MSeqDR Mitochondrial Disease Portal


 
*:HP: HPO terms, UMDF: 1= Disease, ND: NAMDC terms.
  Most Studied  CPEO, Complex I Deficiency, COXPD1, Leigh, LHON, MELAS, MERRF, Myopathy, SANDO
Disease Browser
Parent Node:
expand
Abnormalities, Multiple (D000015)
Parent Node:
expand
DNA Repair-Deficiency Disorders (D049914)
Parent Node:
expand
Dwarfism (D004392)
Parent Node:
expand
Heredodegenerative Disorders, Nervous System (D020271)
..Starting node
..expand
Cockayne Syndrome (D003057)

       Child Nodes:
........expandCerebrooculofacioskeletal Syndrome 1 (C562434)
........expandCerebrooculofacioskeletal Syndrome 3 (C565035)
........expandFORSYTHE-WAKELING SYNDROME (OMIM:613606)
........expandXeroderma Pigmentosum B-Cockayne Syndrome (C567061)
........expandXeroderma Pigmentosum, Type G-Cockayne Syndrome (C566879)
........expandXFE Progeroid Syndrome (C567043)



 Sister Nodes: 
..expandAlexander Disease (D038261) Child1
..expandAmyloid Neuropathies, Familial (D028227) Child1
..expandAtherosclerosis, Premature, with Deafness, Nephropathy, Diabetes Mellitus, Photomyoclonus, and Degenerative Neurologic Disease (C565928)
..expandBulbo-Spinal Atrophy, X-Linked (D055534) Child1
..expandCanavan Disease (D017825)
..expandCerebrocortical Degeneration of Infancy (C565863)
..expandCockayne Syndrome (D003057) Child6
..expandDystonia Musculorum Deformans (D004422) Child7
..expandFamilial encephalopathy with neuroserpin inclusion bodies (C536841)
..expandFatty Acid Hydroxylase-Associated Neurodegeneration (C580102)
..expandGerstmann-Straussler-Scheinker Disease (D016098)
..expandHepatolenticular Degeneration (D006527) Child2
..expandHereditary Central Nervous System Demyelinating Diseases (D020279) Child29  LSDB C:2
..expandHereditary Sensory and Autonomic Neuropathies (D009477) Child12
..expandHereditary Sensory and Motor Neuropathy (D015417) Child164  LSDB C:3
..expandHuntington Disease (D006816) Child3
..expandHuntington Disease-Like 2 (C564708)
..expandHuntington Disease-Like Syndrome (C580174)
..expandLafora Disease (D020192)
..expandLipodystrophy with Congenital Cataracts and Neurodegeneration (C564669)
..expandMental Retardation, X-Linked (D038901) Child134  LSDB C:4
..expandMicrophthalmia, Syndromic 10 (C566985)
..expandMuscular Dystrophy, Congenital, with Severe Central Nervous System Atrophy and Absence of Large Myelinated Fibers (C563378)
..expandMyotonia Congenita (D009224) Child5
..expandMyotonic Dystrophy (D009223) Child1
..expandNavajo neurohepatopathy (C538344) Child1  LSDB C:1 L: 00035;
..expandNeuroacanthocytosis (D054546) Child1
..expandNeurofibromatoses (D017253) Child13  LSDB C:1
..expandNeuronal Ceroid-Lipofuscinoses (D009472) Child9
..expandNeuropathy, Hereditary Sensory, Atypical (C564946)
..expandOptic Atrophies, Hereditary (D015418) Child30  LSDB C:5
..expandOpticocochleodentate Degeneration (C563002)
..expandPantothenate Kinase-Associated Neurodegeneration (D006211) Child1
..expandPeripheral Demyelinating Neuropathy, Central Dysmyelination, Waardenburg Syndrome, and Hirschsprung Disease (C563789)
..expandPeripheral Neuropathy, Ataxia, Focal Necrotizing Encephalopathy, and Spongy Degeneration of Brain (C564894)
..expandScapuloperoneal Syndrome, Neurogenic, Kaeser Type (C566695)
..expandSpinal Muscular Atrophies of Childhood (D014897) Child7
..expandSpinocerebellar Degenerations (D013132) Child85  LSDB C:4
..expandSpongiform Encephalopathy with Neuropsychiatric Features (C564678)
..expandTourette Syndrome (D005879) Child2
..expandTuberous Sclerosis (D014402) Child4
..expandUnverricht-Lundborg Syndrome (D020194)
   

Human Disease MESH is developed by UMLS.
Further data from MedGen, OMIM,ClinVar, CTD
Term ID:2682
Name:Cockayne Syndrome
Definition:A syndrome characterized by multiple system abnormalities including DWARFISM; PHOTOSENSITIVITY DISORDERS; PREMATURE AGING; and HEARING LOSS. It is caused by mutations of a number of autosomal recessive genes encoding proteins that involve transcriptional-coupled DNA REPAIR processes. Cockayne syndrome is classified by the severity and age of onset. Type I (classical; CSA) is early childhood onset in the second year of life; type II (congenital; CSB) is early onset at birth with severe symptoms; type III (xeroderma pigmentosum; XP) is late childhood onset with mild symptoms.
Alternative IDs:DO:DOID:2962|OMIM:133540|OMIM:216400
ParentIDs:MESH:D000015|MESH:D004392|MESH:D020271|MESH:D049914
TreeNumbers:C05.116.099.343.250 |C10.574.500.362 |C16.131.077.250 |C16.320.240.562 |C16.320.400.200 |C18.452.284.250
Synonyms:COCKAYNE SYNDROME A |COCKAYNE SYNDROME B |Cockayne Syndrome, Group A |Cockayne Syndrome, Group B |Cockayne Syndrome, Group C |Cockayne Syndrome Type 3 |Cockayne Syndrome, Type A |Cockayne Syndrome, Type B |Cockayne Syndrome Type C |Cockayne Syndrome, Type C |Cocka
Slim Mappings:Congenital abnormality|Genetic disease (inborn)|Metabolic disease|Musculoskeletal disease|Nervous system disease
Reference: MedGen: D003057
MeSH: D003057
OMIM: 133540;
MSeqDR LSDB:  
Genes: ERCC6; ERCC8;
Phenotypes
1 HP:0000007Autosomal recessive inheritance
2 HP:0006958Abnormal auditory evoked potentials
3 HP:0003130Abnormal peripheral myelination
4 HP:0001000Abnormality of skin pigmentation
5 HP:0001595Abnormality of the hair
6 HP:0000377Abnormality of the pinna
7 HP:0000649Abnormality of visual evoked potentials
8 HP:0000970Anhidrosis
9 HP:0011675Arrhythmia
NAMDC:  Cardiac conduction block
10 HP:0001251Ataxia
11 HP:0000987Atypical scarring of skin
12 HP:0002135Basal ganglia calcification
13 HP:0000670Carious teeth
14 HP:0000518Cataract
NAMDC:  Cataracts
15 HP:0007352Cerebellar calcifications
16 HP:0002059Cerebral atrophy
17 HP:0000028Cryptorchidism
18 HP:0000992Cutaneous photosensitivity
19 HP:0000633Decreased lacrimation
20 HP:0000762Decreased nerve conduction velocity
21 HP:0000680Delayed eruption of primary teeth
22 HP:0000689Dental malocclusion
23 HP:0004334Dermal atrophy
24 HP:0011359Dry hair
25 HP:0000958Dry skin
26 HP:0002240Hepatomegaly
27 HP:0000540Hypermetropia
28 HP:0000822Hypertension
29 HP:0000685Hypoplasia of teeth
30 HP:0007676Hypoplasia of the iris
31 HP:0002866Hypoplastic iliac wing
32 HP:0008839Hypoplastic pelvis
33 HP:0003224Increased cellular sensitivity to UV light
34 HP:0001249Intellectual disability
35 HP:0001511Intrauterine growth retardation
36 HP:0010234Ivory epiphyses of the phalanges of the hand
37 HP:0002808Kyphosis
38 HP:0001376Limitation of joint mobility
39 HP:0000292Loss of facial adipose tissue
40 HP:0000303Mandibular prognathia
41 HP:0000252Microcephaly
42 HP:0000482Microcornea
43 HP:0000054Micropenis
44 HP:0000568Microphthalmia
45 HP:0001324Muscle weakness
NAMDC:  Muscle weakness: diffuse
46 HP:0002343Normal pressure hydrocephalus
47 HP:0000639Nystagmus
48 HP:0007759Opacification of the corneal stroma
49 HP:0000648Optic atrophy
50 HP:0000939Osteoporosis
51 HP:0002545Patchy demyelination of subcortical white matter
52 HP:0003469Peripheral dysmyelination
53 HP:0000580Pigmentary retinopathy
NAMDC:  Pigmentary retinopathy
54 HP:0001271Polyneuropathy
55 HP:0008897Postnatal growth retardation
56 HP:0005328Progeroid facial appearance
57 HP:0000093Proteinuria
58 HP:0003758Reduced subcutaneous adipose tissue
59 HP:0000083Renal insufficiency
60 HP:0001250Seizures
NAMDC:  Seizures
61 HP:0000407Sensorineural hearing impairment
NAMDC:  Sensorineural hearing loss
62 HP:0001525Severe failure to thrive
63 HP:0003510Severe short stature
64 HP:0000417Slender nose
65 HP:0001518Small for gestational age
66 HP:0008070Sparse hair
67 HP:0001744Splenomegaly
68 HP:0003278Square pelvis bone
69 HP:0000486Strabismus
70 HP:0007346Subcortical white matter calcifications
71 HP:0002684Thickened calvaria
72 HP:0001337Tremor
Disease Causing ClinVar Variants
Variation_NameGeneIDGeneSymbolClinicalSignificancedbSNPRCVaccessionTestedInGTRPhenotypeIDsChromosomeStartStopHGVS_cHGVS_pHGVS_gOtherIDsDisease_ClinVar
NM_000124.4(ERCC6):c.*4208A>G2074ERCC6Likely benignrs182395696RCV001107522|RCV001107524|RCV001107523; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105066265350662653TC10:g.50662653T>C-
NM_000124.4(ERCC6):c.*4090G>A2074ERCC6Conflicting interpretations of pathogenicityrs117555054RCV001103899|RCV001103900|RCV001107525; NMONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105066277150662771CT10:g.50662771C>T-
NM_000124.4(ERCC6):c.*4019A>G2074ERCC6Conflicting interpretations of pathogenicityrs569564278RCV001103903|RCV001103902|RCV001103901; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761105066284250662842TC10:g.50662842T>C-
NM_000124.4(ERCC6):c.*3925A>G2074ERCC6Uncertain significancers981190765RCV001103905|RCV001103904|RCV001103906; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761105066293650662936TC10:g.50662936T>C-
NM_000124.4(ERCC6):c.*3921A>G2074ERCC6Likely benignrs533984667RCV001104186|RCV001104184|RCV001104185; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761105066294050662940TC10:g.50662940T>C-
NM_000124.4(ERCC6):c.*3823T>C2074ERCC6Benignrs73297748RCV001104187|RCV001104189|RCV001104188; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761105066303850663038AG10:g.50663038A>G-
NM_000124.4(ERCC6):c.*3720T>C2074ERCC6Uncertain significancers183472492RCV001104190|RCV001104191|RCV001106954; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761105066314150663141AG10:g.50663141A>G-
NM_000124.4(ERCC6):c.*3704C>T2074ERCC6Uncertain significancers1393093094RCV001106956|RCV001106957|RCV001106955; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105066315750663157GA10:g.50663157G>A-
NM_000124.4(ERCC6):c.*3684A>G2074ERCC6Uncertain significancers570822434RCV001106958|RCV001106959|RCV001106960; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761105066317750663177TC10:g.50663177T>C-
NM_000124.4(ERCC6):c.*3395A>C2074ERCC6Benignrs142122327RCV001106961|RCV001107618|RCV001107619; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105066346650663466TG10:g.50663466T>G-
NM_000124.4(ERCC6):c.*3366G>A2074ERCC6Uncertain significancers1850469256RCV001107620|RCV001107622|RCV001107621; NMONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105066349550663495CT10:g.50663495C>T-
NM_000124.4(ERCC6):c.*3356C>T2074ERCC6Uncertain significancers563034452RCV001107624|RCV001107625|RCV001107623; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761105066350550663505GA10:g.50663505G>A-
NM_000124.4(ERCC6):c.*3280A>G2074ERCC6Conflicting interpretations of pathogenicityrs146690522RCV001104002|RCV001104000|RCV001104001; NMONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105066358150663581TC10:g.50663581T>C-
NM_000124.4(ERCC6):c.*3217T>G2074ERCC6Uncertain significancers758928784RCV001104003|RCV001104005|RCV001104004; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105066364450663644AC10:g.50663644A>C-
NM_000124.4(ERCC6):c.*2973C>G2074ERCC6Uncertain significancers951313840RCV001104006|RCV001104007|RCV001104297; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105066388850663888GC10:g.50663888G>C-
NM_000124.4(ERCC6):c.*2946C>T2074ERCC6Benignrs146529081RCV001104298|RCV001104299|RCV001104300; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761105066391550663915GA10:g.50663915G>A-
NM_000124.4(ERCC6):c.*2766T>G2074ERCC6Conflicting interpretations of pathogenicityrs141121035RCV001104303|RCV001104301|RCV001104302; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105066409550664095AC10:g.50664095A>C-
NM_000124.4(ERCC6):c.*2729G>A2074ERCC6Conflicting interpretations of pathogenicityrs535616736RCV001104304|RCV001107052|RCV001107051; NMONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105066413250664132CT10:g.50664132C>T-
NM_000124.4(ERCC6):c.*2680A>C2074ERCC6Uncertain significancers35471849RCV001107054|RCV001107053|RCV001107055; NMONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105066418150664181TG10:g.50664181T>G-
NM_000124.4(ERCC6):c.*2662T>C2074ERCC6Uncertain significancers924324836RCV001107056|RCV001107057|RCV001107058; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761105066419950664199AG10:g.50664199A>G-
NM_000124.4(ERCC6):c.*2602A>G2074ERCC6Uncertain significancers41281953RCV001107721|RCV001107719|RCV001107720; NMONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105066425950664259TC10:g.50664259T>C-
NM_000124.4(ERCC6):c.*2540G>T2074ERCC6Uncertain significancers535495750RCV001107722|RCV001107724|RCV001107723; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105066432150664321CA10:g.50664321C>A-
NM_000124.4(ERCC6):c.*2460T>C2074ERCC6Uncertain significancers566027784RCV001104083|RCV001107725|RCV001107726; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105066440150664401AG10:g.50664401A>G-
NM_000124.4(ERCC6):c.*2237C>T2074ERCC6Conflicting interpretations of pathogenicityrs192242583RCV000295151|RCV000352403|RCV000382421; NMONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105066462450664624GA10:g.50664624G>AClinGen:CA10635388
NM_000124.4(ERCC6):c.*2137A>G2074ERCC6Benignrs114723899RCV000298236|RCV000341541|RCV000396329; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105066472450664724TC10:g.50664724T>CClinGen:CA10635390
NM_000124.4(ERCC6):c.*2031A>G2074ERCC6Uncertain significancers1050975183RCV001107141|RCV001107142|RCV001107143; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105066483050664830TC10:g.50664830T>C-
NM_000124.4(ERCC6):c.*1933A>G2074ERCC6Uncertain significancers748783305RCV000270265|RCV000332299|RCV000389141; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105066492850664928TC10:g.50664928T>CClinGen:CA10635394
NM_000124.4(ERCC6):c.*1872C>T2074ERCC6Benignrs115281814RCV000273691|RCV000331280|RCV000374277; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105066498950664989GA10:g.50664989G>AClinGen:CA10635395
NM_000124.4(ERCC6):c.*1860A>G2074ERCC6Uncertain significancers886047022RCV000282114|RCV000334815|RCV000373187; NMONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105066500150665001TC10:g.50665001T>CClinGen:CA10631727
NM_000124.4(ERCC6):c.*1805G>T2074ERCC6Uncertain significancers1850494237RCV001102556|RCV001102558|RCV001102557; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761105066505650665056CA10:g.50665056C>A-
NM_000124.4(ERCC6):c.*1780T>C2074ERCC6Uncertain significancers188228522RCV000285528|RCV000345129|RCV000393246; NMONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105066508150665081AG10:g.50665081A>GClinGen:CA10635400
NM_000124.4(ERCC6):c.*1383T>G2074ERCC6Uncertain significancers886047023RCV000310096|RCV000364655|RCV000399085; NMONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105066547850665478AC10:g.50665478A>CClinGen:CA10631728
NM_000124.4(ERCC6):c.*1275C>G2074ERCC6Benignrs182177140RCV000288461|RCV000323504|RCV000382929; NMONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105066558650665586GC10:g.50665586G>CClinGen:CA10635858
NM_000124.4(ERCC6):c.*1112G>A2074ERCC6Uncertain significancers186262133RCV000293903|RCV000348193|RCV000403083; NMONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105066574950665749CT10:g.50665749C>TClinGen:CA10635401
NM_000124.4(ERCC6):c.*977A>G2074ERCC6Uncertain significancers765959190RCV000314289|RCV000348878|RCV000398048; NMONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105066588450665884TC10:g.50665884T>CClinGen:CA10635859
NM_000124.4(ERCC6):c.*922C>T2074ERCC6Uncertain significancers562204481RCV001104576|RCV001107325|RCV001107326; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105066593950665939GA10:g.50665939G>A-
NM_000124.4(ERCC6):c.*900C>T2074ERCC6Uncertain significancers189979670RCV000265336|RCV000320386|RCV000356099; NMONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105066596150665961GA10:g.50665961G>AClinGen:CA10631733CN239231 Cerebrooculofacioskeletal Syndrome;
NM_000124.4(ERCC6):c.*813C>T2074ERCC6Conflicting interpretations of pathogenicityrs181327678RCV001107327|RCV001107329|RCV001107328; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105066604850666048GA10:g.50666048G>A-
NM_000124.4(ERCC6):c.*755A>G2074ERCC6Uncertain significancers886047024RCV000266565|RCV000326082|RCV000361190; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105066610650666106TC10:g.50666106T>CClinGen:CA10635402CN239231 Cerebrooculofacioskeletal Syndrome;
NM_000124.4(ERCC6):c.*751G>A2074ERCC6Uncertain significancers886047025RCV000291149|RCV000327420|RCV000380715; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105066611050666110CT10:g.50666110C>TClinGen:CA10635403
NM_000124.4(ERCC6):c.*681G>A2074ERCC6Uncertain significancers547014227RCV000292545|RCV000351993|RCV000386847; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105066618050666180CT10:g.50666180C>TClinGen:CA10628626
NM_000124.4(ERCC6):c.*645G>C2074ERCC6Uncertain significancers886047026RCV000279696|RCV000334705|RCV000387947; NMONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105066621650666216CG10:g.50666216C>GClinGen:CA10628629
NM_000124.4(ERCC6):c.*643G>A2074ERCC6Uncertain significancers886047027RCV000299763|RCV000339545|RCV000394988; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761105066621850666218CT10:g.50666218C>TClinGen:CA10631738
NM_000124.4(ERCC6):c.*589A>G2074ERCC6Uncertain significancers1850515497RCV001102747|RCV001104669|RCV001104670; NMONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105066627250666272TC10:g.50666272T>C-
NM_000124.4(ERCC6):c.*482C>A2074ERCC6Uncertain significancers886047028RCV000304384|RCV000363685|RCV000394991; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105066637950666379GT10:g.50666379G>TClinGen:CA10635860
NM_000124.4(ERCC6):c.*388C>A2074ERCC6Uncertain significancers886047029RCV000269037|RCV000310142|RCV000364713; NMONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105066647350666473GT10:g.50666473G>TClinGen:CA10635861
NM_000124.4(ERCC6):c.*341A>G2074ERCC6Uncertain significancers886047030RCV000275929|RCV000317050|RCV000371424; NMONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105066652050666520TC10:g.50666520T>CClinGen:CA10628636
NM_000124.4(ERCC6):c.*246T>C2074ERCC6Uncertain significancers1850520931RCV001108072|RCV001108070|RCV001108071; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761105066661550666615AG10:g.50666615A>G-
NM_000124.4(ERCC6):c.*118A>C2074ERCC6Likely benignrs4253233RCV000283681|RCV000343389|RCV000404135; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105066674350666743TG10:g.50666743T>GClinGen:CA10628637
NM_000124.4(ERCC6):c.*38A>G2074ERCC6Uncertain significancers756639495RCV000274507|RCV000309677|RCV000369067; NMONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105066682350666823TC10:g.50666823T>CClinGen:CA5495109
NM_000124.4(ERCC6):c.4430A>G (p.His1477Arg)2074ERCC6Uncertain significancers114403790RCV001104782|RCV001104781|RCV001104783; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761105066691350666913TC10:g.50666913T>C-
NM_000124.4(ERCC6):c.4399C>T (p.Arg1467Ter)2074ERCC6Likely pathogenicrs762976316RCV000669820; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105066694450666944GA10:g.50666944G>A-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.4393G>A (p.Val1465Ile)2074ERCC6Conflicting interpretations of pathogenicityrs201813523RCV000262594|RCV000316584|RCV000375860|RCV000483087; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN517202105066695050666950CT10:g.50666950C>TClinGen:CA5495122
NM_000124.4(ERCC6):c.4382C>G (p.Ser1461Ter)2074ERCC6Uncertain significancers1554873743RCV000665498; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105066696150666961GC10:g.50666961G>C-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.4322C>T (p.Thr1441Ile)2074ERCC6Benignrs4253230RCV000291208|RCV000326293|RCV000380935|RCV000870662; NMONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MedGen:CN517202105066702150667021GA10:g.50667021G>AClinGen:CA5495128,UniProtKB:Q03468#VAR_016311
NM_000124.4(ERCC6):c.4306G>A (p.Ala1436Thr)2074ERCC6Uncertain significancers747941045RCV001105917|RCV001105915|RCV001105916; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761105066703750667037CT10:g.50667037C>T-
NM_000124.4(ERCC6):c.4295G>A (p.Arg1432Lys)2074ERCC6Uncertain significancers1360922012RCV001105919|RCV001105920|RCV001105918; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761105066704850667048CT10:g.50667048C>T-
NM_000124.4(ERCC6):c.4223A>C (p.Glu1408Ala)2074ERCC6Conflicting interpretations of pathogenicityrs61760167RCV000298443|RCV000352090|RCV000397993|RCV000592732|RCV000865073|RCV000988351; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MedGen:CN169374|MedGen:CN517202|MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569105066712050667120TG10:g.50667120T>GClinGen:CA5495149CN239231 Cerebrooculofacioskeletal Syndrome;
NM_000124.4(ERCC6):c.4216G>A (p.Glu1406Lys)2074ERCC6Uncertain significancers145622432RCV001102951|RCV001102950|RCV001102952|RCV001310921; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MedGen:CN517202105066712750667127CT10:g.50667127C>T-
NM_000124.4(ERCC6):c.4211G>A (p.Arg1404His)2074ERCC6Uncertain significancers755854972RCV000299693|RCV000353273|RCV000397973; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105066713250667132CT10:g.50667132C>TClinGen:CA5495154
NM_000124.4(ERCC6):c.4186A>G (p.Arg1396Gly)2074ERCC6Uncertain significancers745352643RCV000170392|RCV000665525|RCV000763653; NMedGen:CN169374|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|7 conditions105066715750667157TC10:g.50667157T>CClinGen:CA199600
NM_000124.4(ERCC6):c.4177del (p.Lys1392_Met1393insTer)2074ERCC6Likely pathogenicrs1850531575RCV001089544; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105066716650667166ATA10:g.50667166_50667166del-
NM_000124.4(ERCC6):c.4114G>A (p.Gly1372Arg)2074ERCC6Benign/Likely benignrs4253227RCV000265741|RCV000323106|RCV000359172|RCV000872595; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN517202105066722950667229CT10:g.50667229C>TClinGen:CA5495173,UniProtKB:Q03468#VAR_016308
NM_000124.4(ERCC6):c.4067G>A (p.Gly1356Asp)2074ERCC6Uncertain significancers370285377RCV001104863|RCV001104861|RCV001104862; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105066727650667276CT10:g.50667276C>T-
NM_000124.4(ERCC6):c.4063-1G>C2074ERCC6Pathogenic/Likely pathogenicrs766980240RCV000664549|RCV000994388|RCV001528150; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MedGen:CN517202|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105066728150667281CG10:g.50667281C>G-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.4062+2T>A2074ERCC6Likely pathogenicrs1554873950RCV000672776; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105066841750668417AT10:g.50668417A>T-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.4041A>G (p.Thr1347=)2074ERCC6Uncertain significancers1379322521RCV001104864|RCV001104866|RCV001104865; NMONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105066844050668440TC10:g.50668440T>C-
NM_000124.4(ERCC6):c.4007del (p.Asn1336fs)2074ERCC6Pathogenicrs786205175RCV000170391; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105066847450668474ATA10:g.50668474_50668474delClinGen:CA274714C0751038 133540 Cockayne syndrome B;
NM_000124.4(ERCC6):c.3984-2A>G2074ERCC6Likely pathogenicrs1554873973RCV000670109; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105066849950668499TC10:g.50668499T>C-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.3983+4A>G2074ERCC6Uncertain significancers370938370RCV001106027|RCV001104867|RCV001106026; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761105066939450669394TC10:g.50669394T>C-
NM_000124.4(ERCC6):c.3965G>T (p.Gly1322Val)2074ERCC6Benignrs4253219RCV000269110|RCV000326545|RCV000361480|RCV000914526; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MedGen:CN517202105066941650669416CA10:g.50669416C>AClinGen:CA5495222,UniProtKB:Q03468#VAR_016307
NM_000124.4(ERCC6):c.3957del (p.Ile1320fs)2074ERCC6Likely pathogenicrs1554874073RCV000674136; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105066942450669424TCT10:g.50669424_50669424del-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.3952_3953del (p.Arg1318fs)2074ERCC6Pathogenic/Likely pathogenicrs765825423RCV000170390|RCV000666483|RCV001231998; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN517202105066942850669429CCTC10:g.50669428_50669429delClinGen:CA274713C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.3942G>A (p.Trp1314Ter)2074ERCC6Pathogenicrs1564725764RCV000735200; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105066943950669439CT10:g.50669439C>T-
NM_000124.4(ERCC6):c.3914_3925del (p.Leu1305_Ser1309delinsPro)2074ERCC6Uncertain significancers1554874085RCV000674820; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105066945650669467GACACTGCTCCCAG10:g.50669456_50669467del-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.3904C>T (p.Gln1302Ter)2074ERCC6Pathogenicrs786205174RCV000170389; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105066947750669477GA10:g.50669477G>AClinGen:CA274710C0751038 133540 Cockayne syndrome B;
NM_000124.4(ERCC6):c.3901C>T (p.Arg1301Cys)2074ERCC6Uncertain significancers367552064RCV001108246|RCV001108247|RCV001108248; NMONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105066948050669480GA10:g.50669480G>A-
NM_000124.4(ERCC6):c.3892A>G (p.Arg1298Gly)2074ERCC6Uncertain significancers139188695RCV001103051|RCV001103052|RCV001108249; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761105066948950669489TC10:g.50669489T>C-
NM_000124.4(ERCC6):c.3871dup (p.Gln1291fs)2074ERCC6Pathogenic/Likely pathogenicrs1386369933RCV000666791|RCV001386579; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MedGen:CN517202105066950950669510TTG10:g.50669509_50669510insG-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.3862C>T (p.Arg1288Ter)2074ERCC6Pathogenicrs185142838RCV000024284|RCV000622864|RCV000671085|RCV000733375|RCV000784896; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MeSH:D030342,MedGen:C0950123|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569|MedGe105066951950669519GA10:g.50669519G>AClinGen:CA129817,OMIM:609413.0015
NM_000124.4(ERCC6):c.3804C>T (p.His1268=)2074ERCC6Conflicting interpretations of pathogenicityrs116032070RCV000294639|RCV000351894|RCV000386805|RCV000873518; NMONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN517202105066957750669577GA10:g.50669577G>AClinGen:CA5495259
NM_000124.4(ERCC6):c.3778+1G>C2074ERCC6Likely pathogenicrs1554875114RCV000671515; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105067822750678227CG10:g.50678227C>G-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.3774A>G (p.Lys1258=)2074ERCC6Benign/Likely benignrs35756610RCV000279226|RCV000336851|RCV000403501|RCV000871714; NMONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MedGen:CN517202105067823250678232TC10:g.50678232T>CClinGen:CA5495279
NM_000124.4(ERCC6):c.3764T>C (p.Leu1255Pro)2074ERCC6Uncertain significancers1464826740RCV001104964|RCV001104963|RCV001104965; NMONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105067824250678242AG10:g.50678242A>G-
NM_000124.4(ERCC6):c.3757G>T (p.Glu1253Ter)2074ERCC6Likely pathogenicrs1850747928RCV001264262; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105067824950678249CA10:g.50678249C>A-
NM_000124.4(ERCC6):c.3655G>T (p.Gly1219Ter)2074ERCC6Likely pathogenicrs1850750513RCV001263687; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105067835150678351CA10:g.50678351C>A-
NM_000124.4(ERCC6):c.3650T>G (p.Phe1217Cys)2074ERCC6Conflicting interpretations of pathogenicityrs61760166RCV000307135|RCV000364264|RCV000397087|RCV000513602; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MedGen:CN517202105067835650678356AC10:g.50678356A>CClinGen:CA5495307CN239231 Cerebrooculofacioskeletal Syndrome;
NM_000124.4(ERCC6):c.3637A>T (p.Arg1213Ter)2074ERCC6Likely pathogenicrs2228527RCV001263688; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105067836950678369TA10:g.50678369T>A-
NM_000124.4(ERCC6):c.3636C>T (p.Cys1212=)2074ERCC6Uncertain significancers886047033RCV000275150|RCV000332519|RCV000389904|RCV000731860; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MedGen:CN517202105067837050678370GA10:g.50678370G>AClinGen:CA10628640
NM_000124.4(ERCC6):c.3634T>A (p.Cys1212Ser)2074ERCC6Uncertain significancers886042655RCV000260044|RCV000664624; NMedGen:CN517202|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569105067837250678372AT10:g.50678372A>TClinGen:CA10604527C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.3627dup (p.Lys1210Ter)2074ERCC6Pathogenic/Likely pathogenicrs1554875154RCV000670522|RCV001382561; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MedGen:CN517202105067837850678379TTA10:g.50678378_50678379insA-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.3614del (p.Lys1205fs)2074ERCC6Likely pathogenicrs1554875155RCV000674969; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105067839250678392CTC10:g.50678392_50678392del-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.3612_3613insT (p.Lys1205Ter)2074ERCC6Likely pathogenicrs786205173RCV000170388; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105067839350678394TTA10:g.50678393_50678394insAClinGen:CA274709
NM_000124.4(ERCC6):c.3607_3608insGGGCTGGCTGCTTAAGGTCCACCTTA (p.Lys1203fs)2074ERCC6Pathogenic/Likely pathogenicrs786205172RCV000170387|RCV000671320|RCV001092478; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN517202105067839850678399TTTAAGGTGGACCTTAAGCAGCCAGCCC10:g.50678398_50678399insTAAGGTGGACCTTAAGCAGCCAGCCCClinGen:CA274708C0751038 133540 Cockayne syndrome B;
NM_000124.4(ERCC6):c.3594A>G (p.Lys1198=)2074ERCC6Conflicting interpretations of pathogenicityrs374791168RCV000260366|RCV000317802|RCV000374778|RCV000979457; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MedGen:CN517202105067841250678412TC10:g.50678412T>CClinGen:CA5495318
NM_000124.4(ERCC6):c.3591_3592dup (p.Lys1198fs)2074ERCC6Pathogenic/Likely pathogenicrs1287286877RCV000674275|RCV001386142; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN517202105067841350678414TTTC10:g.50678413_50678414insTC-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.3573AGA[2] (p.Glu1194del)2074ERCC6Uncertain significancers1248870490RCV000669145; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105067842550678427CTCTC10:g.50678425_50678427del-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.3574G>T (p.Glu1192Ter)2074ERCC6Likely pathogenicrs1850753467RCV001263689; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105067843250678432CA10:g.50678432C>A-
NM_000124.4(ERCC6):c.3544A>T (p.Lys1182Ter)2074ERCC6Likely pathogenicrs1850754584RCV001263690; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105067846250678462TA10:g.50678462T>A-
NM_000124.4(ERCC6):c.3536del (p.Tyr1179fs)2074ERCC6Pathogenic/Likely pathogenicrs786205171RCV000170386|RCV000224382|RCV000666242; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN517202|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105067847050678470ATA10:g.50678470_50678470delClinGen:CA274707
NM_000124.4(ERCC6):c.3482G>C (p.Ser1161Thr)2074ERCC6Benign/Likely benignrs148636026RCV000282486|RCV000339799|RCV000378213|RCV000889649; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MedGen:CN517202105067852450678524CG10:g.50678524C>GClinGen:CA5495341
NM_000124.4(ERCC6):c.3481A>C (p.Ser1161Arg)2074ERCC6Benign/Likely benignrs142094044RCV000286114|RCV000342577|RCV000405490|RCV000889650; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MedGen:CN517202105067852550678525TG10:g.50678525T>GClinGen:CA5495342
NM_000124.4(ERCC6):c.3480C>G (p.Pro1160=)2074ERCC6Conflicting interpretations of pathogenicityrs886047034RCV000307447|RCV000345920|RCV000394239|RCV000667349; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201105067852650678526GC10:g.50678526G>CClinGen:CA10635415
NM_000124.4(ERCC6):c.3465C>A (p.Tyr1155Ter)2074ERCC6Likely pathogenicrs1286402535RCV001263691; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105067854150678541GT10:g.50678541G>T-
NM_000124.4(ERCC6):c.3456T>G (p.Gly1152=)2074ERCC6Benign/Likely benignrs148366188RCV000275930|RCV000311187|RCV000368077|RCV000871317; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MedGen:CN517202105067855050678550AC10:g.50678550A>CClinGen:CA5495348
NM_000124.4(ERCC6):c.3453A>G (p.Leu1151=)2074ERCC6Conflicting interpretations of pathogenicityrs771604820RCV000260758|RCV000314768|RCV000353181|RCV000671962; NMONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201105067855350678553TC10:g.50678553T>CClinGen:CA5495351
NM_000124.4(ERCC6):c.3448A>T (p.Lys1150Ter)2074ERCC6Likely pathogenicrs1850757159RCV001263692; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105067855850678558TA10:g.50678558T>A-
NM_000124.4(ERCC6):c.3435_3437dup (p.Ser1146_Ile1147insArg)2074ERCC6Uncertain significancers1435512927RCV000668999; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105067856850678569GGCTT10:g.50678568_50678569insCTT-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.3412dup (p.Thr1138fs)2074ERCC6Pathogenic/Likely pathogenicrs786205170RCV000170385|RCV000668548; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105067859350678594GGT10:g.50678593_50678594insTClinGen:CA274706C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.3391A>G (p.Asn1131Asp)2074ERCC6Conflicting interpretations of pathogenicityrs147079519RCV000264621|RCV000318342|RCV000375317|RCV000994389; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN517202105067861550678615TC10:g.50678615T>CClinGen:CA5495358CN239231 Cerebrooculofacioskeletal Syndrome;
NM_000124.4(ERCC6):c.3355G>T (p.Glu1119Ter)2074ERCC6Likely pathogenicrs1850759141RCV001263693; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105067865150678651CA10:g.50678651C>A-
NM_000124.4(ERCC6):c.3284C>G (p.Pro1095Arg)2074ERCC6Conflicting interpretations of pathogenicityrs4253208RCV000001776|RCV000170384|RCV000291488|RCV000345279|RCV000224059|RCV000988354; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN169374|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MedGen:CN517202|MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569105067872250678722GC10:g.50678722G>CClinGen:CA199597,UniProtKB:Q03468#VAR_001222,OMIM:609413.0008CN239231 Cerebrooculofacioskeletal Syndrome;
NM_000124.4(ERCC6):c.3191A>G (p.Asn1064Ser)2074ERCC6Uncertain significancers200093886RCV000313595|RCV000348563|RCV000403215; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761105067881550678815TC10:g.50678815T>CClinGen:CA5495391
NM_000124.4(ERCC6):c.3177T>C (p.Ser1059=)2074ERCC6Benign/Likely benignrs4253207RCV000170383|RCV000262811|RCV000301771|RCV000355263|RCV000872057; NMedGen:CN169374|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MedGen:CN517202105067882950678829AG10:g.50678829A>GClinGen:CA199594CN239231 Cerebrooculofacioskeletal Syndrome;
NM_000124.4(ERCC6):c.3123A>G (p.Gln1041=)2074ERCC6Conflicting interpretations of pathogenicityrs563142074RCV001103248|RCV001105166|RCV001105167|RCV001395466; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MedGen:CN517202105067888350678883TC10:g.50678883T>C-
NM_000124.4(ERCC6):c.3111AAG[1] (p.Arg1039del)2074ERCC6Uncertain significancers1342267719RCV000672557; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105067889050678892CCTTC10:g.50678890_50678892del-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.3113_3114del (p.Arg1038fs)2074ERCC6Likely pathogenicrs1850765501RCV001030756; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105067889250678893TTCT10:g.50678892_50678893del-
NM_000124.4(ERCC6):c.3097A>T (p.Lys1033Ter)2074ERCC6Likely pathogenicrs1850766086RCV001263694; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105067890950678909TA10:g.50678909T>A-
NM_000124.4(ERCC6):c.3071-1G>A2074ERCC6Likely pathogenicrs1554875287RCV000666961; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105067893650678936CT10:g.50678936C>T-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.3070G>T (p.Gly1024Ter)2074ERCC6Likely pathogenicrs1850769140RCV001263767; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105067902150679021CA10:g.50679021C>A-
NM_000124.4(ERCC6):c.3061A>G (p.Ile1021Val)2074ERCC6Conflicting interpretations of pathogenicityrs41562713RCV000175123|RCV000270778|RCV000328199|RCV000363004; NMedGen:CN517202|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105067903050679030TC10:g.50679030T>CClinGen:CA240809CN239231 Cerebrooculofacioskeletal Syndrome;
NM_000124.4(ERCC6):c.3010C>T (p.Leu1004=)2074ERCC6Benignrs2274097RCV000175124|RCV000331418|RCV000292842|RCV000385102|RCV001519684; NMedGen:CN169374|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN517202105067908150679081GA10:g.50679081G>AClinGen:CA201306CN239231 Cerebrooculofacioskeletal Syndrome;
NM_000124.4(ERCC6):c.3007G>T (p.Glu1003Ter)2074ERCC6Likely pathogenicrs1850770605RCV001263768; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105067908450679084CA10:g.50679084C>A-
NM_000124.4(ERCC6):c.2996A>G (p.Asn999Ser)2074ERCC6Uncertain significancers760694729RCV000296287|RCV000335362|RCV000388236; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761105067909550679095TC10:g.50679095T>CClinGen:CA5495454
NM_000124.4(ERCC6):c.2989A>G (p.Lys997Glu)2074ERCC6Uncertain significancers375181157RCV000281519|RCV000338857|RCV000403327; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761105067910250679102TC10:g.50679102T>CClinGen:CA5495457
NM_000124.4(ERCC6):c.2974C>G (p.Gln992Glu)2074ERCC6Uncertain significancers772104945RCV000303633|RCV000360779|RCV000402532|RCV000666981; NMONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201105067911750679117GC10:g.50679117G>CClinGen:CA5495459
NM_000124.4(ERCC6):c.2925-8T>A2074ERCC6Conflicting interpretations of pathogenicityrs147637331RCV000902364|RCV001103341|RCV001108519|RCV001103342; NMedGen:CN517202|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105067917450679174AT10:g.50679174A>T-
NM_000124.4(ERCC6):c.2923C>T (p.Arg975Ter)2074ERCC6Pathogenicrs772801089RCV000502392|RCV001246953; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN517202105068042350680423GA10:g.50680423G>AClinGen:CA5495484
NM_000124.4(ERCC6):c.2905G>A (p.Glu969Lys)2074ERCC6Uncertain significancers886047035RCV000272205|RCV000329619|RCV000368132; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105068044150680441CT10:g.50680441C>TClinGen:CA10628651
NM_000124.4(ERCC6):c.2875G>T (p.Val959Leu)2074ERCC6Benign/Likely benignrs190863815RCV000514529|RCV001105259|RCV001105258|RCV001105260; NMedGen:CN517202|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105068047150680471CA10:g.50680471C>AClinGen:CA5495497CN517202 not provided;
NM_000124.4(ERCC6):c.2846G>A (p.Trp949Ter)2074ERCC6Likely pathogenicrs1850797541RCV001263769; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105068050050680500CT10:g.50680500C>T-
NM_000124.4(ERCC6):c.2839C>T (p.Arg947Ter)2074ERCC6Pathogenic/Likely pathogenicrs906755254RCV000592438|RCV000674384; NMedGen:CN517202|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569105068050750680507GA10:g.50680507G>AClinGen:CA206586242C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.2830-2A>G2074ERCC6Pathogenicrs373227647RCV000170381|RCV000397640|RCV000762809|RCV000984002; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN517202|7 conditions|MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569105068051850680518TC10:g.50680518T>CClinGen:CA274705C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.2829+11A>T2074ERCC6Uncertain significancers777251839RCV000275855|RCV000333330|RCV000371658; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105068094450680944TA10:g.50680944T>AClinGen:CA5495523
NM_000124.4(ERCC6):c.2829+1G>A2074ERCC6Likely pathogenicrs1554875522RCV000669221; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105068095450680954CT10:g.50680954C>T-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.2825C>T (p.Thr942Met)2074ERCC6Benignrs2228525RCV000250626|RCV000279516|RCV000318258|RCV000375239|RCV000871431; NMedGen:CN169374|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MedGen:CN517202105068095950680959GA10:g.50680959G>AClinGen:CA5495526,UniProtKB:Q03468#VAR_016303
NM_000124.4(ERCC6):c.2807G>A (p.Trp936Ter)2074ERCC6Likely pathogenicrs1283213117RCV001263770; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105068097750680977CT10:g.50680977C>T-
NM_000124.4(ERCC6):c.2776G>C (p.Ala926Pro)2074ERCC6Uncertain significancers765252538RCV001106388|RCV001106389|RCV001106390; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761105068100850681008CG10:g.50681008C>G-
NM_000124.4(ERCC6):c.2741C>T (p.Thr914Met)2074ERCC6Conflicting interpretations of pathogenicityrs142580756RCV000288031|RCV000343009|RCV000404286|RCV001287598; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MedGen:CN235283105068104350681043GA10:g.50681043G>AClinGen:CA5495546
NM_000124.4(ERCC6):c.2696C>T (p.Thr899Met)2074ERCC6Uncertain significancers374470147RCV000259702|RCV000299513|RCV000354408|RCV000671017; NMONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201105068153650681536GA10:g.50681536G>AClinGen:CA5495581
NM_000124.4(ERCC6):c.2645A>G (p.Tyr882Cys)2074ERCC6Uncertain significancers116431130RCV000274635|RCV000314874|RCV000369202; NMONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105068158750681587TC10:g.50681587T>CClinGen:CA5495592CN239231 Cerebrooculofacioskeletal Syndrome;
NM_000124.4(ERCC6):c.2599-26A>G2074ERCC6Conflicting interpretations of pathogenicityrs4253196RCV000170380|RCV000666576|RCV001236817; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN517202105068165950681659TC10:g.50681659T>CClinGen:CA274704
NM_000124.4(ERCC6):c.2598+7G>A2074ERCC6Conflicting interpretations of pathogenicityrs769421755RCV000271217|RCV000329615|RCV000384197|RCV001460607; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MedGen:CN517202105068206650682066CT10:g.50682066C>TClinGen:CA5495616CN239231 Cerebrooculofacioskeletal Syndrome;
NM_000124.4(ERCC6):c.2569C>T (p.Arg857Ter)2074ERCC6Pathogenicrs751448793RCV000668815|RCV001057555; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MedGen:CN517202105068210250682102GA10:g.50682102G>A-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.2566C>T (p.Gln856Ter)2074ERCC6Likely pathogenicrs1850831525RCV001263771; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105068210550682105GA10:g.50682105G>A-
NM_000124.4(ERCC6):c.2560C>T (p.Gln854Ter)2074ERCC6Pathogenicrs1554787509RCV000673909; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105068211150682111GA10:g.50682111G>A-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.2551T>C (p.Trp851Arg)2074ERCC6Conflicting interpretations of pathogenicityrs368728467RCV000195010|RCV000675120|RCV001063571; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN517202105068212050682120AG10:g.50682120A>GClinGen:CA277416,UniProtKB:Q03468#VAR_001219C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.2551T>A (p.Trp851Arg)2074ERCC6Pathogenicrs368728467RCV000625851; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105068212050682120AT10:g.50682120A>TClinGen:CA376721328C0751038 133540 Cockayne syndrome B;
NM_000124.4(ERCC6):c.2543T>A (p.Leu848Ter)2074ERCC6Likely pathogenicrs1850832063RCV001263772; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105068212850682128AT10:g.50682128A>T-
NM_000124.4(ERCC6):c.2504G>A (p.Trp835Ter)2074ERCC6Likely pathogenicrs1850832795RCV001263773; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105068216750682167CT10:g.50682167C>T-
NM_000124.4(ERCC6):c.2403C>T (p.Ala801=)2074ERCC6Benign/Likely benignrs114896216RCV000174447|RCV000282350|RCV000340937|RCV000376963|RCV000872366; NMedGen:CN169374|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN517202105068226850682268GA10:g.50682268G>AClinGen:CA200995CN239231 Cerebrooculofacioskeletal Syndrome;
NM_000124.4(ERCC6):c.2397T>C (p.Leu799=)2074ERCC6Conflicting interpretations of pathogenicityrs200079929RCV000297552|RCV000337332|RCV000406159|RCV000941084; NMONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MedGen:CN517202105068227450682274AG10:g.50682274A>GClinGen:CA5495649
NM_000124.4(ERCC6):c.2391C>T (p.Ser797=)2074ERCC6Conflicting interpretations of pathogenicityrs142641602RCV000313173|RCV000352304|RCV000405332|RCV000732170|RCV000877017; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN169374|MedGen:CN517202105068228050682280GA10:g.50682280G>AClinGen:CA5495652
NM_000124.4(ERCC6):c.2390C>G (p.Ser797Cys)2074ERCC6Conflicting interpretations of pathogenicityrs146043988RCV000273288|RCV000309721|RCV000367782|RCV001546942; NMONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MedGen:CN517202105068228150682281GC10:g.50682281G>CClinGen:CA5495653
NM_000124.4(ERCC6):c.2383-1G>A2074ERCC6Likely pathogenicrs1554787554RCV000674266; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105068228950682289CT10:g.50682289C>T-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.2382+33T>C2074ERCC6Benign-1RCV001613875|RCV001658322|RCV001658321|RCV001658319|RCV001658320; NMedGen:CN517202|MONDO:MONDO:0010909,MedGen:C3551173,OMIM:600630, Orphanet:178338|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569105068422850684228AG50684228-
NM_000124.4(ERCC6):c.2380C>T (p.Gln794Ter)2074ERCC6Likely pathogenicrs1850874595RCV001263774; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105068426350684263GA10:g.50684263G>A-
NM_000124.4(ERCC6):c.2365C>G (p.Leu789Val)2074ERCC6Uncertain significancers139913322RCV000269783|RCV000324861|RCV000364143; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105068427850684278GC10:g.50684278G>CClinGen:CA5495685
NM_000124.4(ERCC6):c.2337C>T (p.Phe779=)2074ERCC6Conflicting interpretations of pathogenicityrs114490473RCV000265214|RCV000320356|RCV000379370|RCV000871449; NMONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN517202105068430650684306GA10:g.50684306G>AClinGen:CA5495691
NM_000124.4(ERCC6):c.2287-2A>G2074ERCC6Likely pathogenicrs754978734RCV000666417; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105068435850684358TC10:g.50684358T>C-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.2287-3T>C2074ERCC6Uncertain significancers780652533RCV000280458|RCV000335612|RCV000374887; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105068435950684359AG10:g.50684359A>GClinGen:CA5495698
NM_000124.4(ERCC6):c.2287-4G>A2074ERCC6Conflicting interpretations of pathogenicityrs375617750RCV000295862|RCV000350825|RCV000371562|RCV000729619; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN517202105068436050684360CT10:g.50684360C>TClinGen:CA5495699
NM_000124.4(ERCC6):c.2287-5C>T2074ERCC6Conflicting interpretations of pathogenicityrs772880581RCV000311710|RCV000347841|RCV000405537|RCV001400321; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MedGen:CN517202105068436150684361GA10:g.50684361G>AClinGen:CA5495701
NM_000124.4(ERCC6):c.2286+1G>A2074ERCC6Likely pathogenicrs1362935450RCV000665459; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105068639950686399CT10:g.50686399C>T-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.2204G>T (p.Arg735Leu)2074ERCC6Uncertain significancers201930958RCV001105445|RCV001105446|RCV001105447; NMONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105068648250686482CA10:g.50686482C>A-
NM_000124.4(ERCC6):c.2203C>T (p.Arg735Ter)2074ERCC6Pathogenicrs121917901RCV000001770|RCV000001769|RCV000406377|RCV000521977|RCV000762810|RCV001199022|RCV001287467; NMONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN239385|MedGen:CN517202|7 conditions|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MedGen:CN235283105068648350686483GA10:g.50686483G>AClinGen:CA115152,OMIM:609413.0002C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.2201T>G (p.Leu734Ter)2074ERCC6Likely pathogenicrs1850916835RCV001264144; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105068648550686485AC10:g.50686485A>C-
NM_000124.4(ERCC6):c.2169+1G>A2074ERCC6Likely pathogenicrs1441655600RCV000670497; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105069073250690732CT10:g.50690732C>T-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.2167C>T (p.Gln723Ter)2074ERCC6Pathogenicrs151242354RCV000170378|RCV000256036|RCV000778283|RCV000983999; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN517202|MedGen:CN239385|MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569105069073550690735GA10:g.50690735G>AClinGen:CA274701C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.2125G>A (p.Val709Ile)2074ERCC6Uncertain significancers369437807RCV000308072|RCV000362821|RCV000395741; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105069077750690777CT10:g.50690777C>TClinGen:CA5495764
NM_000124.4(ERCC6):c.2096dup (p.Leu700fs)2074ERCC6Pathogenic/Likely pathogenicrs774791374RCV000170377|RCV000668158|RCV001046396; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN517202105069080550690806CCG10:g.50690805_50690806insGClinGen:CA274700
NM_000124.4(ERCC6):c.2081C>T (p.Pro694Leu)2074ERCC6Uncertain significancers114852424RCV001106591|RCV001106592|RCV001106593|RCV001759875; NMONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MedGen:CN517202105069082150690821GA10:g.50690821G>A-
NM_000124.4(ERCC6):c.2073_2074insCCGCTCTTTGACTTC (p.Ile692_Phe693insProLeuPheAspPhe)2074ERCC6Uncertain significancers1554788383RCV000674068; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105069082850690829TTGAAGTCAAAGAGCGG10:g.50690828_50690829insGAAGTCAAAGAGCGG-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.2060C>T (p.Ser687Leu)2074ERCC6Uncertain significancers1026438103RCV000667893|RCV001255758; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105069084250690842GA10:g.50690842G>A-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.2058G>A (p.Trp686Ter)2074ERCC6Pathogenicrs751292948RCV000500198; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105069084450690844CT10:g.50690844C>TClinGen:CA376724364
NM_000124.4(ERCC6):c.2048G>A (p.Arg683Gln)2074ERCC6Uncertain significancers148845653RCV000173643|RCV000259781|RCV000318448|RCV000354594; NMedGen:CN517202|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761105069085450690854CT10:g.50690854C>TClinGen:CA239092CN239231 Cerebrooculofacioskeletal Syndrome;
NM_000124.4(ERCC6):c.2038A>G (p.Asn680Asp)2074ERCC6Uncertain significancers1554788393RCV000664690; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105069086450690864TC10:g.50690864T>C-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.2022T>A (p.Ser674=)2074ERCC6Conflicting interpretations of pathogenicityrs544471829RCV000293810|RCV000329682|RCV000388093|RCV001490935; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MedGen:CN517202105069088050690880AT10:g.50690880A>TClinGen:CA5495783
NM_000124.4(ERCC6):c.2008C>T (p.Arg670Trp)2074ERCC6Pathogenicrs202080674RCV000170376|RCV000624050; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MeSH:D030342,MedGen:C0950123105069089450690894GA10:g.50690894G>AClinGen:CA274698,UniProtKB:Q03468#VAR_001218C0751038 133540 Cockayne syndrome B;
NM_000124.4(ERCC6):c.1999del (p.Thr667fs)2074ERCC6Pathogenicrs786205169RCV000170375; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105069090350690903GTG10:g.50690903_50690903delClinGen:CA274697C0751038 133540 Cockayne syndrome B;
NM_000124.4(ERCC6):c.1993-12T>C2074ERCC6Uncertain significancers751115103RCV001103605|RCV001103604|RCV001108765; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761105069092150690921AG10:g.50690921A>G-
NM_000124.4(ERCC6):c.1992+32A>G2074ERCC6Benignrs4253162RCV000250945|RCV001658155|RCV001658154|RCV001658157|RCV001658156; NMedGen:CN169374|MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0010909,MedGen:C3551173,OMIM:600630, Orphanet:178338|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105069136050691360TC10:g.50691360T>CClinGen:CA5495806CN169374 not specified;
NM_000124.4(ERCC6):c.1992+7C>T2074ERCC6Conflicting interpretations of pathogenicityrs373710355RCV000286446|RCV000341501|RCV000407921|RCV000877297; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MedGen:CN517202105069138550691385GA10:g.50691385G>AClinGen:CA5495811
NM_000124.4(ERCC6):c.1954C>T (p.Arg652Ter)2074ERCC6Pathogenic/Likely pathogenicrs767247987RCV000170373|RCV000667169|RCV001227175; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN517202105069143050691430GA10:g.50691430G>AClinGen:CA274694C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.1919G>A (p.Trp640Ter)2074ERCC6Pathogenicrs1851015811RCV001063173|RCV001264145; NMedGen:CN517202|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105069146550691465CT10:g.50691465C>T-
NM_000124.4(ERCC6):c.1850dup (p.Cys617fs)2074ERCC6Pathogenicrs786205167RCV000170366; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105069153350691534AAC10:g.50691533_50691534insCClinGen:CA274691C0751038 133540 Cockayne syndrome B;
NM_000124.4(ERCC6):c.1835G>A (p.Arg612Gln)2074ERCC6Uncertain significancers201894064RCV000170372|RCV000668823; NMedGen:CN169374|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105069154950691549CT10:g.50691549C>TClinGen:CA199582
NM_000124.4(ERCC6):c.1821+1G>A2074ERCC6Likely pathogenicrs1228919836RCV000671000|RCV001061869; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MedGen:CN517202105070116250701162CT10:g.50701162C>T-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.1821delinsAA (p.Glu608fs)2074ERCC6Likely pathogenicrs1554789393RCV000673910; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105070116350701163CTT10:g.50701163_50701164insT-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.1820A>G (p.Lys607Arg)2074ERCC6Conflicting interpretations of pathogenicityrs200832611RCV000522199|RCV001106688|RCV001106689|RCV001106690; NMedGen:CN517202|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105070116450701164TC10:g.50701164T>CClinGen:CA5495858
NM_000124.4(ERCC6):c.1816A>T (p.Lys606Ter)2074ERCC6Likely pathogenicrs961060711RCV001264146; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105070116850701168TA10:g.50701168T>A-
NM_000124.4(ERCC6):c.1777A>T (p.Arg593Ter)2074ERCC6Likely pathogenicrs768188064RCV001264147; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105070120750701207TA10:g.50701207T>A-
NM_000124.4(ERCC6):c.1761G>T (p.Thr587=)2074ERCC6Conflicting interpretations of pathogenicityrs144608959RCV000298809|RCV000353565|RCV000405509|RCV000905410; NMONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MedGen:CN517202105070122350701223CA10:g.50701223C>AClinGen:CA5495876
NM_000124.4(ERCC6):c.1760C>T (p.Thr587Met)2074ERCC6Conflicting interpretations of pathogenicityrs767709344RCV000277469|RCV000332639|RCV000368604|RCV000944209; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN517202105070122450701224GA10:g.50701224G>AClinGen:CA5495877
NM_000124.4(ERCC6):c.1686-12G>A2074ERCC6Uncertain significancers774930802RCV001108854|RCV001108855|RCV001108856; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761105070131050701310CT10:g.50701310C>T-
NM_000124.4(ERCC6):c.1681T>G (p.Tyr561Asp)2074ERCC6Uncertain significancers1564430115RCV000714664|RCV000714665; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105070858850708588AC10:g.50708588A>C-
NM_000124.4(ERCC6):c.1659G>T (p.Lys553Asn)2074ERCC6Uncertain significancers116373975RCV000170369|RCV000274383|RCV000329433|RCV000384088|RCV000515209|RCV000723972; NMedGen:CN169374|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|7 conditions|MedGen:CN517202105070861050708610CA10:g.50708610C>AClinGen:CA199578C3151063 613761 Age-related macular degeneration 5;
NM_000124.4(ERCC6):c.1595A>G (p.Asp532Gly)2074ERCC6Uncertain significancers752712823RCV000670772; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105070867450708674TC10:g.50708674T>C-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.1550G>A (p.Trp517Ter)2074ERCC6Pathogenicrs121917900RCV000001768; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105070871950708719CT10:g.50708719C>TClinGen:CA251917,OMIM:609413.0001C0751038 133540 Cockayne syndrome B;
NM_000124.4(ERCC6):c.1527-2A>G2074ERCC6Likely pathogenicrs768608345RCV000674964; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105070874450708744TC10:g.50708744T>C-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.1526+1G>T2074ERCC6Pathogenic/Likely pathogenicrs371739894RCV000170365|RCV000723622|RCV000983983|RCV001280930; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN517202|MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569|MONDO:MONDO:0016006,MedGen:C0009207, Orphanet:191105071392950713929CA10:g.50713929C>AClinGen:CA274690C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.1518del (p.Lys506fs)2074ERCC6Pathogenic/Likely pathogenicrs786205168RCV000170368; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105071393850713938GCG10:g.50713938_50713938delClinGen:CA274692,OMIM:609413.0003C0751038 133540 Cockayne syndrome B;
NM_000124.4(ERCC6):c.1516A>T (p.Lys506Ter)2074ERCC6Likely pathogenicrs1851434105RCV001264148; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105071394050713940TA10:g.50713940T>A-
NM_000124.4(ERCC6):c.1482C>T (p.Asp494=)2074ERCC6Conflicting interpretations of pathogenicityrs150762517RCV000289491|RCV000326056|RCV000380599|RCV000667559|RCV001470692; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201105071397450713974GA10:g.50713974G>AClinGen:CA5495960
NM_000124.4(ERCC6):c.1436G>A (p.Arg479His)2074ERCC6Uncertain significancers139161933RCV000286147|RCV000341135|RCV000392882|RCV001508658; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN517202105071402050714020CT10:g.50714020C>TClinGen:CA5495971
NM_000124.4(ERCC6):c.1435C>T (p.Arg479Cys)2074ERCC6Conflicting interpretations of pathogenicityrs61749175RCV000280376|RCV000335550|RCV000402785; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105071402150714021GA10:g.50714021G>AClinGen:CA5495972
NM_000124.4(ERCC6):c.1398-2A>G2074ERCC6Likely pathogenicrs1317145066RCV000670670|RCV001035343; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MedGen:CN517202105071406050714060TC10:g.50714060T>C-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.1397+1G>C2074ERCC6Likely pathogenicrs1554793174RCV000665527|RCV001266078; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MeSH:D030342,MedGen:C0950123105073207850732078CG10:g.50732078C>G-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.1390C>T (p.Arg464Trp)2074ERCC6Uncertain significancers375995821RCV000730622|RCV001105651|RCV001105652|RCV001105653; NMedGen:CN517202|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105073208650732086GA10:g.50732086G>A-
NM_000124.4(ERCC6):c.1379A>C (p.Tyr460Ser)2074ERCC6Uncertain significancers140135643RCV001105654|RCV001105655|RCV001105656; NMONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105073209750732097TG10:g.50732097T>G-
NM_000124.4(ERCC6):c.1357C>T (p.Arg453Ter)2074ERCC6Pathogenicrs121917902RCV000001772|RCV000669858|RCV000763212|RCV001384070; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569|7 conditions|MedGen:C105073211950732119GA10:g.50732119G>AClinGen:CA251920,OMIM:609413.0004C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.1322_1324del (p.Glu441del)2074ERCC6Uncertain significancers769020754RCV000672827; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105073215250732154CCTTC10:g.50732152_50732154del-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.1319_1321del (p.Gly440del)2074ERCC6Uncertain significancers779180885RCV000672534; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105073215550732157TCTCT10:g.50732155_50732157del-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.1281C>T (p.Phe427=)2074ERCC6Likely benignrs267602508RCV000666439; NMONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105073219550732195GA10:g.50732195G>A-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.1280dup (p.Ser429fs)2074ERCC6Pathogenicrs786205166RCV000170364; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105073219550732196GGA10:g.50732195_50732196insAClinGen:CA274689
NM_000124.4(ERCC6):c.1280T>C (p.Phe427Ser)2074ERCC6Uncertain significancers886047038RCV000273044|RCV000306991|RCV000365275|RCV000664610; NMONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201105073219650732196AG10:g.50732196A>GClinGen:CA10628663
NM_000124.4(ERCC6):c.1274A>C (p.Asp425Ala)2074ERCC6Conflicting interpretations of pathogenicityrs4253046RCV000266947|RCV000324334|RCV000364031|RCV000733377; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MedGen:CN517202105073220250732202TG10:g.50732202T>GClinGen:CA5496358,UniProtKB:Q03468#VAR_016301
NM_000124.4(ERCC6):c.1237C>T (p.Arg413Trp)2074ERCC6Uncertain significancers374490261RCV001107417|RCV001107418|RCV001107419; NMONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105073223950732239GA10:g.50732239G>A-
NM_000124.4(ERCC6):c.1229G>A (p.Gly410Asp)2074ERCC6Conflicting interpretations of pathogenicityrs138865542RCV000265852|RCV000318351|RCV000376746|RCV000943556; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MedGen:CN517202105073224750732247CT10:g.50732247C>TClinGen:CA5496364
NM_000124.4(ERCC6):c.1211_1212insTCA (p.Lys405_Pro406insGln)2074ERCC6Uncertain significancers772545860RCV000674239; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105073226450732265CCTGA10:g.50732264_50732265insTGA-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.1159G>A (p.Glu387Lys)2074ERCC6Conflicting interpretations of pathogenicityrs148295935RCV000296235|RCV000348685|RCV000388161|RCV000923032; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MedGen:CN517202105073231750732317CT10:g.50732317C>TClinGen:CA5496377
NM_000124.4(ERCC6):c.1158C>T (p.Asp386=)2074ERCC6Conflicting interpretations of pathogenicityrs141391984RCV000308605|RCV000347073|RCV000407268|RCV000928375; NMONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN517202105073231850732318GA10:g.50732318G>AClinGen:CA5496379
NM_000124.4(ERCC6):c.1158C>A (p.Asp386Glu)2074ERCC6Uncertain significancers141391984RCV000267854|RCV000301875|RCV000358992; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105073231850732318GT10:g.50732318G>TClinGen:CA10631775
NM_000124.4(ERCC6):c.1158C>G (p.Asp386Glu)2074ERCC6Conflicting interpretations of pathogenicityrs141391984RCV000307520|RCV000359960|RCV000406265|RCV000871745|RCV000731973; NMONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN517202|MedGen:CN169374105073231850732318GC10:g.50732318G>CClinGen:CA5496378
NM_000124.4(ERCC6):c.1137GGAGGAAGA[1] (p.Glu382_Glu384del)2074ERCC6Uncertain significancers1284316063RCV000596097|RCV000668240; NMedGen:CN517202|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569105073232250732330ATCTTCCTCCA10:g.50732322_50732330delClinGen:CA593780523C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.1146G>A (p.Glu382=)2074ERCC6Benign/Likely benignrs4253045RCV000263560|RCV000316464|RCV000373317|RCV000871011; NMONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN517202105073233050732330CT10:g.50732330C>TClinGen:CA5496383
NM_000124.4(ERCC6):c.1134GGA[6] (p.Glu382_Glu384dup)2074ERCC6Uncertain significancers1554793268RCV000668743; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105073233350732334TTTCCTCCTCC10:g.50732333_50732334insTCCTCCTCC-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.1135G>T (p.Glu379Ter)2074ERCC6Pathogenic/Likely pathogenicrs1554793270RCV000670903|RCV001203195; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MedGen:CN517202105073234150732341CA10:g.50732341C>A-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.1062T>C (p.Pro354=)2074ERCC6Conflicting interpretations of pathogenicityrs764159237RCV000276506|RCV000333763|RCV000385877|RCV000668822|RCV000905618; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201105073241450732414AG10:g.50732414A>GClinGen:CA5496396
NM_000124.4(ERCC6):c.1062T>A (p.Pro354=)2074ERCC6Likely benignrs764159237RCV000667537; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105073241450732414AT10:g.50732414A>T-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.1034_1035insT (p.Lys345fs)2074ERCC6Pathogenicrs1590474873RCV000001780; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105073244150732442TTA10:g.50732441_50732442insAOMIM:609413.0011C0751038 133540 Cockayne syndrome B;
NM_000124.4(ERCC6):c.1009A>T (p.Lys337Ter)2074ERCC6Pathogenic/Likely pathogenicrs1198241866RCV000665546|RCV000809201|RCV001449817; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MedGen:CN517202|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105073246750732467TA10:g.50732467T>A-
NM_000124.4(ERCC6):c.972dup (p.Glu325fs)2074ERCC6Pathogenicrs387906262RCV000001773; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105073250350732504CCT10:g.50732503_50732504insTClinGen:CA251923,OMIM:609413.0005C0751038 133540 Cockayne syndrome B;
NM_000124.4(ERCC6):c.958G>C (p.Val320Leu)2074ERCC6Uncertain significancers1218964618RCV001107526|RCV001107527|RCV001107528; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105073251850732518CG10:g.50732518C>G-
NM_000124.4(ERCC6):c.906_923del (p.Thr303_Val308del)2074ERCC6Uncertain significancers765040780RCV000664827; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105073255350732570CACTGGGGCTGGAGGCGTGC10:g.50732553_50732570del-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.901C>T (p.Pro301Ser)2074ERCC6Uncertain significancers766256094RCV000293985|RCV000346592|RCV000385141; NMONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105073257550732575GA10:g.50732575G>AClinGen:CA5496417
NM_000124.4(ERCC6):c.858G>C (p.Lys286Asn)2074ERCC6Conflicting interpretations of pathogenicityrs143260457RCV000288378|RCV000345666|RCV000408050|RCV000983817; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MedGen:CN517202105073261850732618CG10:g.50732618C>GClinGen:CA5496425
NM_000124.4(ERCC6):c.850_851insT (p.Glu284fs)2074ERCC6Pathogenicrs797045562RCV000194098; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105073262550732626TTA10:g.50732625_50732626insAClinGen:CA277259
NM_000124.4(ERCC6):c.814G>A (p.Glu272Lys)2074ERCC6Uncertain significancers768589918RCV001103907|RCV001103908|RCV001103909|RCV001664689; NMONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN258378, Orphanet:485382105073266250732662CT10:g.50732662C>T-
NM_000124.4(ERCC6):c.779_780dup (p.Arg261fs)2074ERCC6Likely pathogenicrs1254008304RCV000664845; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105073269550732696TTGG10:g.50732695_50732696insGG-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.670C>T (p.Leu224Phe)2074ERCC6Conflicting interpretations of pathogenicityrs150935953RCV000170393|RCV000287342|RCV000340086|RCV000404438|RCV000726037; NMedGen:CN169374|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN517202105073280650732806GA10:g.50732806G>AClinGen:CA199603CN239231 Cerebrooculofacioskeletal Syndrome;
NM_000124.4(ERCC6):c.652G>A (p.Glu218Lys)2074ERCC6Uncertain significance-1RCV001728131; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105073646350736463CT50736463-
NM_000124.4(ERCC6):c.643G>T (p.Glu215Ter)2074ERCC6Pathogenic/Likely pathogenicrs875989810RCV000211122|RCV000674902|RCV001061726; NMONDO:MONDO:0014843,MedGen:C4310783,OMIM:616946|MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN517202105073647250736472CA10:g.50736472C>AClinGen:CA10576142,OMIM:609413.0017C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.595C>G (p.Leu199Val)2074ERCC6Uncertain significancers886047039RCV000300289|RCV000356401|RCV000406450|RCV000669790; NMONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201105073652050736520GC10:g.50736520G>CClinGen:CA10635431
NM_000124.4(ERCC6):c.574C>T (p.Gln192Ter)2074ERCC6Likely pathogenicrs1837393519RCV001264149; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105073654150736541GA10:g.50736541G>A-
NM_000124.4(ERCC6):c.544-2A>G2074ERCC6Likely pathogenicrs1554794073RCV000669337; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105073657350736573TC10:g.50736573T>C-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.543+4del2074ERCC6Pathogenicrs527236039RCV000132720|RCV001244262; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN517202105073876250738762ATA10:g.50738762_50738762delClinGen:CA270164C0751038 133540 Cockayne syndrome B;
NM_000124.4(ERCC6):c.543+1G>T2074ERCC6Likely pathogenicrs1837448977RCV001251189; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105073876550738765CA10:g.50738765C>A-
NM_000124.4(ERCC6):c.526C>T (p.Arg176Ter)2074ERCC6Pathogenic/Likely pathogenicrs771781694RCV000666614|RCV001731863; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MedGen:CN517202105073878350738783GA10:g.50738783G>A-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.466C>T (p.Gln156Ter)2074ERCC6Pathogenicrs751838040RCV000193828|RCV000224212|RCV000984001; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN517202|MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569105073884350738843GA10:g.50738843G>AClinGen:CA277210C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.439del (p.Ser146_Leu147insTer)2074ERCC6Likely pathogenicrs1554794360RCV000672864; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105073887050738870AGA10:g.50738870_50738870del-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.431C>T (p.Thr144Met)2074ERCC6Conflicting interpretations of pathogenicityrs149382642RCV001106963|RCV001106964|RCV001106962; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105073887850738878GA10:g.50738878G>A-
NM_000124.4(ERCC6):c.423-7T>C2074ERCC6Conflicting interpretations of pathogenicityrs1837452924RCV001106965|RCV001106966|RCV001106967|RCV001479735; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MedGen:CN517202105073889350738893AG10:g.50738893A>G-
NM_000124.4(ERCC6):c.423-9A>C2074ERCC6Conflicting interpretations of pathogenicityrs775274710RCV001106968|RCV001107626|RCV001107627|RCV001425763; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MedGen:CN517202105073889550738895TG10:g.50738895T>G-
NM_000124.4(ERCC6):c.422+1G>A2074ERCC6Likely pathogenicrs1198472093RCV000665499|RCV001376925; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MedGen:CN517202105074058850740588CT10:g.50740588C>T-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.422+1G>C2074ERCC6Likely pathogenicrs1198472093RCV000672335|RCV001238124; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN517202105074058850740588CG10:g.50740588C>G-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.384C>T (p.Asp128=)2074ERCC6Conflicting interpretations of pathogenicityrs146165518RCV000283340|RCV000323401|RCV000380147|RCV000936177; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MedGen:CN517202105074062750740627GA10:g.50740627G>AClinGen:CA5496562
NM_000124.4(ERCC6):c.379G>A (p.Val127Ile)2074ERCC6Likely benignrs116275562RCV000278426|RCV000340746|RCV000391442|RCV000917252; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MedGen:CN517202105074063250740632CT10:g.50740632C>TClinGen:CA5496563
NM_000124.4(ERCC6):c.259_260del (p.Ala87fs)2074ERCC6Likely pathogenicrs1554794620RCV000667164; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105074075150740752GGCG10:g.50740751_50740752del-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.229C>T (p.Arg77Ter)2074ERCC6Pathogenicrs121917903RCV000001777|RCV000502276; NMONDO:MONDO:0010909,MedGen:C3551173,OMIM:600630, Orphanet:178338|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105074078250740782GA10:g.50740782G>AClinGen:CA115155,OMIM:609413.0009C0751038 133540 Cockayne syndrome B;
NM_000124.4(ERCC6):c.214del (p.Leu72fs)2074ERCC6Likely pathogenicrs1554794640RCV000669424; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105074079750740797AGA10:g.50740797_50740797del-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.207dup (p.Pro70fs)2074ERCC6Pathogenic/Likely pathogenicrs1554794641RCV000672932|RCV001172036; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MedGen:CN517202105074080350740804GGC10:g.50740803_50740804insC-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.184G>A (p.Ala62Thr)2074ERCC6Uncertain significancers186839348RCV000664765; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105074082750740827CT10:g.50740827C>T-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.150G>A (p.Val50=)2074ERCC6Conflicting interpretations of pathogenicityrs80133923RCV000170367|RCV000314736|RCV000335795|RCV000402991|RCV000871118; NMedGen:CN169374|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MedGen:CN517202105074086150740861CT10:g.50740861C>TClinGen:CA199575CN239231 Cerebrooculofacioskeletal Syndrome;
NM_000124.4(ERCC6):c.124GAG[1] (p.Glu43del)2074ERCC6Uncertain significancers751610688RCV000672340; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105074088250740884ACTCA10:g.50740882_50740884del-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.61C>T (p.Gln21Ter)2074ERCC6Pathogenic/Likely pathogenicrs577021605RCV000666618|RCV001381278; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MedGen:CN517202105074095050740950GA10:g.50740950G>A-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.-14-2A>G2074ERCC6Uncertain significancers760663515RCV000666837; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191; MONDO:MONDO:0010217,MedGen:C0265201,OMIM:278800, Orphanet:1569; MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105074102650741026TC10:g.50741026T>C-C0220722 214150 Cerebro-oculo-facio-skeletal syndrome;
NM_000124.4(ERCC6):c.-15+3G>T2074ERCC6Likely pathogenicrs1010201937RCV000853311; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105074700550747005CA10:g.50747005C>A-
NM_000124.4(ERCC6):c.-22G>A2074ERCC6Conflicting interpretations of pathogenicityrs4253006RCV000267938|RCV000320674|RCV000359897; NMONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105074701550747015CT10:g.50747015C>TClinGen:CA10635886
NM_000124.4(ERCC6):c.-32G>A2074ERCC6Uncertain significancers1215179845RCV001104086|RCV001104084|RCV001104085; NMONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105074702550747025CT10:g.50747025C>T-
NM_000124.4(ERCC6):c.-52G>A2074ERCC6Uncertain significancers550772412RCV000280700|RCV000319401|RCV000377581; NMONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150105074704550747045CT10:g.50747045C>TClinGen:CA10635890
NM_000124.4(ERCC6):c.-65G>A2074ERCC6Uncertain significancers1318032118RCV001104389|RCV001104388|RCV001104390; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191105074705850747058CT10:g.50747058C>T-
NM_000124.4(ERCC6):c.-83G>A2074ERCC6Uncertain significancers886047040RCV000292741|RCV000350035|RCV000389601; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761105074707650747076CT10:g.50747076C>TClinGen:CA10628667
NM_000124.4(ERCC6):c.-100A>G2074ERCC6Uncertain significancers886047041RCV000304788|RCV000361867|RCV000402835; NMONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761105074709350747093TC10:g.50747093T>CClinGen:CA10631778
NM_000124.4(ERCC6):c.-107A>G2074ERCC6Uncertain significancers886047042RCV000265025|RCV000303756|RCV000356350; NMONDO:MONDO:0019570,MedGen:C0751038,OMIM:133540, Orphanet:191|MONDO:MONDO:0008955,MedGen:C0220722,OMIM:214150|MONDO:MONDO:0013409,MedGen:C3151063,OMIM:613761105074710050747100TC10:g.50747100T>CClinGen:CA10635438
MSeqDR Portal