-
NM_144997.7(FLCN):c.871+2_871+3insTCCA201163FLCNUncertain significance-1RCV001368181; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712484817124849CCTGGA17124848-
NM_144997.7(FLCN):c.868G>T (p.Ala290Ser)201163FLCNUncertain significancers767119281RCV001059031; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712485417124854CA17:g.17124854C>A-
NM_144997.7(FLCN):c.868G>A (p.Ala290Thr)201163FLCNUncertain significancers767119281RCV001228792; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712485417124854CT17:g.17124854C>T-
NM_144997.7(FLCN):c.867C>T (p.Leu289=)201163FLCNLikely benignrs367562964RCV000532846|RCV001018172|RCV001563418; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202171712485517124855GA17:g.17124855G>AClinGen:CA8416270C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.867C>G (p.Leu289=)201163FLCNLikely benignrs367562964RCV001018171|RCV001453795; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712485517124855GC17:g.17124855G>C-
NM_144997.7(FLCN):c.857T>C (p.Met286Thr)201163FLCNUncertain significance-1RCV001896236; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712486517124865AG17124865-
NM_144997.7(FLCN):c.853C>T (p.Gln285Ter)201163FLCNPathogenicrs879255667RCV000239633|RCV001582803; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171712486917124869GA17:g.17124869G>AClinGen:CA10586264C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.852C>T (p.Val284=)201163FLCNLikely benign-1RCV001411534; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712487017124870GA17124870-
NM_144997.7(FLCN):c.851del (p.Val284fs)201163FLCNPathogenicrs879255666RCV000239718; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712487117124871GAG17:g.17124871_17124871delClinGen:CA10586265C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.845C>T (p.Thr282Ile)201163FLCNUncertain significancers758884167RCV001017842|RCV001042568; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712487717124877GA17:g.17124877G>A-
NM_144997.7(FLCN):c.844A>T (p.Thr282Ser)201163FLCNUncertain significancers876658621RCV000217998|RCV000635551; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712487817124878TA17:g.17124878T>AClinGen:CA10580170C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.826_842del (p.Gly276fs)201163FLCNPathogenic-1RCV001380875; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712488017124896ATCCTCGGTCGGAGCACCA17124879-
NM_144997.7(FLCN):c.841G>A (p.Asp281Asn)201163FLCNUncertain significancers2047090106RCV001301298; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712488117124881CT17124881-
NM_144997.7(FLCN):c.841G>C (p.Asp281His)201163FLCNUncertain significance-1RCV001950080; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712488117124881CG17124881-
NM_144997.7(FLCN):c.840G>A (p.Glu280=)201163FLCNLikely benignrs1597599136RCV000969073; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712488217124882CT17:g.17124882C>T-
NM_144997.7(FLCN):c.838G>A (p.Glu280Lys)201163FLCNUncertain significancers1060502367RCV000463825; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712488417124884CTNC_000017.10:g.17124884C>TClinGen:CA16615520C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.837C>G (p.Thr279=)201163FLCNLikely benignrs751877389RCV000574115|RCV000944071|RCV001425264; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712488517124885GCNC_000017.10:g.17124885G>CClinGen:CA498163742C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.837C>T (p.Thr279=)201163FLCNLikely benign-1RCV001431323; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712488517124885GA17124885-
NM_144997.7(FLCN):c.835A>G (p.Thr279Ala)201163FLCNUncertain significancers2047090568RCV001343626; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712488717124887TC17124887-
NM_144997.7(FLCN):c.834G>A (p.Pro278=)201163FLCNLikely benignrs146801028RCV000554520|RCV000563236; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171712488817124888CT17:g.17124888C>TClinGen:CA8416279C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.834G>T (p.Pro278=)201163FLCNLikely benign-1RCV001492254; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712488817124888CA17124888-
NM_144997.7(FLCN):c.833C>T (p.Pro278Leu)201163FLCNUncertain significancers748031634RCV000210885; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712488917124889GA17:g.17124889G>AClinGen:CA358318C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.833C>G (p.Pro278Arg)201163FLCNUncertain significancers748031634RCV000544099; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712488917124889GC17:g.17124889G>CClinGen:CA398533693C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.832C>G (p.Pro278Ala)201163FLCNUncertain significancers1597599209RCV001017558|RCV001369370; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712489017124890GC17:g.17124890G>C-
NM_144997.7(FLCN):c.832C>T (p.Pro278Ser)201163FLCNUncertain significancers1597599209RCV001063698; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712489017124890GA17:g.17124890G>A-
NM_144997.7(FLCN):c.828_829dup (p.Ala277fs)201163FLCNPathogenicrs398124539RCV000082642|RCV001854441; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712489217124893GGCA17:g.17124892_17124893insCAClinGen:CA224178CN517202 not provided;
NM_144997.7(FLCN):c.829G>C (p.Ala277Pro)201163FLCNUncertain significance-1RCV001917290; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712489317124893CG17124893-
NM_144997.7(FLCN):c.829G>A (p.Ala277Thr)201163FLCNUncertain significance-1RCV001912857; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712489317124893CT17124893-
NM_144997.7(FLCN):c.828delinsAGA (p.Ala277fs)201163FLCNPathogenicrs878855220RCV000231805; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712489417124894ATCT17:g.17124894_17124895insCTClinGen:CA10583454C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.827_828insAG (p.Ala277fs)201163FLCNPathogenic-1RCV001384024; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712489417124895AACT17124894-
NM_144997.7(FLCN):c.825A>G (p.Glu275=)201163FLCNLikely benign-1RCV002177071; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712489717124897TC17124897-
NM_144997.7(FLCN):c.822G>A (p.Leu274=)201163FLCNLikely benignrs777731843RCV000923644|RCV001497583; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712490017124900CT17:g.17124900C>T-
NM_144997.7(FLCN):c.819C>T (p.Leu273=)201163FLCNLikely benign-1RCV001477605; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712490317124903GA17124903-
NM_144997.7(FLCN):c.811G>A (p.Glu271Lys)201163FLCNUncertain significancers2047091792RCV001217150; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712491117124911CT17:g.17124911C>T-
NM_144997.7(FLCN):c.811G>C (p.Glu271Gln)201163FLCNUncertain significance-1RCV001927237; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712491117124911CG17124911-
NM_144997.7(FLCN):c.810C>A (p.Thr270=)201163FLCNLikely benignrs372342796RCV000220617|RCV000635581; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712491217124912GT17:g.17124912G>TClinGen:CA8416283C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.810C>T (p.Thr270=)201163FLCNLikely benignrs372342796RCV000529335|RCV001027184; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171712491217124912GA17:g.17124912G>AClinGen:CA8416284C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.810C>G (p.Thr270=)201163FLCNLikely benignrs372342796RCV000635587; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712491217124912GC17:g.17124912G>CClinGen:CA8416285C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.810del (p.Glu271fs)201163FLCNPathogenic-1RCV001907594; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712491217124912CGC17124911-
NM_144997.7(FLCN):c.808dup (p.Thr270fs)201163FLCNPathogenicrs2047092163RCV001036238; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712491317124914GGT17:g.17124913_17124914insT-
NM_144997.7(FLCN):c.809C>G (p.Thr270Ser)201163FLCNUncertain significance-1RCV001959612; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712491317124913GC17124913-
NM_144997.7(FLCN):c.807G>A (p.Leu269=)201163FLCNLikely benign-1RCV002133940; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712491517124915CT17124915-
NM_144997.7(FLCN):c.804G>T (p.Arg268=)201163FLCNLikely benignrs771424902RCV000166410|RCV000458952; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712491817124918CA17:g.17124918C>AClinGen:CA195802C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.804del (p.Arg268_Leu269insTer)201163FLCNPathogenicrs1567816285RCV000697842; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712491817124918GCG17:g.17124918_17124918del-C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.803G>A (p.Arg268Gln)201163FLCNUncertain significance-1RCV002013566; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712491917124919CT17124919-
NM_144997.7(FLCN):c.802C>T (p.Arg268Trp)201163FLCNUncertain significancers762370059RCV000819183|RCV001027085|RCV001824384; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202171712492017124920GA17:g.17124920G>A-
NM_144997.7(FLCN):c.798C>T (p.Gly266=)201163FLCNUncertain significancers2047092959RCV001122058|RCV001122059; NMONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712492417124924GA17:g.17124924G>A-
NM_144997.7(FLCN):c.792G>A (p.Ala264=)201163FLCNLikely benignrs140500421RCV000460100|RCV001026964; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171712493017124930CTNC_000017.10:g.17124930C>TClinGen:CA8416290C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.792G>T (p.Ala264=)201163FLCNLikely benignrs140500421RCV000635583|RCV001026965; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171712493017124930CANC_000017.10:g.17124930C>AClinGen:CA498163769C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.792del (p.Cys265fs)201163FLCNPathogenic/Likely pathogenicrs1567816339RCV000761277|RCV001855939; N|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712493017124930ACANC_000017.10:g.17124930del-
NM_144997.7(FLCN):c.791C>T (p.Ala264Val)201163FLCNUncertain significancers372304384RCV000293686|RCV000348649|RCV001556414; NMONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171712493117124931GA17:g.17124931G>AClinGen:CA8416291C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.789G>A (p.Lys263=)201163FLCNLikely benignrs1483962771RCV000555299; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712493317124933CT17:g.17124933C>TClinGen:CA498163771C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.783C>G (p.Leu261=)201163FLCNLikely benign-1RCV002218543; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712493917124939GC17124939-
NM_144997.7(FLCN):c.780G>A (p.Trp260Ter)201163FLCNPathogenicrs1131690826RCV000492729|RCV001856948; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712494217124942CTNC_000017.10:g.17124942C>TClinGen:CA398533803C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.780-1G>C201163FLCNLikely pathogenicrs878855218RCV000233680; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712494317124943CG17:g.17124943C>GClinGen:CA10583455C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.780-1G>T201163FLCNPathogenic/Likely pathogenicrs878855218RCV000475965|RCV000487245; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171712494317124943CANC_000017.10:g.17124943C>AClinGen:CA16615114C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.780-2A>G201163FLCNPathogenicrs1555609514RCV000519471|RCV001386655; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712494417124944TCNC_000017.10:g.17124944T>CClinGen:CA398533806
NM_144997.7(FLCN):c.780-3C>A201163FLCNUncertain significancers755253791RCV001241773; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712494517124945GT17:g.17124945G>T-
NM_144997.7(FLCN):c.780-5T>A201163FLCNUncertain significance-1RCV001891660; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712494717124947AT17124947-
NM_144997.7(FLCN):c.780-6C>T201163FLCNLikely benignrs752746072RCV000635593; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712494817124948GA17:g.17124948G>AClinGen:CA8416295C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.780-13C>T201163FLCNLikely benign-1RCV002087815; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712495517124955GA17124955-
NM_144997.7(FLCN):c.780-14G>A201163FLCNLikely benign-1RCV002194855; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712495617124956CT17124956-
NM_144997.7(FLCN):c.780-14G>C201163FLCNLikely benign-1RCV002192097; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712495617124956CG17124956-
NM_144997.7(FLCN):c.780-15T>A201163FLCNLikely benign-1RCV002118765; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712495717124957AT17124957-
NM_144997.7(FLCN):c.780-16G>T201163FLCNLikely benign-1RCV002075038; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712495817124958CA17124958-
NM_144997.7(FLCN):c.780-20G>T201163FLCNLikely benign-1RCV002209964; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712496217124962CA17124962-
NM_144997.7(FLCN):c.779+20T>C201163FLCNLikely benign-1RCV002184719; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712579517125795AG17125795-
NM_144997.7(FLCN):c.779+19T>G201163FLCNLikely benign-1RCV002156443; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712579617125796AC17125796-
NM_144997.7(FLCN):c.779+10G>A201163FLCNLikely benignrs376357696RCV000250401|RCV000462936; NMedGen:CN169374|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712580517125805CT17:g.17125805C>TClinGen:CA8416317C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.779+10G>T201163FLCNLikely benign-1RCV001470223; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712580517125805CA17125805-
NC_000017.10:g.(?_17125805)_(17125985_?)del201163FLCNPathogenic-1RCV001951530; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712580517125985nana-1-
NM_144997.7(FLCN):c.779+9C>T201163FLCNBenignrs373504780RCV000476671; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712580617125806GANC_000017.10:g.17125806G>AClinGen:CA8416318C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.779+8G>T201163FLCNLikely benignrs1260972155RCV000875911|RCV001407740; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712580717125807CA17:g.17125807C>A-
NM_144997.7(FLCN):c.779+8G>A201163FLCNLikely benign-1RCV001427076; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712580717125807CT17125807-
NM_144997.7(FLCN):c.779+8del201163FLCNLikely benign-1RCV002169442; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712580717125807GCG17125806-
NM_144997.7(FLCN):c.779+8G>C201163FLCNLikely benign-1RCV002183796; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712580717125807CG17125807-
NM_144997.7(FLCN):c.779+6G>A201163FLCNUncertain significancers778530618RCV000989760; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712580917125809CT17:g.17125809C>T-
NM_144997.7(FLCN):c.779+5C>T201163FLCNUncertain significancers745645385RCV000561400|RCV000635571; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712581017125810GA17:g.17125810G>AClinGen:CA8416320C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.779+1G>T201163FLCNPathogenic/Likely pathogenicrs758175953RCV000218992|RCV000239675|RCV000255322|RCV000506237|RCV000762981; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202|MedGen:CN169374|MONDO:MONDO:0007763,MedGen:CN074294,OMIM:144700, Orphanet:422526; MONDO:MONDO:0008259,MedGen:C186171712581417125814CA17:g.17125814C>AClinGen:CA8416321C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.779G>A (p.Trp260Ter)201163FLCNPathogenicrs368778627RCV000148502|RCV000635567; NMONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712581517125815CT17:g.17125815C>TClinGen:CA211427C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.777C>G (p.Ala259=)201163FLCNLikely benign-1RCV001392486; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712581717125817GC17125817-
NM_144997.7(FLCN):c.776C>T (p.Ala259Val)201163FLCNUncertain significance-1RCV001957881; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712581817125818GA17125818-
NM_144997.7(FLCN):c.774del (p.Phe258fs)201163FLCNPathogenic-1RCV001963303; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712582017125820CAC17125819-
NM_144997.7(FLCN):c.766A>T (p.Thr256Ser)201163FLCNUncertain significancers876658799RCV000222438|RCV000808271; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712582817125828TANC_000017.10:g.17125828T>AClinGen:CA10580171C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.764A>C (p.His255Pro)201163FLCNConflicting interpretations of pathogenicityrs879255665RCV000239631|RCV001269562; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171712583017125830TG17:g.17125830T>GClinGen:CA10586266C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.763C>T (p.His255Tyr)201163FLCNConflicting interpretations of pathogenicityrs879255664RCV000489495|RCV000239703; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712583117125831GA17:g.17125831G>AClinGen:CA10586267C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.762G>A (p.Leu254=)201163FLCNLikely benignrs1597601840RCV000945161; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712583217125832CT17:g.17125832C>T-
NM_144997.7(FLCN):c.739_761delinsCAGCGAG (p.Asp247fs)201163FLCNPathogenicrs2047123162RCV001048781; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712583317125855AGGCACGCCCACAGGTTGTCATCCTCGCTG17:g.17125834_17125855del-
NM_144997.7(FLCN):c.759C>G (p.Cys253Trp)201163FLCNUncertain significancers2047123235RCV001246877; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712583517125835GC17:g.17125835G>C-
NM_144997.7(FLCN):c.756G>A (p.Ala252=)201163FLCNLikely benignrs746664975RCV000876453|RCV001026577; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171712583817125838CT17:g.17125838C>T-
NM_144997.7(FLCN):c.756G>T (p.Ala252=)201163FLCNLikely benign-1RCV002176944; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712583817125838CA17125838-
NM_144997.7(FLCN):c.755C>T (p.Ala252Val)201163FLCNUncertain significancers2047123533RCV001237937; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712583917125839GA17:g.17125839G>A-
NM_144997.7(FLCN):c.755del (p.Ala252fs)201163FLCNPathogenic-1RCV002000020; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712583917125839CGC17125838-
NM_144997.7(FLCN):c.752G>A (p.Trp251Ter)201163FLCNPathogenicrs879255663RCV000239672; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712584217125842CT17:g.17125842C>TClinGen:CA10586268C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.749T>C (p.Leu250Pro)201163FLCNUncertain significancers1555609772RCV000525579; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712584517125845AG17:g.17125845A>GClinGen:CA398533877C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.749T>A (p.Leu250Gln)201163FLCNUncertain significance-1RCV001872302; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712584517125845AT17125845-
NM_144997.7(FLCN):c.748C>A (p.Leu250Met)201163FLCNUncertain significancers898441209RCV000462755|RCV000492271; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171712584617125846GTNC_000017.10:g.17125846G>TClinGen:CA16615122C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.740A>G (p.Asp247Gly)201163FLCNUncertain significancers2047124055RCV001206003; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712585417125854TC17:g.17125854T>C-
NM_144997.7(FLCN):c.735_738del (p.Ser246fs)201163FLCNPathogenicrs879255662RCV000239628; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712585617125859CACTTC17:g.17125856_17125859delClinGen:CA10586269C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.738T>G (p.Ser246Arg)201163FLCNUncertain significancers1597601940RCV001026367|RCV001308080; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712585617125856AC17:g.17125856A>C-
NM_144997.7(FLCN):c.738T>C (p.Ser246=)201163FLCNLikely benign-1RCV001451489; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712585617125856AG17125856-
NM_144997.7(FLCN):c.737G>A (p.Ser246Asn)201163FLCNUncertain significancers1555609798RCV000556357; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712585717125857CT17:g.17125857C>TClinGen:CA398533907C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.718TCGCTGACA[3] (p.241LTS[3])201163FLCNUncertain significancers1209487287RCV000692111; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712585817125859TTTGTCAGCGA17:g.17125858_17125859insTGTCAGCGA-C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.735A>C (p.Thr245=)201163FLCNBenign/Likely benignrs150175875RCV000229035|RCV000492518; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171712585917125859TG17:g.17125859T>GClinGen:CA8416326C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.735A>G (p.Thr245=)201163FLCNLikely benignrs150175875RCV000541375|RCV001026317; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171712585917125859TCNC_000017.10:g.17125859T>CClinGen:CA8416325C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.718TCGCTGACA[1] (p.241LTS[1])201163FLCNUncertain significancers1209487287RCV000635541; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712585917125867TTGTCAGCGATNC_000017.10:g.17125859TGTCAGCGA[1]ClinGen:CA625314083C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.734C>A (p.Thr245Lys)201163FLCNUncertain significancers371401039RCV001026310|RCV001247341|RCV001759715; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171712586017125860GT17:g.17125860G>T-
NM_144997.7(FLCN):c.733A>G (p.Thr245Ala)201163FLCNUncertain significancers1555609813RCV000526590; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712586117125861TC17:g.17125861T>CClinGen:CA398533914C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.730C>T (p.Leu244=)201163FLCNLikely benign-1RCV002217952; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712586417125864GA17125864-
NM_144997.7(FLCN):c.729G>A (p.Ser243=)201163FLCNLikely benignrs377261933RCV000576058|RCV000635592|RCV001722534; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171712586517125865CTNC_000017.10:g.17125865C>TClinGen:CA8416330C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.728C>T (p.Ser243Leu)201163FLCNUncertain significancers1026067642RCV000635544|RCV001823153; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171712586617125866GA17:g.17125866G>AClinGen:CA288315500C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.726A>T (p.Thr242=)201163FLCNBenignrs113938514RCV000082641|RCV000129668|RCV000290141|RCV000384438|RCV000586027; NMedGen:CN169374|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171712586817125868TA17:g.17125868T>AClinGen:CA149551C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.724A>T (p.Thr242Ser)201163FLCNUncertain significancers2047125204RCV001308764; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712587017125870TA17125870-
NM_144997.7(FLCN):c.723G>A (p.Leu241=)201163FLCNLikely benign-1RCV002094697; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712587117125871CT17125871-
NM_144997.7(FLCN):c.720G>A (p.Ser240=)201163FLCNLikely benignrs186366202RCV000573098|RCV000842492|RCV001084076; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712587417125874CTNC_000017.10:g.17125874C>TClinGen:CA8416332C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.719C>T (p.Ser240Leu)201163FLCNUncertain significancers2047125657RCV001040050; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712587517125875GA17:g.17125875G>A-
NM_144997.7(FLCN):c.716G>A (p.Arg239His)201163FLCNUncertain significancers753948488RCV000239701|RCV000561577|RCV001527887; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202171712587817125878CT17:g.17125878C>TClinGen:CA8416333C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.715C>T (p.Arg239Cys)201163FLCNConflicting interpretations of pathogenicityrs78683075RCV000121104|RCV000148504|RCV000163388|RCV000656850|RCV001762262; NMedGen:CN169374|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MONDO:MONDO:0005575,MedGen:C0346629,OMIM:114500171712587917125879GA17:g.17125879G>AClinGen:CA159776,UniProtKB:Q8NFG4#VAR_066026C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.712G>C (p.Ala238Pro)201163FLCNUncertain significance-1RCV001962745; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712588217125882CG17125882-
NM_144997.7(FLCN):c.711C>T (p.Ala237=)201163FLCNLikely benignrs111258744RCV000167445|RCV000868094; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712588317125883GA17:g.17125883G>AClinGen:CA198322C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.711C>G (p.Ala237=)201163FLCNLikely benign-1RCV002129524; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712588317125883GC17125883-
NM_144997.7(FLCN):c.709G>A (p.Ala237Thr)201163FLCNUncertain significancers1257705335RCV000816714; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712588517125885CT17:g.17125885C>T-
NM_144997.7(FLCN):c.708del (p.Asn236fs)201163FLCNPathogenicrs886039369RCV000254784|RCV001389700; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712588617125886CGC17:g.17125886_17125886delClinGen:CA10588641CN517202 not provided;
NM_144997.7(FLCN):c.708C>T (p.Asn236=)201163FLCNConflicting interpretations of pathogenicityrs750394475RCV000548041|RCV000599827|RCV001026020|RCV001124827; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN169374|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903171712588617125886GA17:g.17125886G>AClinGen:CA8416334C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.708C>G (p.Asn236Lys)201163FLCNUncertain significance-1RCV002020487; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712588617125886GC17125886-
NM_144997.7(FLCN):c.707A>G (p.Asn236Ser)201163FLCNUncertain significancers1194767470RCV000570714|RCV000692706; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712588717125887TCNC_000017.10:g.17125887T>CClinGen:CA398533958C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.703G>A (p.Gly235Ser)201163FLCNUncertain significancers200693409RCV001025960|RCV001209824; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712589117125891CT17:g.17125891C>T-
NM_144997.7(FLCN):c.702C>T (p.Asn234=)201163FLCNLikely benignrs1471089893RCV000873478|RCV001025945|RCV001443020; NMedGen:CN517202|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712589217125892GA17:g.17125892G>A-
NM_144997.7(FLCN):c.691C>T (p.His231Tyr)201163FLCNUncertain significance-1RCV001904704; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712590317125903GA17125903-
NM_144997.7(FLCN):c.690A>C (p.Leu230=)201163FLCNLikely benignrs373977390RCV000912757|RCV001461283; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712590417125904TG17:g.17125904T>G-
NM_144997.7(FLCN):c.687C>T (p.Phe229=)201163FLCNLikely benignrs754710935RCV000476941|RCV000573598|RCV001704577; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202171712590717125907GANC_000017.10:g.17125907G>AClinGen:CA8416338C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.684A>G (p.Pro228=)201163FLCNLikely benign-1RCV001465658; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712591017125910TC17125910-
NM_144997.7(FLCN):c.682C>T (p.Pro228Ser)201163FLCNUncertain significancers1255176486RCV001234115; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712591217125912GA17:g.17125912G>A-
NM_144997.7(FLCN):c.681G>A (p.Thr227=)201163FLCNLikely benignrs781035304RCV000877766|RCV001480863; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712591317125913CT17:g.17125913C>T-
NM_144997.7(FLCN):c.680C>T (p.Thr227Met)201163FLCNUncertain significancers747675386RCV000635540|RCV001775932; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171712591417125914GA17:g.17125914G>AClinGen:CA8416340C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.679A>C (p.Thr227Pro)201163FLCNUncertain significancers2047127982RCV001212811; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712591517125915TG17:g.17125915T>G-
NM_144997.7(FLCN):c.678C>T (p.Phe226=)201163FLCNLikely benign-1RCV002185680; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712591617125916GA17125916-
NM_144997.7(FLCN):c.677T>C (p.Phe226Ser)201163FLCNUncertain significancers2047128063RCV001228897; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712591717125917AG17:g.17125917A>G-
NM_144997.7(FLCN):c.675C>T (p.Ala225=)201163FLCNLikely benign-1RCV001504712; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712591917125919GA17125919-
NM_144997.7(FLCN):c.673G>A (p.Ala225Thr)201163FLCNUncertain significancers769250170RCV000560997|RCV001059272; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712592117125921CT17:g.17125921C>TClinGen:CA8416341C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.672A>G (p.Thr224=)201163FLCNLikely benignrs1555609880RCV000635578; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712592217125922TC17:g.17125922T>CClinGen:CA498164695C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.671C>T (p.Thr224Ile)201163FLCNUncertain significancers2047128653RCV001225992; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712592317125923GA17:g.17125923G>A-
NM_144997.7(FLCN):c.670A>T (p.Thr224Ser)201163FLCNUncertain significance-1RCV001963489; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712592417125924TA17125924-
NM_144997.7(FLCN):c.669C>T (p.Asn223=)201163FLCNLikely benignrs938971627RCV000890610|RCV001446582; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712592517125925GA17:g.17125925G>A-
NM_144997.7(FLCN):c.665T>A (p.Met222Lys)201163FLCNUncertain significance-1RCV001912541; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712592917125929AT17125929-
NM_144997.7(FLCN):c.659A>T (p.Gln220Leu)201163FLCNUncertain significance-1RCV002030017; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712593517125935TA17125935-
NM_144997.7(FLCN):c.657T>C (p.Ala219=)201163FLCNLikely benign-1RCV002131880; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712593717125937AG17125937-
NM_144997.7(FLCN):c.656C>T (p.Ala219Val)201163FLCNUncertain significancers2047129495RCV001341804; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712593817125938GA17125938-
NM_144997.7(FLCN):c.655G>A (p.Ala219Thr)201163FLCNUncertain significancers2047129580RCV001062089; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712593917125939CT17:g.17125939C>T-
NM_144997.7(FLCN):c.654T>C (p.Arg218=)201163FLCNLikely benignrs1352108327RCV000937912; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712594017125940AG17:g.17125940A>G-
NM_144997.7(FLCN):c.653G>A (p.Arg218His)201163FLCNUncertain significancers367843558RCV000471194; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712594117125941CTNC_000017.10:g.17125941C>TClinGen:CA8416343C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.652C>T (p.Arg218Cys)201163FLCNUncertain significancers1555609896RCV000537821; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712594217125942GA17:g.17125942G>AClinGen:CA398534080C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.646C>G (p.Pro216Ala)201163FLCNUncertain significance-1RCV001945038; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712594817125948GC17125948-
NM_144997.7(FLCN):c.645C>T (p.Cys215=)201163FLCNLikely benign-1RCV001475424|RCV001566080; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171712594917125949GA17125949-
NM_144997.7(FLCN):c.644G>A (p.Cys215Tyr)201163FLCNUncertain significance-1RCV002022645; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712595017125950CT17125950-
NM_144997.7(FLCN):c.634C>T (p.Gln212Ter)201163FLCNPathogenicrs558699420RCV000239615; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712596017125960GA17:g.17125960G>AClinGen:CA10586270C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.634C>A (p.Gln212Lys)201163FLCNUncertain significancers558699420RCV000527374|RCV001025165; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171712596017125960GT17:g.17125960G>TClinGen:CA8416347C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.633G>C (p.Glu211Asp)201163FLCNUncertain significancers876659927RCV000220989|RCV001056971; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712596117125961CG17:g.17125961C>GClinGen:CA10580172C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.632_633delinsC (p.Glu211fs)201163FLCNPathogenicrs879255661RCV000239710|RCV000657236; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171712596117125962CTG17:g.17125962_17125962delClinGen:CA10586271,OMIM:607273.0003C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.630A>G (p.Ala210=)201163FLCNLikely benignrs1305220357RCV000870403|RCV001423287; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712596417125964TC17:g.17125964T>C-
NM_144997.7(FLCN):c.629C>T (p.Ala210Val)201163FLCNUncertain significance-1RCV001884015; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712596517125965GA17125965-
NM_144997.7(FLCN):c.626A>G (p.Glu209Gly)201163FLCNUncertain significancers2047131274RCV001217099; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712596817125968TC17:g.17125968T>C-
NM_144997.7(FLCN):c.623T>G (p.Phe208Cys)201163FLCNUncertain significancers1441105848RCV001219820; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712597117125971AC17:g.17125971A>C-
NM_144997.7(FLCN):c.619G>A (p.Val207Met)201163FLCNUncertain significancers1597602620RCV000801297; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712597517125975CT17:g.17125975C>T-
NM_144997.7(FLCN):c.619-1G>A201163FLCNPathogenicrs1131690840RCV000492185|RCV000815117|RCV001724027; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171712597617125976CTNC_000017.10:g.17125976C>TClinGen:CA398534160C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.619-4del201163FLCNLikely benign-1RCV001410906; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712597917125979GAG17125978-
NM_144997.7(FLCN):c.619-6T>A201163FLCNUncertain significancers375642836RCV000549114; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712598117125981AT17:g.17125981A>TClinGen:CA8416349C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.619-7A>G201163FLCNLikely benign-1RCV002108941; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712598217125982TC17125982-
NM_144997.7(FLCN):c.619-8C>T201163FLCNLikely benign-1RCV001405454; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712598317125983GA17125983-
NM_144997.7(FLCN):c.619-12T>C201163FLCNLikely benign-1RCV002134961; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712598717125987AG17125987-
NM_144997.7(FLCN):c.619-15_619-14insG201163FLCNLikely benign-1RCV002097770; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712598917125990GGC17125989-
NM_144997.7(FLCN):c.619-15C>A201163FLCNLikely benign-1RCV002216183; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712599017125990GT17125990-
NM_144997.7(FLCN):c.619-15C>G201163FLCNLikely benign-1RCV002109596; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712599017125990GC17125990-
NM_144997.7(FLCN):c.619-15C>T201163FLCNLikely benign-1RCV002120315; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712599017125990GA17125990-
NM_144997.7(FLCN):c.619-20C>T201163FLCNLikely benignrs202217257RCV000253017|RCV001812046|RCV002055543; NMedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712599517125995GA17:g.17125995G>AClinGen:CA290941CN169374 not specified;
NM_144997.7(FLCN):c.619-20C>G201163FLCNLikely benign-1RCV002091124; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712599517125995GC17125995-
NM_144997.7(FLCN):c.618+20G>T201163FLCNLikely benign-1RCV002089598; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712721617127216CA17127216-
NC_000017.10:g.(?_17127226)_(17140502_?)del201163FLCNPathogenic-1RCV001381180; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712722617140502nana-1-
NM_144997.7(FLCN):c.618+10G>A201163FLCNLikely benign-1RCV001497749; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712722617127226CT17127226-
NC_000017.10:g.(?_17127226)_(17127467_?)dup201163FLCNUncertain significance-1RCV001989782; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712722617127467nana-1-
NM_144997.7(FLCN):c.618+10del201163FLCNLikely benign-1RCV002077476; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712722617127226TCT17127225-
NM_144997.7(FLCN):c.618+8C>G201163FLCNLikely benignrs1555610185RCV000635591; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712722817127228GC17:g.17127228G>CClinGen:CA658798723C0346010 135150 Multiple fibrofolliculomas;
NC_000017.11:g.(?_17223916)_(17224149_?)del201163FLCNLikely pathogenic-1RCV000707848; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712723017127463nana-C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.618+3G>A201163FLCNUncertain significance-1RCV002033123; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712723317127233CT17127233-
NM_144997.7(FLCN):c.618G>A (p.Lys206=)201163FLCNUncertain significancers2047170110RCV001236352; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712723617127236CT17:g.17127236C>T-
NM_144997.7(FLCN):c.617A>G (p.Lys206Arg)201163FLCNUncertain significancers886052661RCV000305587|RCV000404850; NMONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712723717127237TC17:g.17127237T>CClinGen:CA10648704C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.615C>G (p.Leu205=)201163FLCNLikely benignrs1555610191RCV000534048|RCV001024961; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171712723917127239GC17:g.17127239G>CClinGen:CA498165965C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.614T>C (p.Leu205Pro)201163FLCNUncertain significancers878855219RCV000232477|RCV001024947; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171712724017127240AG17:g.17127240A>GClinGen:CA10583456C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.612G>A (p.Ala204=)201163FLCNLikely benignrs763168749RCV001024924|RCV001497054; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712724217127242CT17:g.17127242C>T-
NM_144997.7(FLCN):c.610_611delinsTA (p.Ala204Ter)201163FLCNPathogenicrs398124538RCV000082640|RCV000133394; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712724317127244GCTANC_000017.10:g.17127243_17127244delinsTAClinGen:CA224175C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.611C>T (p.Ala204Val)201163FLCNUncertain significancers766401197RCV001064258|RCV001024911; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171712724317127243GA17:g.17127243G>A-
NM_144997.7(FLCN):c.610G>A (p.Ala204Thr)201163FLCNUncertain significancers1456509027RCV000573736|RCV001046048; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712724417127244CT17:g.17127244C>TClinGen:CA398534186C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.606C>T (p.Gly202=)201163FLCNUncertain significance-1RCV001776702|RCV002034517; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712724817127248GA17127248-
NM_144997.7(FLCN):c.604G>A (p.Gly202Ser)201163FLCNUncertain significancers774491699RCV000545339|RCV000565519; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171712725017127250CT17:g.17127250C>TClinGen:CA8416374C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.604G>C (p.Gly202Arg)201163FLCNUncertain significance-1RCV001975297; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712725017127250CG17127250-
NM_144997.7(FLCN):c.603G>T (p.Gln201His)201163FLCNUncertain significancers759405317RCV000473814; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712725117127251CANC_000017.10:g.17127251C>AClinGen:CA8416375C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.603G>A (p.Gln201=)201163FLCNLikely benign-1RCV001463339; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712725117127251CT17127251-
NM_144997.7(FLCN):c.598C>T (p.Leu200Phe)201163FLCNUncertain significancers1229735191RCV001024757|RCV001125808|RCV001125809; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903171712725617127256GA17:g.17127256G>A-
NM_144997.7(FLCN):c.597G>A (p.Glu199=)201163FLCNLikely benignrs1555610215RCV000556541; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712725717127257CT17:g.17127257C>TClinGen:CA498166063C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.594_596del (p.Asp198del)201163FLCNUncertain significancers1567819459RCV000757300|RCV000812991; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712725817127260CTCACNC_000017.10:g.17127260_17127262del-
NM_144997.7(FLCN):c.592G>A (p.Asp198Asn)201163FLCNConflicting interpretations of pathogenicityrs200168437RCV000121103|RCV000228569|RCV000341795|RCV000569608|RCV001762261|RCV001579897; NMedGen:CN169374|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0005575,MedGen:C0346629,OMIM:114500|M171712726217127262CT17:g.17127262C>TClinGen:CA159773C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.591C>T (p.Ile197=)201163FLCNLikely benignrs763617124RCV000492100|RCV000635586; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712726317127263GANC_000017.10:g.17127263G>AClinGen:CA8416378C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.589A>G (p.Ile197Val)201163FLCNUncertain significancers1288802432RCV000697317; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712726517127265TC17:g.17127265T>C-C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.588C>T (p.Ile196=)201163FLCNLikely benign-1RCV001494441; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712726617127266GA17127266-
NM_144997.7(FLCN):c.586A>G (p.Ile196Val)201163FLCNConflicting interpretations of pathogenicityrs201078144RCV000034793|RCV000464556|RCV001024623; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171712726817127268TC17:g.17127268T>CClinGen:CA215936C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.576_586del (p.Lys192fs)201163FLCNPathogenicrs2047172274RCV001236967; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712726817127278ATTCCCCGGACCA17:g.17127268_17127278del-
NM_144997.7(FLCN):c.584del (p.Gly195fs)201163FLCNPathogenicrs878855217RCV000230881|RCV000255719|RCV000492527; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171712727017127270TCTNC_000017.10:g.17127273delClinGen:CA10583457
NM_144997.7(FLCN):c.583G>A (p.Gly195Arg)201163FLCNUncertain significance-1RCV001366451; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712727117127271CT17127271-
NM_144997.7(FLCN):c.582G>A (p.Arg194=)201163FLCNLikely benign-1RCV001443321; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712727217127272CT17127272-
NM_144997.7(FLCN):c.581G>A (p.Arg194Gln)201163FLCNUncertain significancers756807584RCV000694416; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712727317127273CT17:g.17127273C>T-C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.580C>T (p.Arg194Trp)201163FLCNConflicting interpretations of pathogenicityrs138070947RCV000130128|RCV000226985|RCV001563174; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171712727417127274GA17:g.17127274G>AClinGen:CA165760C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.575A>G (p.Lys192Arg)201163FLCNUncertain significance-1RCV002020774; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712727917127279TC17127279-
NM_144997.7(FLCN):c.574A>G (p.Lys192Glu)201163FLCNUncertain significancers2047173108RCV001037887; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712728017127280TC17:g.17127280T>C-
NM_144997.7(FLCN):c.573G>T (p.Gly191=)201163FLCNUncertain significancers1394124940RCV000546412; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712728117127281CA17:g.17127281C>AClinGen:CA498166156C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.572G>A (p.Gly191Glu)201163FLCNUncertain significancers2047173274RCV001308623; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712728217127282CT17127282-
NM_144997.7(FLCN):c.570G>A (p.Leu190=)201163FLCNUncertain significance-1RCV001938631; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712728417127284CT17127284-
NM_144997.7(FLCN):c.567_568delinsTT (p.Leu189_Leu190=)201163FLCNLikely benignrs1597606495RCV000944182; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712728617127287GCAANC_000017.10:g.17127286_17127287delinsAA-
NM_144997.7(FLCN):c.567G>A (p.Leu189=)201163FLCNLikely benign-1RCV002124112; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712728717127287CT17127287-
NM_144997.7(FLCN):c.565C>T (p.Leu189=)201163FLCNLikely benignrs781433539RCV000464106; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712728917127289GANC_000017.10:g.17127289G>AClinGen:CA8416382C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.564C>T (p.Phe188=)201163FLCNLikely benignrs1597606543RCV000982168; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712729017127290GA17:g.17127290G>A-
NM_144997.7(FLCN):c.563del (p.Phe188fs)201163FLCNPathogenicrs1597606551RCV000816840; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712729117127291GAG17:g.17127291_17127291del-
NM_144997.7(FLCN):c.562T>A (p.Phe188Ile)201163FLCNUncertain significancers1407566775RCV001056721; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712729217127292AT17:g.17127292A>T-
NM_144997.7(FLCN):c.559C>A (p.Pro187Thr)201163FLCNUncertain significance-1RCV001365487; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712729517127295GT17127295-
NM_144997.7(FLCN):c.558G>A (p.Trp186Ter)201163FLCNPathogenic-1RCV001387218; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712729617127296CT17127296-
NM_144997.7(FLCN):c.557G>A (p.Trp186Ter)201163FLCNPathogenicrs876658409RCV000217378|RCV000475095|RCV000489130; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171712729717127297CT17:g.17127297C>TClinGen:CA10580173C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.555C>A (p.Ser185=)201163FLCNConflicting interpretations of pathogenicityrs748363919RCV000864248|RCV001024273|RCV001776067; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202171712729917127299GT17:g.17127299G>T-
NM_144997.7(FLCN):c.555C>T (p.Ser185=)201163FLCNLikely benign-1RCV001448956; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712729917127299GA17127299-
NM_144997.7(FLCN):c.553T>C (p.Ser185Pro)201163FLCNLikely pathogenicrs876657646RCV000222633; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712730117127301AG17:g.17127301A>GClinGen:CA10577010C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.552C>A (p.Asn184Lys)201163FLCNConflicting interpretations of pathogenicityrs143525924RCV000234368|RCV000523373|RCV001024230|RCV001125810; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903171712730217127302GTNC_000017.10:g.17127302G>TClinGen:CA8416384
NM_144997.7(FLCN):c.551A>C (p.Asn184Thr)201163FLCNUncertain significance-1RCV001906016; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712730317127303TG17127303-
NM_144997.7(FLCN):c.549C>T (p.Ile183=)201163FLCNLikely benign-1RCV001418074; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712730517127305GA17127305-
NM_144997.7(FLCN):c.549C>G (p.Ile183Met)201163FLCNUncertain significance-1RCV001990664; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712730517127305GC17127305-
NM_144997.7(FLCN):c.546C>T (p.Leu182=)201163FLCNLikely benign-1RCV001429615; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712730817127308GA17127308-
NM_144997.7(FLCN):c.544C>T (p.Leu182Phe)201163FLCNUncertain significance-1RCV001995171; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712731017127310GA17127310-
NM_144997.7(FLCN):c.543C>T (p.Tyr181=)201163FLCNLikely benign-1RCV002191595; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712731117127311GA17127311-
NM_144997.7(FLCN):c.542A>T (p.Tyr181Phe)201163FLCNUncertain significancers1398715352RCV001350708; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712731217127312TA17127312-
NM_144997.7(FLCN):c.539T>A (p.Ile180Asn)201163FLCNUncertain significance-1RCV002043366; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712731517127315AT17127315-
NM_144997.7(FLCN):c.536G>A (p.Arg179Gln)201163FLCNUncertain significancers369906553RCV000302075|RCV000356859|RCV001764291; NMONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171712731817127318CT17:g.17127318C>TClinGen:CA10648705C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.535C>T (p.Arg179Trp)201163FLCNUncertain significancers774358971RCV000467918|RCV001023971|RCV001568283|RCV001198849; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|Gene:100038247,MONDO:MONDO:0012574,MedGen:C2931246,OMIM:610883, Orphanet:1713171712731917127319GANC_000017.10:g.17127319G>AClinGen:CA8416388C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.523_535del (p.Ile175fs)201163FLCNPathogenicrs2047175695RCV001063466; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712731917127331CGGTCCATCATGATC17:g.17127319_17127331del-
NM_144997.7(FLCN):c.535C>A (p.Arg179=)201163FLCNUncertain significance-1RCV001933595; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712731917127319GT17127319-
NM_144997.7(FLCN):c.534C>T (p.Asp178=)201163FLCNLikely benignrs1597606800RCV000975594|RCV001438656; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712732017127320GA17:g.17127320G>A-
NM_144997.7(FLCN):c.530T>A (p.Met177Lys)201163FLCNUncertain significancers2047175841RCV001295148; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712732417127324AT17127324-
NM_144997.7(FLCN):c.521_527del (p.Thr174fs)201163FLCNPathogenicrs1085307478RCV000489049|RCV001064850; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712732717127333CATGATGGCNC_000017.10:g.17127327_17127333delClinGen:CA645293898CN517202 not provided;
NM_144997.7(FLCN):c.523A>G (p.Ile175Val)201163FLCNUncertain significancers1410036494RCV001345137; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712733117127331TC17127331-
NM_144997.7(FLCN):c.522C>T (p.Thr174=)201163FLCNLikely benign-1RCV002074890; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712733217127332GA17127332-
NM_144997.7(FLCN):c.521C>T (p.Thr174Ile)201163FLCNUncertain significancers886799065RCV001040690; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712733317127333GA17:g.17127333G>A-
NM_144997.7(FLCN):c.520A>T (p.Thr174Ser)201163FLCNUncertain significancers2047176361RCV001052858; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712733417127334TA17:g.17127334T>A-
NM_144997.7(FLCN):c.503_518delinsATCAG (p.Arg168fs)201163FLCNPathogenicrs1064792959RCV000459716|RCV000492646; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171712733617127351ATGATGCTGTACCAGCCTGATNC_000017.10:g.17127336_17127351delinsCTGATClinGen:CA16615530C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.517A>G (p.Ile173Val)201163FLCNUncertain significancers1597606885RCV001023667|RCV001343002; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712733717127337TC17:g.17127337T>C-
NM_144997.7(FLCN):c.516C>T (p.Ile172=)201163FLCNLikely benign-1RCV002131577; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712733817127338GA17127338-
NM_144997.7(FLCN):c.514A>G (p.Ile172Val)201163FLCNUncertain significancers1290646710RCV000689969; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712734017127340TCNC_000017.10:g.17127340T>C-C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.510C>A (p.Tyr170Ter)201163FLCNPathogenicrs1567819834RCV000685150; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712734417127344GT17:g.17127344G>T-C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.510C>T (p.Tyr170=)201163FLCNLikely benign-1RCV001402995; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712734417127344GA17127344-
NM_144997.7(FLCN):c.503G>A (p.Arg168His)201163FLCNUncertain significancers759556434RCV000707321; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712735117127351CTNC_000017.10:g.17127351C>T-C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.502C>T (p.Arg168Cys)201163FLCNUncertain significancers587778367RCV000121102|RCV000817735; NMedGen:CN169374|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712735217127352GANC_000017.10:g.17127352G>AClinGen:CA159770CN169374 not specified;
NM_144997.7(FLCN):c.501G>C (p.Gln167His)201163FLCNUncertain significancers772775816RCV000692538|RCV001023431; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171712735317127353CGNC_000017.10:g.17127353C>G-C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.500A>C (p.Gln167Pro)201163FLCNUncertain significancers1597606955RCV000799526; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712735417127354TG17:g.17127354T>G-
NM_144997.7(FLCN):c.500A>G (p.Gln167Arg)201163FLCNUncertain significancers1597606955RCV001219299; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712735417127354TC17:g.17127354T>C-
NM_144997.7(FLCN):c.499C>T (p.Gln167Ter)201163FLCNPathogenicrs587782069RCV000130556|RCV000239654|RCV000255173; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171712735517127355GANC_000017.10:g.17127355G>AClinGen:CA166645
NM_144997.7(FLCN):c.498C>G (p.Phe166Leu)201163FLCNUncertain significancers1040675580RCV000553117|RCV001023371|RCV001574889; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202171712735617127356GC17:g.17127356G>CClinGen:CA288317129C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.489C>A (p.Ala163=)201163FLCNLikely benignrs775176038RCV000876981|RCV001023219|RCV001487039; NMedGen:CN517202|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712736517127365GT17:g.17127365G>T-
NM_144997.7(FLCN):c.484C>G (p.Leu162Val)201163FLCNUncertain significancers1597607071RCV000812582; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712737017127370GC17:g.17127370G>C-
NM_144997.7(FLCN):c.482G>A (p.Ser161Asn)201163FLCNUncertain significancers760556162RCV001023122|RCV001873365; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712737217127372CT17:g.17127372C>T-
NM_144997.7(FLCN):c.480C>T (p.Asp160=)201163FLCNLikely benignrs1597607089RCV000940786|RCV001426578; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712737417127374GA17:g.17127374G>A-
NM_144997.7(FLCN):c.476_479dup (p.Asp160fs)201163FLCNPathogenic-1RCV001899744; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712737417127375GGTCCT17127374-
NM_144997.7(FLCN):c.478G>T (p.Asp160Tyr)201163FLCNUncertain significancers1400112197RCV001044758; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712737617127376CA17:g.17127376C>A-
NM_144997.7(FLCN):c.464_475del (p.Thr155_Ile158del)201163FLCNUncertain significancers2047178513RCV001342723; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712737917127390TTGATGAAGAAGGT17127378-
NM_144997.7(FLCN):c.474C>T (p.Ile158=)201163FLCNLikely benignrs1597607110RCV000939345|RCV001442677; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712738017127380GA17:g.17127380G>A-
NM_144997.7(FLCN):c.472A>G (p.Ile158Val)201163FLCNUncertain significancers2047178671RCV001066844; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712738217127382TC17:g.17127382T>C-
NM_144997.7(FLCN):c.466TTC[1] (p.Phe157del)201163FLCNPathogenic/Likely pathogenicrs786203218RCV000003541|RCV000166434|RCV000256108|RCV000239623; NMONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712738317127385TGAAT17:g.17127383_17127385delClinGen:CA195863,OMIM:607273.0012C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.463A>T (p.Thr155Ser)201163FLCNUncertain significancers1253782475RCV000702695; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712739117127391TA17:g.17127391T>A-C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.461A>T (p.His154Leu)201163FLCNUncertain significancers1555610310RCV000567896|RCV001853771; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712739317127393TANC_000017.10:g.17127393T>AClinGen:CA398534509C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.457A>G (p.Ser153Gly)201163FLCNUncertain significance-1RCV002029781; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712739717127397TC17127397-
NM_144997.7(FLCN):c.456C>T (p.Phe152=)201163FLCNLikely benignrs763630763RCV000547198; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712739817127398GA17:g.17127398G>AClinGen:CA8416393C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.454T>C (p.Phe152Leu)201163FLCNUncertain significance-1RCV001998568; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712740017127400AG17127400-
NM_144997.7(FLCN):c.453del (p.Phe152fs)201163FLCNPathogenicrs879255660RCV000239695; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712740117127401ACA17:g.17127401_17127401delClinGen:CA10586272C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.452T>C (p.Val151Ala)201163FLCNUncertain significancers373794943RCV001226238; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712740217127402AG17:g.17127402A>G-
NM_144997.7(FLCN):c.451G>A (p.Val151Met)201163FLCNUncertain significancers147164515RCV000532463|RCV000658774|RCV000765334|RCV001022629; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202|Gene:100038247,MONDO:MONDO:0012574,MedGen:C2931246,OMIM:610883, Orphanet:1713; MONDO:MONDO:0002032,MedGen:C0699790; MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122; MO171712740317127403CT17:g.17127403C>TClinGen:CA8416395C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.451G>T (p.Val151Leu)201163FLCNUncertain significancers147164515RCV001069426; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712740317127403CA17:g.17127403C>A-
NM_144997.7(FLCN):c.450T>C (p.Phe150=)201163FLCNBenign/Likely benignrs200672897RCV000230449|RCV000561895|RCV001705294; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202171712740417127404AG17:g.17127404A>GClinGen:CA8416396C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.446del (p.Gly149fs)201163FLCNLikely pathogenicrs727504645RCV000155908; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712740817127408GCG17:g.17127408_17127408delClinGen:CA273584C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.446G>A (p.Gly149Asp)201163FLCNUncertain significance-1RCV002003980; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712740817127408CT17127408-
NM_144997.7(FLCN):c.445G>A (p.Gly149Ser)201163FLCNUncertain significancers752014050RCV000239651; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712740917127409CT17:g.17127409C>TClinGen:CA8416397C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.444C>T (p.His148=)201163FLCNConflicting interpretations of pathogenicityrs376825814RCV000553883|RCV001022501|RCV001086268; NMedGen:CN517202|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712741017127410GA17:g.17127410G>AClinGen:CA8416398C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.440A>T (p.Gln147Leu)201163FLCNUncertain significancers2047180211RCV001207423; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712741417127414TA17:g.17127414T>A-
NM_144997.7(FLCN):c.440A>C (p.Gln147Pro)201163FLCNUncertain significancers2047180211RCV001312283; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712741417127414TG17127414-
NM_144997.7(FLCN):c.433del (p.Asp145fs)201163FLCNPathogenicrs1135401752RCV000496097; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712742117127421TCTNC_000017.10:g.17127421delClinGen:CA645372605C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.430G>A (p.Gly144Arg)201163FLCNUncertain significance-1RCV001877089; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712742417127424CT17127424-
NM_144997.7(FLCN):c.429C>G (p.Phe143Leu)201163FLCNUncertain significancers773792624RCV000432084|RCV000571995|RCV000689693; NMedGen:CN517202|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712742517127425GC17:g.17127425G>CClinGen:CA16608387C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.429C>T (p.Phe143=)201163FLCNLikely benignrs773792624RCV000635595|RCV001022236; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171712742517127425GA17:g.17127425G>AClinGen:CA8416400C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.424TTC[1] (p.Phe143del)201163FLCNUncertain significancers764153620RCV000989761; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712742517127427CGAAC17:g.17127425_17127427del-
NM_144997.7(FLCN):c.421A>G (p.Ile141Val)201163FLCNUncertain significancers375921200RCV000570809|RCV000635569; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712743317127433TC17:g.17127433T>CClinGen:CA8416401C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.420dup (p.Ile141fs)201163FLCNPathogenicrs2047181267RCV001048645; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712743317127434TTG17:g.17127433_17127434insG-
NM_144997.7(FLCN):c.415G>T (p.Gly139Cys)201163FLCNUncertain significance-1RCV001866414; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712743917127439CA17127439-
NM_144997.7(FLCN):c.410G>A (p.Arg137His)201163FLCNUncertain significancers1289872207RCV000685189|RCV001021888; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171712744417127444CT17:g.17127444C>T-C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.404C>G (p.Pro135Arg)201163FLCNUncertain significancers1490236729RCV001040404; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712745017127450GC17:g.17127450G>C-
NM_144997.7(FLCN):c.404C>T (p.Pro135Leu)201163FLCNUncertain significance-1RCV001931295; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712745017127450GA17127450-
NM_144997.7(FLCN):c.403C>G (p.Pro135Ala)201163FLCNUncertain significance-1RCV001368772; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712745117127451GC17127451-
NM_144997.7(FLCN):c.402C>T (p.Cys134=)201163FLCNLikely benign-1RCV001436104; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712745217127452GA17127452-
NM_144997.7(FLCN):c.399C>G (p.Val133=)201163FLCNLikely benign-1RCV002182744; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712745517127455GC17127455-
NM_144997.7(FLCN):c.397G>T (p.Val133Phe)201163FLCNUncertain significance-1RCV001367143; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712745717127457CA17127457-
NM_144997.7(FLCN):c.397-1G>T201163FLCNPathogenic-1RCV001384858; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712745817127458CA17127458-
NM_144997.7(FLCN):c.397-6C>T201163FLCNLikely benign-1RCV001498454; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712746317127463GA17127463-
NM_144997.7(FLCN):c.397-8C>A201163FLCNUncertain significance-1RCV002013003; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712746517127465GT17127465-
NM_144997.7(FLCN):c.397-12G>T201163FLCNBenign/Likely benignrs199958635RCV001704756|RCV002064157; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712746917127469CA17:g.17127469C>AClinGen:CA8416404CN169374 not specified;
NM_144997.7(FLCN):c.397-12G>A201163FLCNLikely benign-1RCV002161402; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712746917127469CT17127469-
NM_144997.7(FLCN):c.397-13G>A201163FLCNBenignrs3744123RCV000082637|RCV000298389|RCV000393156|RCV000588201; NMedGen:CN169374|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MedGen:CN517202171712747017127470CT17:g.17127470C>TClinGen:CA149549C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.397-14C>T201163FLCNBenignrs1736219RCV000082638|RCV000277303|RCV000353310|RCV000589883; NMedGen:CN169374|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MedGen:CN517202171712747117127471GA17:g.17127471G>AClinGen:CA149550C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.397-16G>A201163FLCNLikely benign-1RCV002165665; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712747317127473CT17127473-
NM_144997.7(FLCN):c.397-17C>T201163FLCNLikely benign-1RCV002101209; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712747417127474GA17127474-
NM_144997.7(FLCN):c.396+19G>A201163FLCNLikely benign-1RCV001811710|RCV002077238; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712947117129471CT17129471-
NM_144997.7(FLCN):c.396+17del201163FLCNLikely benign-1RCV002202880; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712947317129473TGT17129472-
NM_144997.7(FLCN):c.396+7C>T201163FLCNLikely benignrs781155484RCV000863041; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712948317129483GA17:g.17129483G>A-
NM_144997.7(FLCN):c.396+6C>T201163FLCNUncertain significancers747922795RCV000538911; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712948417129484GA17:g.17129484G>AClinGen:CA8416444C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.396+4A>G201163FLCNConflicting interpretations of pathogenicityrs370353839RCV000463405|RCV000570650|RCV001570953; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202171712948617129486TCNC_000017.10:g.17129486T>CClinGen:CA8416446C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.396+1G>A201163FLCNLikely pathogenic-1RCV002049690; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712948917129489CT17129489-
NM_144997.7(FLCN):c.389G>A (p.Ser130Asn)201163FLCNUncertain significance-1RCV001911575; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712949717129497CT17129497-
NM_144997.7(FLCN):c.385C>T (p.Leu129=)201163FLCNLikely benignrs1597612658RCV000940109; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712950117129501GA17:g.17129501G>A-
NM_144997.7(FLCN):c.384C>T (p.Ser128=)201163FLCNLikely benignrs1597612670RCV000887553|RCV001404606; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712950217129502GA17:g.17129502G>A-
NM_144997.7(FLCN):c.383G>A (p.Ser128Asn)201163FLCNUncertain significancers2047242176RCV001228990; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712950317129503CT17:g.17129503C>T-
NM_144997.7(FLCN):c.381dup (p.Ser128fs)201163FLCNPathogenic-1RCV001950929; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712950417129505TTC17129504-
NM_144997.7(FLCN):c.381G>A (p.Arg127=)201163FLCNLikely benign-1RCV002150631; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712950517129505CT17129505-
NM_144997.7(FLCN):c.380G>A (p.Arg127Gln)201163FLCNUncertain significancers1567822604RCV000704964|RCV001843545; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171712950617129506CTNC_000017.10:g.17129506C>T-C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.379dup (p.Arg127fs)201163FLCNLikely pathogenic-1RCV001779546; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712950617129507CCG17129506-
NM_144997.7(FLCN):c.379C>T (p.Arg127Trp)201163FLCNUncertain significancers1274919531RCV000562654|RCV000635533; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712950717129507GA17:g.17129507G>AClinGen:CA398534710C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.375T>C (p.Cys125=)201163FLCNLikely benign-1RCV001444713; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712951117129511AG17129511-
NM_144997.7(FLCN):c.365_372del (p.Arg122fs)201163FLCNPathogenicrs1567822638RCV000685151; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712951417129521AGGCCTGGCA17:g.17129514_17129521del-C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.371C>A (p.Ala124Asp)201163FLCNUncertain significancers2047242712RCV001065743; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712951517129515GT17:g.17129515G>T-
NM_144997.7(FLCN):c.367C>T (p.Gln123Ter)201163FLCNPathogenic-1RCV001380279; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712951917129519GA17129519-
NM_144997.7(FLCN):c.366C>G (p.Arg122=)201163FLCNLikely benignrs1597612729RCV000944258|RCV001501035; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712952017129520GC17:g.17129520G>C-
NM_144997.7(FLCN):c.365G>C (p.Arg122Pro)201163FLCNUncertain significance-1RCV001372073; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712952117129521CG17129521-
NM_144997.7(FLCN):c.364C>T (p.Arg122Cys)201163FLCNUncertain significance-1RCV001886301; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712952217129522GA17129522-
NM_144997.7(FLCN):c.362T>C (p.Val121Ala)201163FLCNUncertain significancers1597612758RCV000796572; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712952417129524AG17:g.17129524A>G-
NM_144997.7(FLCN):c.357C>T (p.Ser119=)201163FLCNLikely benignrs878855216RCV000232790|RCV001394830; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712952917129529GA17:g.17129529G>AClinGen:CA10583458C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.354C>T (p.Phe118=)201163FLCNLikely benignrs1555610913RCV000533319; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712953217129532GA17:g.17129532G>AClinGen:CA498167672C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.351C>G (p.Leu117=)201163FLCNLikely benign-1RCV002156169; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712953517129535GC17129535-
NM_144997.7(FLCN):c.347dup (p.Leu117fs)201163FLCNPathogenicrs776896550RCV000230001|RCV000358389|RCV000492339; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171712953817129539CCTNC_000017.10:g.17129539dupClinGen:CA8416448
NM_144997.7(FLCN):c.346C>T (p.Gln116Ter)201163FLCNPathogenicrs398124536RCV000082636|RCV000239717|RCV000492649; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171712954017129540GA17:g.17129540G>AClinGen:CA224169C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.346C>A (p.Gln116Lys)201163FLCNConflicting interpretations of pathogenicityrs398124536RCV000563415|RCV000635549|RCV001764683; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0005575,MedGen:C0346629,OMIM:114500171712954017129540GT17:g.17129540G>TClinGen:CA8416449C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.345C>G (p.Pro115=)201163FLCNLikely benign-1RCV002197777; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712954117129541GC17129541-
NM_144997.7(FLCN):c.342C>A (p.His114Gln)201163FLCNUncertain significancers1448942524RCV000694404; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712954417129544GT17:g.17129544G>T-C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.339C>T (p.Ser113=)201163FLCNLikely benign-1RCV001452015; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712954717129547GA17129547-
NM_144997.7(FLCN):c.334C>G (p.Pro112Ala)201163FLCNUncertain significancers2047244344RCV001227112; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712955217129552GC17:g.17129552G>C-
NM_144997.7(FLCN):c.333C>T (p.His111=)201163FLCNLikely benignrs1555610924RCV000635572; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712955317129553GANC_000017.10:g.17129553G>AClinGen:CA498167685C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.333C>G (p.His111Gln)201163FLCNUncertain significancers1555610924RCV001316117; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712955317129553GC17129553-
NM_144997.7(FLCN):c.327C>T (p.His109=)201163FLCNLikely benignrs1597612898RCV000870696|RCV001416097; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712955917129559GA17:g.17129559G>A-
NM_144997.7(FLCN):c.326A>G (p.His109Arg)201163FLCNUncertain significancers1597612913RCV001019536|RCV001873316; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712956017129560TC17:g.17129560T>C-
NM_144997.7(FLCN):c.325C>T (p.His109Tyr)201163FLCNUncertain significancers2047244929RCV001034835; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712956117129561GA17:g.17129561G>A-
NM_144997.7(FLCN):c.323_324delinsTT (p.Ser108Ile)201163FLCNUncertain significance-1RCV001776764|RCV002034521; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712956217129563GCAA17129562-
NM_144997.7(FLCN):c.321dup (p.Ser108fs)201163FLCNPathogenic-1RCV001384571; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712956417129565TTG17129564-
NM_144997.7(FLCN):c.321C>T (p.Val107=)201163FLCNLikely benign-1RCV002104778; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712956517129565GA17129565-
NM_144997.7(FLCN):c.319_320delinsCAC (p.Val107fs)201163FLCNPathogenicrs398124535RCV000082635|RCV000239674|RCV000492373; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171712956617129567ACGTG17:g.17129566_17129567insTGClinGen:CA224168C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.319_320del (p.Val107fs)201163FLCNPathogenic-1RCV001380023; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712956617129567GACG17129565-
NM_144997.7(FLCN):c.319G>A (p.Val107Ile)201163FLCNUncertain significancers1372666497RCV001058910|RCV001776114; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171712956717129567CT17:g.17129567C>T-
NM_144997.7(FLCN):c.318C>T (p.Tyr106=)201163FLCNLikely benignrs773946854RCV000554734|RCV000562037|RCV001584258; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202171712956817129568GA17:g.17129568G>AClinGen:CA8416451C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.315A>G (p.Lys105=)201163FLCNConflicting interpretations of pathogenicityrs759011359RCV000804725|RCV001018865; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171712957117129571TC17:g.17129571T>C-
NM_144997.7(FLCN):c.315A>C (p.Lys105Asn)201163FLCNUncertain significance-1RCV002015984; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712957117129571TG17129571-
NM_144997.7(FLCN):c.312del (p.Lys105fs)201163FLCNPathogenicrs1597612985RCV000811522; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712957417129574TAT17:g.17129574_17129574del-
NM_144997.7(FLCN):c.312T>G (p.Ile104Met)201163FLCNUncertain significance-1RCV001930348; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712957417129574AC17129574-
NM_144997.7(FLCN):c.311T>C (p.Ile104Thr)201163FLCNUncertain significancers764679174RCV001018710|RCV001860921; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712957517129575AG17:g.17129575A>G-
NM_144997.7(FLCN):c.309C>T (p.Ser103=)201163FLCNLikely benign-1RCV002186058; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712957717129577GA17129577-
NM_144997.7(FLCN):c.306C>T (p.Thr102=)201163FLCNLikely benignrs762265819RCV000940620|RCV001431473; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712958017129580GA17:g.17129580G>A-
NM_144997.7(FLCN):c.304A>T (p.Thr102Ser)201163FLCNUncertain significancers1555610938RCV000562365|RCV000804977; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712958217129582TANC_000017.10:g.17129582T>AClinGen:CA398534881C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.303G>C (p.Glu101Asp)201163FLCNUncertain significancers910566279RCV000635563; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712958317129583CGNC_000017.10:g.17129583C>GClinGen:CA288319037C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.302A>C (p.Glu101Ala)201163FLCNUncertain significancers958255980RCV000573827|RCV000820452; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712958417129584TGNC_000017.10:g.17129584T>GClinGen:CA398534885C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.302A>G (p.Glu101Gly)201163FLCNUncertain significancers958255980RCV001063990; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712958417129584TC17:g.17129584T>C-
NM_144997.7(FLCN):c.300A>G (p.Lys100=)201163FLCNLikely benign-1RCV002098768; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712958617129586TC17129586-
NM_144997.7(FLCN):c.297T>C (p.Asp99=)201163FLCNLikely benignrs1597613086RCV000933110|RCV001492716; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712958917129589AG17:g.17129589A>G-
NM_144997.7(FLCN):c.296del (p.Asp99fs)201163FLCNPathogenicrs398124534RCV000082634|RCV000239648|RCV000492350; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171712959017129590ATANC_000017.10:g.17129590delClinGen:CA224167
NM_144997.7(FLCN):c.294T>C (p.His98=)201163FLCNLikely benign-1RCV001426637; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712959217129592AG17129592-
NM_144997.7(FLCN):c.292C>G (p.His98Asp)201163FLCNUncertain significancers1567822895RCV000706896; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712959417129594GCNC_000017.10:g.17129594G>C-C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.292C>T (p.His98Tyr)201163FLCNUncertain significancers1567822895RCV001041249; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712959417129594GA17:g.17129594G>A-
NM_144997.7(FLCN):c.290G>A (p.Ser97Asn)201163FLCNUncertain significance-1RCV001990138; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712959617129596CT17129596-
NM_144997.7(FLCN):c.288C>T (p.Ile96=)201163FLCNLikely benign-1RCV002213035; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712959817129598GA17129598-
NM_144997.7(FLCN):c.285T>C (p.Tyr95=)201163FLCNLikely benign-1RCV002093797; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712960117129601AG17129601-
NM_144997.7(FLCN):c.284A>G (p.Tyr95Cys)201163FLCNUncertain significancers1555610947RCV000539998|RCV001016782|RCV001843529; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|Human Phenotype Ontology:HP:0002884,MONDO:MONDO:0018666,MedGen:C0206624, Orphanet:449171712960217129602TCNC_000017.10:g.17129602T>CClinGen:CA398534933C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.283T>C (p.Tyr95His)201163FLCNUncertain significance-1RCV001954746; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712960317129603AG17129603-
NM_144997.7(FLCN):c.282A>G (p.Gly94=)201163FLCNUncertain significance-1RCV001967698; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712960417129604TC17129604-
NM_144997.7(FLCN):c.281G>A (p.Gly94Glu)201163FLCNUncertain significance-1RCV002001092; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712960517129605CT17129605-
NM_144997.7(FLCN):c.279G>A (p.Pro93=)201163FLCNLikely benignrs138688941RCV000575778|RCV000867885; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712960717129607CTNC_000017.10:g.17129607C>TClinGen:CA8416458C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.278C>T (p.Pro93Leu)201163FLCNUncertain significancers766548696RCV000566388|RCV000691012|RCV001564751; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171712960817129608GA17:g.17129608G>AClinGen:CA8416459C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.277C>T (p.Pro93Ser)201163FLCNUncertain significance-1RCV001992967; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712960917129609GA17129609-
NM_144997.7(FLCN):c.277C>G (p.Pro93Ala)201163FLCNUncertain significance-1RCV002022696; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712960917129609GC17129609-
NM_144997.7(FLCN):c.276C>T (p.His92=)201163FLCNLikely benignrs1555610970RCV000635585; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712961017129610GANC_000017.10:g.17129610G>AClinGen:CA498167711C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.274C>T (p.His92Tyr)201163FLCNUncertain significancers755107067RCV000469187|RCV001016489; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171712961217129612GANC_000017.10:g.17129612G>AClinGen:CA8416461C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.273del (p.His92fs)201163FLCNPathogenicrs2047248214RCV001040528; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712961317129613GCG17:g.17129613_17129613del-
NM_144997.7(FLCN):c.256_269del (p.Ser87fs)201163FLCNLikely pathogenic-1RCV001553626; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712961717129630TGCAGCAAGTGACCGT17129616-
NM_144997.7(FLCN):c.268G>T (p.Ala90Ser)201163FLCNConflicting interpretations of pathogenicityrs141140415RCV000034791|RCV000121101|RCV000227232|RCV000332283|RCV000571977|RCV001762107; NMedGen:CN517202|MedGen:CN169374|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0005575,MedGen:C03466171712961817129618CA17:g.17129618C>AClinGen:CA159767C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.268G>A (p.Ala90Thr)201163FLCNUncertain significancers141140415RCV001016321|RCV001070722; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712961817129618CT17:g.17129618C>T-
NM_144997.7(FLCN):c.262C>G (p.Leu88Val)201163FLCNUncertain significancers2047248621RCV001216164; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712962417129624GC17:g.17129624G>C-
NM_144997.7(FLCN):c.261A>G (p.Ser87=)201163FLCNLikely benign-1RCV002143294; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712962517129625TC17129625-
NM_144997.7(FLCN):c.258G>T (p.Arg86=)201163FLCNLikely benign-1RCV001441689; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712962817129628CA17129628-
NM_144997.7(FLCN):c.257G>A (p.Arg86Gln)201163FLCNUncertain significancers765550303RCV000468705|RCV001016003; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171712962917129629CTNC_000017.10:g.17129629C>TClinGen:CA8416463C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.256C>T (p.Arg86Trp)201163FLCNUncertain significancers1327627870RCV000525004|RCV000569962; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171712963017129630GA17:g.17129630G>AClinGen:CA398534984C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.252C>T (p.Gly84=)201163FLCNLikely benignrs1597613345RCV001015847|RCV001404111; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712963417129634GA17:g.17129634G>A-
NM_144997.7(FLCN):c.250-1G>A201163FLCNPathogenicrs786202081RCV000164717|RCV000239714|RCV000490144; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171712963717129637CTNC_000017.10:g.17129637C>TClinGen:CA191617
NM_144997.7(FLCN):c.250-2A>G201163FLCNPathogenicrs398124533RCV000082633|RCV000239670|RCV000492149; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171712963817129638TCNC_000017.10:g.17129638T>CClinGen:CA224166,OMIM:607273.0014
NM_144997.7(FLCN):c.250-3C>G201163FLCNUncertain significance-1RCV001909370; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712963917129639GC17129639-
NM_144997.7(FLCN):c.250-4A>G201163FLCNConflicting interpretations of pathogenicityrs777642771RCV001015778|RCV001398747; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712964017129640TC17:g.17129640T>C-
NM_144997.7(FLCN):c.250-7T>C201163FLCNConflicting interpretations of pathogenicityrs748857550RCV000274117|RCV000329198; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903171712964317129643AG17:g.17129643A>GClinGen:CA8416465C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.250-8A>T201163FLCNLikely benignrs770589774RCV000635575; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712964417129644TANC_000017.10:g.17129644T>AClinGen:CA8416466C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.250-8A>G201163FLCNLikely benign-1RCV002097695; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712964417129644TC17129644-
NM_144997.7(FLCN):c.250-14_250-9del201163FLCNUncertain significance-1RCV001965570; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171712964517129650TGAAAAGT17129644-
NM_144997.7(FLCN):c.249+16G>A201163FLCNLikely benign-1RCV002118270; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713118717131187CT17131187-
NM_144997.7(FLCN):c.249+13G>C201163FLCNConflicting interpretations of pathogenicityrs200103733RCV000289424|RCV000383825|RCV000612124; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MedGen:CN169374171713119017131190CG17:g.17131190C>GClinGen:CA8416482C0346010 135150 Multiple fibrofolliculomas;
NC_000017.10:g.(?_17131193)_(17140502_?)del201163FLCNPathogenic-1RCV001381179; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713119317140502nana-1-
NC_000017.10:g.(?_17131193)_(17140502_?)dup201163FLCNUncertain significance-1RCV001943276; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713119317140502nana-1-
NC_000017.10:g.(?_17131193)_(17131475_?)del201163FLCNPathogenic-1RCV002007467; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713119317131475nana-1-
NM_144997.7(FLCN):c.249+7G>A201163FLCNLikely benignrs1597617052RCV000912503|RCV001460862; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713119617131196CT17:g.17131196C>T-
NM_144997.7(FLCN):c.249+5G>A201163FLCNConflicting interpretations of pathogenicityrs1064793127RCV000485638|RCV000635570; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713119817131198CT17:g.17131198C>TClinGen:CA16620340C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.249+4A>G201163FLCNUncertain significancers753648691RCV000567172|RCV000704120; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713119917131199TCNC_000017.10:g.17131199T>CClinGen:CA8416484C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.249+4A>C201163FLCNUncertain significancers753648691RCV001223425; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713119917131199TG17:g.17131199T>G-
NM_144997.7(FLCN):c.249+3A>G201163FLCNUncertain significance-1RCV002020669; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713120017131200TC17131200-
NM_144997.7(FLCN):c.249+2C>T201163FLCNUncertain significancers939223011RCV000456150; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713120117131201GANC_000017.10:g.17131201G>AClinGen:CA16615123C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.249+1G>T201163FLCNLikely pathogenicrs1060502369RCV000473630; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713120217131202CANC_000017.10:g.17131202C>AClinGen:CA16615127C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.247G>A (p.Glu83Lys)201163FLCNConflicting interpretations of pathogenicityrs757060348RCV000421206|RCV000540761|RCV000563799; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171713120517131205CTNC_000017.10:g.17131205C>TClinGen:CA8416485
NM_144997.7(FLCN):c.246C>T (p.Cys82=)201163FLCNLikely benignrs150712346RCV000163467|RCV000756169|RCV001085160; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713120617131206GA17:g.17131206G>AClinGen:CA188367C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.245G>A (p.Cys82Tyr)201163FLCNUncertain significance-1RCV001372406; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713120717131207CT17131207-
NM_144997.7(FLCN):c.241A>G (p.Met81Val)201163FLCNUncertain significancers745521431RCV000803233; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713121117131211TC17:g.17131211T>C-
NM_144997.7(FLCN):c.237_240dup (p.Met81fs)201163FLCNPathogenicrs1597617148RCV000799523|RCV001015314; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171713121117131212TTGTCC17:g.17131211_17131212insGTCC-
NM_144997.7(FLCN):c.241A>C (p.Met81Leu)201163FLCNUncertain significance-1RCV002047319; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713121117131211TG17131211-
NM_144997.7(FLCN):c.239del (p.Asp80fs)201163FLCNPathogenicrs1060502371RCV000461846; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713121317131213GTGNC_000017.10:g.17131213delClinGen:CA16615385C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.235_238del (p.Ser79fs)201163FLCNPathogenicrs750146811RCV000003538|RCV000239626|RCV000222354|RCV000255605; NMONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202171713121417131217TCCGAT17:g.17131214_17131217delClinGen:CA8416487,OMIM:607273.0009C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.237G>T (p.Ser79=)201163FLCNLikely benignrs771650940RCV000937373; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713121517131215CA17:g.17131215C>A-
NM_144997.7(FLCN):c.237G>A (p.Ser79=)201163FLCNLikely benign-1RCV001438905|RCV001574702; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171713121517131215CT17131215-
NM_144997.7(FLCN):c.235T>G (p.Ser79Ala)201163FLCNUncertain significancers779733014RCV000685818|RCV001683629; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903171713121717131217AC17:g.17131217A>C-C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.234G>C (p.Lys78Asn)201163FLCNUncertain significancers2047302304RCV001068397; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713121817131218CG17:g.17131218C>G-
NM_144997.7(FLCN):c.233A>G (p.Lys78Arg)201163FLCNUncertain significancers1209539424RCV000804045; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713121917131219TC17:g.17131219T>C-
NM_144997.7(FLCN):c.233A>C (p.Lys78Thr)201163FLCNUncertain significancers1209539424RCV001069990; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713121917131219TG17:g.17131219T>G-
NM_144997.7(FLCN):c.233A>T (p.Lys78Met)201163FLCNUncertain significancers1209539424RCV001320815; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713121917131219TA17131219-
NM_144997.7(FLCN):c.230A>C (p.Lys77Thr)201163FLCNUncertain significancers746556970RCV000820627; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713122217131222TG17:g.17131222T>G-
NM_144997.7(FLCN):c.228C>T (p.Pro76=)201163FLCNLikely benignrs1597617304RCV000972293|RCV001015079; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171713122417131224GA17:g.17131224G>A-
NM_144997.7(FLCN):c.228del (p.Lys78fs)201163FLCNPathogenicrs2047302808RCV001217352; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713122417131224TGT17:g.17131224_17131224del-
NM_144997.7(FLCN):c.227C>T (p.Pro76Leu)201163FLCNUncertain significancers2047302894RCV001294480; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713122517131225GA17131225-
NM_144997.7(FLCN):c.225G>T (p.Gly75=)201163FLCNLikely benignrs1555611381RCV000635574; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713122717131227CA17:g.17131227C>AClinGen:CA498421507C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.225G>A (p.Gly75=)201163FLCNLikely benignrs1555611381RCV000945241|RCV001478695; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713122717131227CT17:g.17131227C>T-
NM_144997.7(FLCN):c.223G>A (p.Gly75Arg)201163FLCNUncertain significancers1597617348RCV001014882|RCV001349128; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713122917131229CT17:g.17131229C>T-
NM_144997.7(FLCN):c.222G>A (p.Pro74=)201163FLCNLikely benignrs770311645RCV000563022|RCV000827457|RCV001087245; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713123017131230CTNC_000017.10:g.17131230C>TClinGen:CA8416491C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.221C>T (p.Pro74Leu)201163FLCNUncertain significancers773648142RCV001061632; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713123117131231GA17:g.17131231G>A-
NM_144997.7(FLCN):c.221C>G (p.Pro74Arg)201163FLCNUncertain significance-1RCV001870603; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713123117131231GC17131231-
NM_144997.7(FLCN):c.221C>A (p.Pro74Gln)201163FLCNUncertain significance-1RCV002034963; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713123117131231GT17131231-
NM_144997.7(FLCN):c.220C>T (p.Pro74Ser)201163FLCNUncertain significancers1432861054RCV000811517; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713123217131232GA17:g.17131232G>A-
NM_144997.7(FLCN):c.212C>T (p.Ser71Phe)201163FLCNUncertain significancers1555611399RCV000547463; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713124017131240GA17:g.17131240G>AClinGen:CA398535091C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.212C>A (p.Ser71Tyr)201163FLCNUncertain significance-1RCV001994248; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713124017131240GT17131240-
NM_144997.7(FLCN):c.210G>A (p.Glu70=)201163FLCNLikely benignrs771202158RCV000872205|RCV001014462|RCV001463004; NMedGen:CN517202|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713124217131242CT17:g.17131242C>T-
NM_144997.7(FLCN):c.208G>A (p.Glu70Lys)201163FLCNUncertain significancers554247745RCV000468736|RCV000575560|RCV001764421; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202171713124417131244CTNC_000017.10:g.17131244C>TClinGen:CA8416495C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.207C>T (p.Val69=)201163FLCNLikely benignrs759772780RCV000566140|RCV000635590|RCV001311877; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171713124517131245GA17:g.17131245G>AClinGen:CA8416496C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.205G>A (p.Val69Ile)201163FLCNConflicting interpretations of pathogenicityrs567617762RCV000461839|RCV000574441|RCV000611358|RCV001336976; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN169374|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903171713124717131247CTNC_000017.10:g.17131247C>TClinGen:CA8416497C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.205G>T (p.Val69Phe)201163FLCNUncertain significancers567617762RCV001296953; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713124717131247CA17131247-
NM_144997.7(FLCN):c.204C>T (p.Ser68=)201163FLCNLikely benignrs371947198RCV000423628|RCV000471138|RCV000574824; NMedGen:CN169374|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171713124817131248GA17:g.17131248G>AClinGen:CA8416498C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.202A>G (p.Ser68Gly)201163FLCNUncertain significancers587778365RCV000121098|RCV000635559; NMedGen:CN169374|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713125017131250TC17:g.17131250T>CClinGen:CA159758C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.202del (p.Ser68fs)201163FLCNPathogenicrs1060502370RCV000468103; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713125017131250CTCNC_000017.10:g.17131250delClinGen:CA16615391C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.202A>C (p.Ser68Arg)201163FLCNUncertain significance-1RCV002043649; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713125017131250TG17131250-
NM_144997.7(FLCN):c.201C>G (p.Ala67=)201163FLCNLikely benign-1RCV002117414; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713125117131251GC17131251-
NM_144997.7(FLCN):c.199del (p.Ala67fs)201163FLCNPathogenicrs1555611438RCV000561793|RCV001217705; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713125317131253GCG17:g.17131253_17131253delClinGen:CA658658540C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.199G>T (p.Ala67Ser)201163FLCNUncertain significance-1RCV001900908; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713125317131253CA17131253-
NM_144997.7(FLCN):c.198G>T (p.Gly66=)201163FLCNLikely benignrs1369491093RCV000635576|RCV001013968; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171713125417131254CANC_000017.10:g.17131254C>AClinGen:CA498421521C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.198G>A (p.Gly66=)201163FLCNLikely benignrs1369491093RCV000917325|RCV001453796; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713125417131254CT17:g.17131254C>T-
NM_144997.7(FLCN):c.197G>A (p.Gly66Glu)201163FLCNUncertain significancers753787458RCV000464734|RCV001013941|RCV001764420; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202171713125517131255CTNC_000017.10:g.17131255C>TClinGen:CA8416500C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.194A>C (p.Glu65Ala)201163FLCNUncertain significancers757012294RCV000699848; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713125817131258TGNC_000017.10:g.17131258T>G-C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.190G>A (p.Ala64Thr)201163FLCNUncertain significancers778587763RCV000805647; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713126217131262CT17:g.17131262C>T-
NM_144997.7(FLCN):c.189del (p.Ala64fs)201163FLCNPathogenicrs876660611RCV000222065|RCV000255061|RCV000537263; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713126317131263CGCNC_000017.10:g.17131266delClinGen:CA10580174
NM_144997.7(FLCN):c.189C>T (p.Pro63=)201163FLCNLikely benignrs750047828RCV000951743|RCV001311878; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171713126317131263GA17:g.17131263G>A-
NM_144997.7(FLCN):c.189C>G (p.Pro63=)201163FLCNLikely benign-1RCV001505457; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713126317131263GC17131263-
NM_144997.7(FLCN):c.186C>T (p.Ser62=)201163FLCNConflicting interpretations of pathogenicityrs1060504593RCV000458479|RCV001395736; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713126617131266GANC_000017.10:g.17131266G>AClinGen:CA16615124C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.183C>T (p.His61=)201163FLCNLikely benign-1RCV002076828; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713126917131269GA17131269-
NM_144997.7(FLCN):c.181C>G (p.His61Asp)201163FLCNUncertain significance-1RCV001777059|RCV002034530; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713127117131271GC17131271-
NM_144997.7(FLCN):c.180G>A (p.Ala60=)201163FLCNLikely benignrs1203041436RCV000945663|RCV001013202; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171713127217131272CT17:g.17131272C>T-
NM_144997.7(FLCN):c.180G>C (p.Ala60=)201163FLCNLikely benign-1RCV002218748; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713127217131272CG17131272-
NM_144997.7(FLCN):c.179C>T (p.Ala60Val)201163FLCNUncertain significancers779900587RCV001048408; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713127317131273GA17:g.17131273G>A-
NM_144997.7(FLCN):c.176G>A (p.Arg59His)201163FLCNUncertain significancers374969279RCV000239700|RCV001013092; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171713127617131276CT17:g.17131276C>TClinGen:CA8416506C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.176G>T (p.Arg59Leu)201163FLCNUncertain significancers374969279RCV001013095|RCV001055863; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713127617131276CA17:g.17131276C>A-
NM_144997.7(FLCN):c.176G>C (p.Arg59Pro)201163FLCNUncertain significancers374969279RCV001055965; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713127617131276CG17:g.17131276C>G-
NM_144997.7(FLCN):c.175C>T (p.Arg59Cys)201163FLCNUncertain significancers778275358RCV000635534|RCV001012999; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171713127717131277GANC_000017.10:g.17131277G>AClinGen:CA8416508C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.171dup (p.Met58fs)201163FLCNPathogenicrs886041203RCV000320045|RCV001383231; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713128017131281TTCNC_000017.10:g.17131282dupClinGen:CA10603439
NM_144997.7(FLCN):c.171G>A (p.Arg57=)201163FLCNLikely benign-1RCV001456631; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713128117131281CT17131281-
NM_144997.7(FLCN):c.170G>A (p.Arg57Gln)201163FLCNUncertain significancers749770193RCV000635545|RCV001012837; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171713128217131282CTNC_000017.10:g.17131282C>TClinGen:CA8416509C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.169C>T (p.Arg57Trp)201163FLCNUncertain significancers746507528RCV000699243|RCV001012686; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171713128317131283GA17:g.17131283G>A-C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.167del (p.Ser56fs)201163FLCNPathogenicrs1597617757RCV000804949; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713128517131285ACA17:g.17131285_17131285del-
NM_144997.7(FLCN):c.167G>C (p.Ser56Thr)201163FLCNUncertain significancers2047307172RCV001052501; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713128517131285CG17:g.17131285C>G-
NM_144997.7(FLCN):c.167G>A (p.Ser56Asn)201163FLCNUncertain significance-1RCV002014292; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713128517131285CT17131285-
NM_144997.7(FLCN):c.165C>A (p.Asn55Lys)201163FLCNUncertain significance-1RCV001978331; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713128717131287GT17131287-
NM_144997.7(FLCN):c.164A>G (p.Asn55Ser)201163FLCNUncertain significancers876660119RCV000220909|RCV000559720; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713128817131288TC17:g.17131288T>CClinGen:CA10580175C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.162G>A (p.Met54Ile)201163FLCNUncertain significance-1RCV001374058; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713129017131290CT17131290-
NM_144997.7(FLCN):c.161T>C (p.Met54Thr)201163FLCNUncertain significancers1555611472RCV000635531; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713129117131291AGNC_000017.10:g.17131291A>GClinGen:CA398535196C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.161T>A (p.Met54Lys)201163FLCNUncertain significancers1555611472RCV001228266; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713129117131291AT17:g.17131291A>T-
NM_144997.7(FLCN):c.159G>T (p.Gln53His)201163FLCNUncertain significance-1RCV001907644; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713129317131293CA17131293-
NM_144997.7(FLCN):c.158del (p.Gln53fs)201163FLCNPathogenicrs1131690825RCV000492196|RCV000520861|RCV001390962; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713129417131294CTC17:g.17131294_17131294delClinGen:CA645369708C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.158A>G (p.Gln53Arg)201163FLCNUncertain significance-1RCV002030615; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713129417131294TC17131294-
NM_144997.7(FLCN):c.154A>G (p.Ile52Val)201163FLCNUncertain significancers2047308054RCV001313434; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713129817131298TC17131298-
NM_144997.7(FLCN):c.151G>A (p.Gly51Ser)201163FLCNUncertain significancers2047308123RCV001046857; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713130117131301CT17:g.17131301C>T-
NM_144997.7(FLCN):c.149G>A (p.Gly50Asp)201163FLCNUncertain significancers1166116743RCV000793095; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713130317131303CT17:g.17131303C>T-
NM_144997.7(FLCN):c.144G>A (p.Glu48=)201163FLCNLikely benign-1RCV002121917; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713130817131308CT17131308-
NM_144997.7(FLCN):c.139G>C (p.Glu47Gln)201163FLCNUncertain significancers369115472RCV000166697|RCV000465657; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713131317131313CG17:g.17131313C>GClinGen:CA196505C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.138A>G (p.Glu46=)201163FLCNLikely benignrs1597617874RCV001011329|RCV001413060; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713131417131314TC17:g.17131314T>C-
NM_144997.7(FLCN):c.135G>A (p.Ala45=)201163FLCNConflicting interpretations of pathogenicityrs759930161RCV000163920|RCV000635597|RCV001122163|RCV001697059; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MedGen:CN517202171713131717131317CT17:g.17131317C>TClinGen:CA189519C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.134C>G (p.Ala45Gly)201163FLCNConflicting interpretations of pathogenicityrs556510460RCV000121099|RCV000163762|RCV000543424|RCV000765335; NMedGen:CN169374|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0007763,MedGen:CN074294,OMIM:144700, Orphanet:422526; MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150171713131817131318GC17:g.17131318G>CClinGen:CA159761C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.134C>T (p.Ala45Val)201163FLCNUncertain significancers556510460RCV000564102|RCV001171925|RCV001246934|RCV001764684; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0005575,MedGen:C0346629,OMIM:114500171713131817131318GA17:g.17131318G>AClinGen:CA8416512C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.134C>A (p.Ala45Glu)201163FLCNUncertain significancers556510460RCV000791768|RCV001011021; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171713131817131318GT17:g.17131318G>T-
NM_144997.7(FLCN):c.132G>A (p.Gln44=)201163FLCNLikely benign-1RCV002089897; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713132017131320CT17131320-
NM_144997.7(FLCN):c.129G>C (p.Glu43Asp)201163FLCNUncertain significance-1RCV002033570; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713132317131323CG17131323-
NM_144997.7(FLCN):c.125G>A (p.Gly42Asp)201163FLCNUncertain significancers999239742RCV000474602|RCV001010593; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171713132717131327CTNC_000017.10:g.17131327C>TClinGen:CA16615533C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.124G>C (p.Gly42Arg)201163FLCNUncertain significancers1436126248RCV001010539|RCV000806975; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713132817131328CG17:g.17131328C>G-
NM_144997.7(FLCN):c.122A>C (p.Gln41Pro)201163FLCNUncertain significancers2047309411RCV001219112; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713133017131330TG17:g.17131330T>G-
NM_144997.7(FLCN):c.121C>T (p.Gln41Ter)201163FLCNPathogenicrs1254608489RCV000692108; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713133117131331GANC_000017.10:g.17131331G>A-C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.121C>G (p.Gln41Glu)201163FLCNUncertain significancers1254608489RCV000703712; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713133117131331GCNC_000017.10:g.17131331G>C-C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.119G>T (p.Gly40Val)201163FLCNUncertain significance-1RCV001999558; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713133317131333CA17131333-
NM_144997.7(FLCN):c.115C>A (p.Pro39Thr)201163FLCNUncertain significancers1060502375RCV000461771; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713133717131337GTNC_000017.10:g.17131337G>TClinGen:CA16615393C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.115C>T (p.Pro39Ser)201163FLCNUncertain significance-1RCV001926295; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713133717131337GA17131337-
NM_144997.7(FLCN):c.114T>C (p.Ser38=)201163FLCNLikely benign-1RCV001401772; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713133817131338AG17131338-
NM_144997.7(FLCN):c.113del (p.Ser38fs)201163FLCNPathogenicrs878855212RCV000233508|RCV000627521; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171713133917131339ACANC_000017.10:g.17131339delClinGen:CA10583459
NM_144997.7(FLCN):c.113G>T (p.Ser38Ile)201163FLCNUncertain significancers139418842RCV000469363|RCV001017432|RCV001558005|RCV001844165; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MedGen:CN169374171713133917131339CANC_000017.10:g.17131339C>AClinGen:CA8416514C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.108G>A (p.Glu36=)201163FLCNLikely benign-1RCV002101625; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713134417131344CT17131344-
NM_144997.7(FLCN):c.104A>G (p.Asn35Ser)201163FLCNUncertain significancers2047310284RCV001246782; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713134817131348TC17:g.17131348T>C-
NM_144997.7(FLCN):c.100G>A (p.Gly34Arg)201163FLCNUncertain significancers2047310577RCV001206380; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713135217131352CT17:g.17131352C>T-
NM_144997.7(FLCN):c.99T>A (p.Asp33Glu)201163FLCNUncertain significancers375348725RCV000816744|RCV001019971; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171713135317131353AT17:g.17131353A>T-
NM_144997.7(FLCN):c.97G>T (p.Asp33Tyr)201163FLCNUncertain significancers386833401RCV000222636|RCV000635568; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713135517131355CA17:g.17131355C>AClinGen:CA10580176C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.95G>A (p.Gly32Glu)201163FLCNUncertain significancers587778366RCV000121100|RCV001019544|RCV001062369; NMedGen:CN169374|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713135717131357CT17:g.17131357C>TClinGen:CA159764CN169374 not specified;
NM_144997.7(FLCN):c.90T>C (p.Pro30=)201163FLCNLikely benignrs766122649RCV000875305|RCV001437165; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713136217131362AG17:g.17131362A>G-
NM_144997.7(FLCN):c.88C>T (p.Pro30Ser)201163FLCNUncertain significance-1RCV001985400; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713136417131364GA17131364-
NM_144997.7(FLCN):c.88C>G (p.Pro30Ala)201163FLCNUncertain significance-1RCV001979306; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713136417131364GC17131364-
NM_144997.7(FLCN):c.87T>A (p.Leu29=)201163FLCNLikely benign-1RCV001419679; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713136517131365AT17131365-
NM_144997.7(FLCN):c.86T>C (p.Leu29Pro)201163FLCNUncertain significancers150051278RCV000687044|RCV001556472; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171713136617131366AG17:g.17131366A>G-C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.86T>A (p.Leu29His)201163FLCNUncertain significancers150051278RCV001220594; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713136617131366AT17:g.17131366A>T-
NM_144997.7(FLCN):c.83C>G (p.Pro28Arg)201163FLCNConflicting interpretations of pathogenicityrs780588085RCV000466986|RCV001017707; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171713136917131369GCNC_000017.10:g.17131369G>CClinGen:CA8416521C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.82C>T (p.Pro28Ser)201163FLCNUncertain significancers749758787RCV000229497|RCV000380278|RCV001027381; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171713137017131370GA17:g.17131370G>AClinGen:CA8416522C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.82C>G (p.Pro28Ala)201163FLCNUncertain significance-1RCV001899605; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713137017131370GC17131370-
NM_144997.7(FLCN):c.80C>T (p.Ala27Val)201163FLCNUncertain significancers757670898RCV001346690; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713137217131372GA17131372-
NM_144997.7(FLCN):c.79G>T (p.Ala27Ser)201163FLCNUncertain significancers779449668RCV001044211; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713137317131373CA17:g.17131373C>A-
NM_144997.7(FLCN):c.67_79del (p.Glu23fs)201163FLCNPathogenic-1RCV001941786; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713137317131385GCGTGCAGCACCTCG17131372-
NM_144997.7(FLCN):c.79G>A (p.Ala27Thr)201163FLCNUncertain significance-1RCV002044332; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713137317131373CT17131373-
NM_144997.7(FLCN):c.78C>T (p.His26=)201163FLCNLikely benignrs746222481RCV000635588|RCV001530782|RCV001026930; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171713137417131374GANC_000017.10:g.17131374G>AClinGen:CA8416525C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.75G>T (p.Leu25=)201163FLCNLikely benignrs200350612RCV000470019; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713137717131377CANC_000017.10:g.17131377C>AClinGen:CA16615394C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.75G>A (p.Leu25=)201163FLCNBenign/Likely benignrs200350612RCV000573433|RCV000756172|RCV001081390|RCV001124933; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903171713137717131377CTNC_000017.10:g.17131377C>TClinGen:CA8416526C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.74T>C (p.Leu25Pro)201163FLCNUncertain significancers2047312815RCV001341903; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713137817131378AG17131378-
NM_144997.7(FLCN):c.73C>A (p.Leu25Met)201163FLCNUncertain significance-1RCV001897483; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713137917131379GT17131379-
NM_144997.7(FLCN):c.70G>T (p.Val24Leu)201163FLCNUncertain significancers775626774RCV001040382; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713138217131382CA17:g.17131382C>A-
NM_144997.7(FLCN):c.66G>A (p.Thr22=)201163FLCNUncertain significancers747210367RCV001059337; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713138617131386CT17:g.17131386C>T-
NM_144997.7(FLCN):c.65C>T (p.Thr22Met)201163FLCNUncertain significancers768734584RCV000456284|RCV000574639|RCV001574874; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202171713138717131387GANC_000017.10:g.17131387G>AClinGen:CA8416529C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.62G>A (p.Cys21Tyr)201163FLCNUncertain significancers1025567379RCV000804774|RCV001025105|RCV001766672; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202171713139017131390CT17:g.17131390C>T-
NM_144997.7(FLCN):c.60C>T (p.Phe20=)201163FLCNLikely benign-1RCV001486288; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713139217131392GA17131392-
NM_144997.7(FLCN):c.59del (p.Phe20fs)201163FLCNPathogenicrs876658390RCV000213153|RCV000239668|RCV000256007; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171713139317131393GAG17:g.17131393_17131393delClinGen:CA10580178C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.59T>A (p.Phe20Tyr)201163FLCNUncertain significancers1555611550RCV000535153|RCV000562808; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171713139317131393ATNC_000017.10:g.17131393A>TClinGen:CA398535414C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.57_58del (p.Phe20fs)201163FLCNPathogenic-1RCV001380040; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713139417131395AAGA17131393-
NM_144997.7(FLCN):c.57C>T (p.Leu19=)201163FLCNLikely benignrs1597618395RCV000982927|RCV001444972; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713139517131395GA17:g.17131395G>A-
NM_144997.7(FLCN):c.56T>C (p.Leu19Pro)201163FLCNUncertain significancers2047313909RCV001055395; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713139617131396AG17:g.17131396A>G-
NM_144997.7(FLCN):c.52_54delinsGCA (p.Thr18Ala)201163FLCNUncertain significancers2047314194RCV001331744; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713139817131400AGTTGC17131398-
NM_144997.7(FLCN):c.53C>T (p.Thr18Ile)201163FLCNUncertain significancers2047314341RCV001243119; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713139917131399GA17:g.17131399G>A-
NM_144997.7(FLCN):c.52A>G (p.Thr18Ala)201163FLCNUncertain significancers761993256RCV000805665; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713140017131400TC17:g.17131400T>C-
NM_144997.7(FLCN):c.52A>C (p.Thr18Pro)201163FLCNUncertain significancers761993256RCV001221879|RCV001776150; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171713140017131400TG17:g.17131400T>G-
NM_144997.7(FLCN):c.49dup (p.Arg17fs)201163FLCNPathogenicrs758385503RCV000494484|RCV000989762|RCV001197006; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|Gene:100038247,MONDO:MONDO:0012574,MedGen:C2931246,OMIM:610883, Orphanet:1713171713140217131403CCG17:g.17131402_17131403insGClinGen:CA645369710CN517202 not provided;
NM_144997.7(FLCN):c.49C>T (p.Arg17Cys)201163FLCNUncertain significance-1RCV002028451; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713140317131403GA17131403-
NM_144997.7(FLCN):c.48C>G (p.Pro16=)201163FLCNLikely benignrs1597618480RCV000867521|RCV001392136; NMedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713140417131404GC17:g.17131404G>C-
NM_144997.7(FLCN):c.47C>T (p.Pro16Leu)201163FLCNUncertain significancers1597618496RCV001246982; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713140517131405GA17:g.17131405G>A-
NM_144997.7(FLCN):c.46C>T (p.Pro16Ser)201163FLCNUncertain significance-1RCV001913758; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713140617131406GA17131406-
NM_144997.7(FLCN):c.45C>T (p.Gly15=)201163FLCNLikely benign-1RCV001474161; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713140717131407GA17131407-
NM_144997.7(FLCN):c.43G>A (p.Gly15Ser)201163FLCNUncertain significancers539468848RCV001022425|RCV001298715; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713140917131409CT17:g.17131409C>T-
NM_144997.7(FLCN):c.42C>T (p.His14=)201163FLCNLikely benignrs766288960RCV000227689|RCV000570789|RCV000601530; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN169374171713141017131410GA17:g.17131410G>AClinGen:CA8416536C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.39C>T (p.Leu13=)201163FLCNLikely benign-1RCV002183177; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713141317131413GA17131413-
NM_144997.7(FLCN):c.34G>A (p.Glu12Lys)201163FLCNUncertain significancers751171641RCV001315894; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713141817131418CT17131418-
NM_144997.7(FLCN):c.33C>A (p.Cys11Ter)201163FLCNPathogenicrs754616167RCV000492609|RCV000578955|RCV000696880; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MedGen:CN517202|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713141917131419GT17:g.17131419G>TClinGen:CA398535464C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.33C>T (p.Cys11=)201163FLCNConflicting interpretations of pathogenicityrs754616167RCV000566419|RCV000701230; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713141917131419GA17:g.17131419G>AClinGen:CA8416538C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.33C>G (p.Cys11Trp)201163FLCNConflicting interpretations of pathogenicityrs754616167RCV001297304|RCV001812962; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171713141917131419GC17131419-
NM_144997.7(FLCN):c.31T>A (p.Cys11Ser)201163FLCNUncertain significancers879255659RCV000239640; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713142117131421ATNC_000017.10:g.17131421A>TClinGen:CA10586273C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.31T>G (p.Cys11Gly)201163FLCNUncertain significancers879255659RCV000817471; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713142117131421AC17:g.17131421A>C-
NM_144997.7(FLCN):c.30del (p.Cys11fs)201163FLCNPathogenic-1RCV001901629; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713142217131422AGA17131421-
NM_144997.7(FLCN):c.27C>T (p.His9=)201163FLCNLikely benign-1RCV001405698; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713142517131425GA17131425-
NM_144997.7(FLCN):c.26A>G (p.His9Arg)201163FLCNUncertain significancers1060502373RCV000461258; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713142617131426TCNC_000017.10:g.17131426T>CClinGen:CA16615133C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.13G>A (p.Val5Met)201163FLCNUncertain significancers767235709RCV001210622; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713143917131439CT17:g.17131439C>T-
NM_144997.7(FLCN):c.12C>T (p.Ile4=)201163FLCNLikely benignrs752123350RCV000559159|RCV001010849; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162171713144017131440GANC_000017.10:g.17131440G>AClinGen:CA8416540C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.12C>A (p.Ile4=)201163FLCNLikely benignrs752123350RCV000914332; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713144017131440GT17:g.17131440G>T-
NM_144997.7(FLCN):c.10A>G (p.Ile4Val)201163FLCNUncertain significancers1555611575RCV000635529|RCV001124934; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903171713144217131442TC17:g.17131442T>CClinGen:CA398535516C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.10A>C (p.Ile4Leu)201163FLCNUncertain significance-1RCV002025827; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713144217131442TG17131442-
NM_144997.7(FLCN):c.9C>T (p.Ala3=)201163FLCNLikely benignrs1555611576RCV000565277|RCV001449326; NMONDO:MONDO:0015356,MeSH:D009386,MedGen:C0027672, Orphanet:140162|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713144317131443GANC_000017.10:g.17131443G>AClinGen:CA498167780C0027672 Hereditary cancer-predisposing syndrome;
NM_144997.7(FLCN):c.3G>C (p.Met1Ile)201163FLCNConflicting interpretations of pathogenicityrs879255658RCV000239708; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713144917131449CG17:g.17131449C>GClinGen:CA10586274C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.1A>G (p.Met1Val)201163FLCNUncertain significancers2047316806RCV001295990; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713145117131451TC17131451-
NM_144997.7(FLCN):c.-17dup201163FLCNUncertain significancers886052662RCV000285890|RCV000341017; NHuman Phenotype Ontology:HP:0002108,MedGen:C0149781|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713146717131468GGC17:g.17131467_17131468insCClinGen:CA10648708C0346010 135150 Multiple fibrofolliculomas;
NC_000017.10:g.(?_17135108)_(17136215_?)dup201163FLCNUncertain significance-1RCV000803918; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713510817136215nana-
NC_000017.10:g.(?_17135108)_(17136215_?)del201163FLCNUncertain significance-1RCV001374325; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713510817136215nana-1-
NM_144997.7(FLCN):c.-29G>A201163FLCNConflicting interpretations of pathogenicityrs151144873RCV000282578|RCV000402810|RCV000440382; NMONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN169374171713511217135112CTNC_000017.10:g.17135112C>TClinGen:CA10649611C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.-45A>G201163FLCNConflicting interpretations of pathogenicityrs571154058RCV000337565|RCV000438625|RCV000403643; NMONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MedGen:CN169374|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713512817135128TCNC_000017.10:g.17135128T>CClinGen:CA10644975C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.-65A>G201163FLCNUncertain significancers145125741RCV001124935|RCV001125913; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903171713514817135148TC17:g.17135148T>C-
NM_144997.7(FLCN):c.-78G>C201163FLCNBenignrs147598893RCV000297915|RCV000371346|RCV001672532; NMONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171713516117135161CGNC_000017.10:g.17135161C>GClinGen:CA10649614C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.-90A>G201163FLCNBenignrs8069957RCV000313226|RCV000396145|RCV001712041; NMONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171713517317135173TCNC_000017.10:g.17135173T>CClinGen:CA10648710C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.-93C>T201163FLCNBenignrs115413827RCV000273217|RCV000365505|RCV000442452; NMONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN169374171713517617135176GANC_000017.10:g.17135176G>AClinGen:CA10639033C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.-97C>T201163FLCNBenignrs114481741RCV000325983|RCV000364186|RCV000441001; NMONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN169374171713518017135180GANC_000017.10:g.17135180G>AClinGen:CA10639034C0346010 135150 Multiple fibrofolliculomas;
NC_000017.10:g.(?_17135706)_(17147081_?)del201163FLCNPathogenic-1RCV001956473; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713570617147081nana-1-
NM_144997.7(FLCN):c.-134C>T201163FLCNBenignrs116581458RCV000267182|RCV000324792|RCV000604914; NMONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN169374171713612217136122GANC_000017.10:g.17136122G>AClinGen:CA10648712C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.-141G>T201163FLCNLikely benignrs541105214RCV000284665|RCV000376999; NMONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713612917136129CANC_000017.10:g.17136129C>AClinGen:CA10648713C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.-143C>A201163FLCNUncertain significancers560968516RCV000318711|RCV000375661; NMONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713613117136131GTNC_000017.10:g.17136131G>TClinGen:CA10639035C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.-173G>A201163FLCNUncertain significancers894893484RCV001122256|RCV001128014; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903171713616117136161CT17:g.17136161C>T-
NM_144997.7(FLCN):c.-176G>A201163FLCNBenign/Likely benignrs117215381RCV000278613|RCV000336282|RCV000837366; NMONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171713616417136164CTNC_000017.10:g.17136164C>TClinGen:CA10644976C0346010 135150 Multiple fibrofolliculomas;
Single allele201163FLCNPathogenic-1RCV000787393; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171713822017146328ATTGAGACCATCCTGGCTAACACAGTGAAACCCCGTCTCTACTAAAAAATACAAAAAATTAGCTGGGCATGGTGGCGGGGGCCTGTAGCCCCAGCTACTGGGGAGGCCGAANC_000017.10:g.17138220_17146328del-C1968689 243700 Hyperimmunoglobulin E recurrent infection syndrome, autosomal recessive;
NC_000017.11:g.(?_17236912)_(17237188_?)del201163FLCNPathogenic-1RCV000708185; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171714022617140502nana-C0346010 135150 Multiple fibrofolliculomas;
NC_000017.10:g.(?_17140226)_(17140502_?)del201163FLCNPathogenic-1RCV001271106; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171714022617140502nana-1-
NM_144997.7(FLCN):c.-299C>T201163FLCNBenignrs1708629RCV000296363|RCV000408011|RCV001683291; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MedGen:CN517202171714029717140297GANC_000017.10:g.17140297G>AClinGen:CA10648714C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.-302G>A201163FLCNBenignrs41345949RCV000349034|RCV000405947|RCV001675814; NMONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171714030017140300CTNC_000017.10:g.17140300C>TClinGen:CA10649615C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.-342G>A201163FLCNUncertain significancers2047601141RCV001122257|RCV001125030; NMONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171714034017140340CT17:g.17140340C>T-
NM_144997.7(FLCN):c.-430C>T201163FLCNBenign/Likely benignrs553452028RCV001125031|RCV001125032; NMONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122171714042817140428GA17:g.17140428G>A-
NM_144997.7(FLCN):c.-431C>T201163FLCNUncertain significancers138847774RCV000308846|RCV000347473|RCV000996502; NMONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171714042917140429GA17:g.17140429G>AClinGen:CA10648719C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.-437C>T201163FLCNUncertain significancers886052663RCV000307871|RCV000402634; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903171714043517140435GANC_000017.10:g.17140435G>AClinGen:CA10649617C0346010 135150 Multiple fibrofolliculomas;
NM_144997.7(FLCN):c.-480G>C201163FLCNBenign/Likely benignrs564584154RCV000267530|RCV000360306; NMONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903171714047817140478CGNC_000017.10:g.17140478C>GClinGen:CA10649618C0346010 135150 Multiple fibrofolliculomas;
NM_144997.6(FLCN):c.-487G>C201163FLCNBenignrs1736209RCV000301565|RCV000359232|RCV001712042; NMONDO:MONDO:0008259,MedGen:C1868193,OMIM:173600, Orphanet:2903|MONDO:MONDO:0007607,MedGen:C0346010,OMIM:135150, Orphanet:122|MedGen:CN517202171714048517140485CGNC_000017.10:g.17140485C>GClinGen:CA10644979C0346010 135150 Multiple fibrofolliculomas;
MSeqDR Portal