MSeqDR Mitochondrial Disease Portal


 
*:HP: HPO terms, UMDF: 1= Disease, ND: NAMDC terms.
  Most Studied  CPEO, Complex I Deficiency, COXPD1, Leigh, LHON, MELAS, MERRF, Myopathy, SANDO
Disease Browser
Parent Node:
expand
Hereditary Sensory and Motor Neuropathy (D015417)
..Starting node
..expand
Charcot-Marie-Tooth Disease (D002607)

       Child Nodes:
........expandCharcot Marie Tooth type 1 aplasia cutis congenita (C538077)
........expandCharcot-Marie-Tooth disease and deafness (C538078)
........expandCharcot-Marie-Tooth disease with ptosis and parkinsonism (C538079)
........expandCharcot-Marie-Tooth Disease, Autosomal Dominant, Type 2k (C564325)
........expandCHARCOT-MARIE-TOOTH DISEASE, AXONAL, AUTOSOMAL RECESSIVE, TYPE 2A2B (OMIM:617087)
........expandCharcot-Marie-Tooth Disease, Axonal, Type 2a1 (C566138)
........expandCharcot-Marie-Tooth Disease, Axonal, Type 2A2 (C563757)  LSDB  L: 00488;
........expandCHARCOT-MARIE-TOOTH DISEASE, AXONAL, TYPE 2CC (OMIM:616924)
........expandCHARCOT-MARIE-TOOTH DISEASE, AXONAL, TYPE 2L (OMIM:608673)
........expandCharcot-Marie-Tooth Disease, Axonal, Type 2n (C567653)
........expandCHARCOT-MARIE-TOOTH DISEASE, AXONAL, TYPE 2O (OMIM:614228)
........expandCHARCOT-MARIE-TOOTH DISEASE, AXONAL, TYPE 2P (OMIM:614436)
........expandCHARCOT-MARIE-TOOTH DISEASE, AXONAL, TYPE 2Q (OMIM:615025)
........expandCHARCOT-MARIE-TOOTH DISEASE, AXONAL, TYPE 2R (OMIM:615490)
........expandCHARCOT-MARIE-TOOTH DISEASE, AXONAL, TYPE 2S (OMIM:616155)
........expandCHARCOT-MARIE-TOOTH DISEASE, AXONAL, TYPE 2T (OMIM:617017)
........expandCHARCOT-MARIE-TOOTH DISEASE, AXONAL, TYPE 2U (OMIM:616280)
........expandCHARCOT-MARIE-TOOTH DISEASE, AXONAL, TYPE 2V (OMIM:616491)
........expandCHARCOT-MARIE-TOOTH DISEASE, AXONAL, TYPE 2W (OMIM:616625)
........expandCHARCOT-MARIE-TOOTH DISEASE, AXONAL, TYPE 2X (OMIM:616668)
........expandCHARCOT-MARIE-TOOTH DISEASE, AXONAL, TYPE 2Y (OMIM:616687)
........expandCHARCOT-MARIE-TOOTH DISEASE, AXONAL, TYPE 2Z (OMIM:616688)
........expandCharcot-Marie-Tooth Disease, Demyelinating, Type 1e (C566136)
........expandCHARCOT-MARIE-TOOTH DISEASE, DEMYELINATING, TYPE 4F (OMIM:614895)
........expandCharcot-Marie-Tooth disease, dominant intermediate 1 (C535399)
........expandCharcot-Marie-Tooth disease, dominant intermediate 2 (C535400)
........expandCharcot-Marie-Tooth disease, dominant intermediate 3 (C535401)
........expandCharcot-Marie-Tooth Disease, Dominant Intermediate A (C564702)
........expandCharcot-Marie-Tooth Disease, Dominant Intermediate B (C564703)
........expandCharcot-Marie-Tooth Disease, Dominant Intermediate C (C564257)
........expandCharcot-Marie-Tooth Disease, Dominant Intermediate D (C564333)
........expandCHARCOT-MARIE-TOOTH DISEASE, DOMINANT INTERMEDIATE E (OMIM:614455)
........expandCHARCOT-MARIE-TOOTH DISEASE, DOMINANT INTERMEDIATE F (OMIM:615185)
........expandCharcot-Marie-Tooth Disease, Foot Deformity of (C564179)
........expandCharcot-Marie-Tooth Disease, Guadalajara Neuronal Type (C566137)
........expandCharcot-Marie-Tooth Disease, Recessive Intermediate A (C564256)
........expandCHARCOT-MARIE-TOOTH DISEASE, RECESSIVE INTERMEDIATE B (OMIM:613641)
........expandCHARCOT-MARIE-TOOTH DISEASE, RECESSIVE INTERMEDIATE C (OMIM:615376)
........expandCHARCOT-MARIE-TOOTH DISEASE, RECESSIVE INTERMEDIATE D (OMIM:616039)
........expandCharcot-Marie-Tooth disease, Type 1C (C537984)
........expandCharcot-Marie-Tooth disease, Type 1D (C537985)
........expandCharcot-Marie-Tooth disease, Type 1E (C537986)
........expandCharcot-Marie-Tooth disease, Type 1F (C537987)
........expandCharcot-Marie-Tooth disease, Type 2A (C537988)
........expandCharcot-Marie-Tooth disease, Type 2B (C537989)
........expandCharcot-Marie-Tooth disease, Type 2B1 (C537990)
........expandCharcot-Marie-Tooth disease, Type 2B2 (C537991)
........expandCharcot-Marie-Tooth disease, Type 2C (C537992)
........expandCharcot-Marie-Tooth disease, Type 2D (C537993)
........expandCharcot-Marie-Tooth disease, Type 2E (C537994)
........expandCharcot-Marie-Tooth disease, Type 2F (C535413)
........expandCharcot-Marie-Tooth disease, Type 2H (C535415)
........expandCharcot-Marie-Tooth disease, Type 2I (C535416)
........expandCharcot-Marie-Tooth disease, Type 2J (C535417)
........expandCharcot-Marie-Tooth disease, Type 2K (C535418)
........expandCharcot-Marie-Tooth disease, Type 4A (C535419)
........expandCharcot-Marie-Tooth disease, Type 4A, axonal form (C539595) Child1
........expandCharcot-Marie-Tooth disease, Type 4B1 (C535420)
........expandCharcot-Marie-Tooth disease, Type 4B2 (C535421)
........expandCharcot-Marie-Tooth disease, Type 4B2, with early-onset glaucoma (C535422)
........expandCHARCOT-MARIE-TOOTH DISEASE, TYPE 4B3 (OMIM:615284)
........expandCharcot-Marie-Tooth disease, Type 4C (C535423)
........expandCharcot-Marie-Tooth disease, Type 4E (C535301)
........expandCharcot-Marie-Tooth Disease, Type 4H (C563740)
........expandCharcot-Marie-Tooth Disease, Type 4j (C566984)
........expandCHARCOT-MARIE-TOOTH DISEASE, TYPE 4K (OMIM:616684)
........expandCharcot-Marie-Tooth disease, X-linked recessive, 2 (C535302)
........expandCharcot-Marie-Tooth disease, X-linked recessive, 3 (C535303)
........expandCharcot-Marie-Tooth disease, X-linked, 1 (C535919)
........expandCharcot-Marie-Tooth Neuropathy, Dominant Intermediate B, with Neutropenia (C564704)
........expandCharcot-Marie-Tooth Neuropathy, Type 4B2, with Early-Onset Glaucoma (C565761)
........expandCharcot-Marie-Tooth Peroneal Muscular Atrophy and Friedreich Ataxia, Combined (C564446)
........expandCowchock syndrome (C536450)
........expandHereditary Motor And Sensory Neuropathy, Type IIC (C565261)
........expandKeratoderma palmoplantar spastic paralysis (C536153)
........expandNeuropathy, Distal Hereditary Motor, Type IIA (C563561)
........expandNeuropathy, hereditary motor and sensory, LOM type (C535716)
........expandPolyneuropathy, Mixed, of Early Onset (C564879)



 Sister Nodes: 
..expandAlstrom Syndrome (D056769)
..expandCardioneuromyopathy with Hyaline Masses and Nemaline Rods (C564655)
..expandCharcot-Marie-Tooth Disease (D002607) Child59  LSDB C:1
..expandGiant Axonal Neuropathy (D056768) Child1
..expandHagemoser Weinstein Bresnick syndrome (C537626)
..expandHereditary Motor And Sensory Neuropathy VI (C562851)  LSDB  L: 00485;
..expandHypertrichosis, Congenital Anterior Cervical, with Peripheral Sensory and Motor Neuropathy (C565492)
..expandNeuropathy, Distal Hereditary Motor, Type VIIA (C563562)
..expandNeuropathy, hereditary motor and sensory, Okinawa type (C535717)
..expandNeuropathy, hereditary motor and sensory, Russe type (C535813)
..expandNEUROPATHY, HEREDITARY MOTOR AND SENSORY, TYPE VIB (OMIM:616505)
..expandNeuropathy, Hereditary Motor and Sensory, with Excessive Myelin Folding Complex, Autosomal Recessive (C564947)
..expandNeuropathy, Hereditary Sensorimotor, with Upper Motor Neuron, Visual Pathway and Autonomic Disturbance (C563517)
..expandNeuropathy, Hereditary Sensory, with Spastic Paraplegia, Autosomal Recessive (C564948)
..expandNeuropathy, Hereditary Thermosensitive (C566575)
..expandPolyneuropathy, Lethal Neonatal, Axonal Sensorimotor, Autosomal Recessive (C565773)
..expandRefsum Disease (D012035) Child4
..expandSensory ataxic neuropathy, dysarthria, and ophthalmoparesis (C537583)  LSDB  L: 00042;
..expandSlowed Nerve Conduction Velocity, Autosomal Dominant (C564269)
..expandSpastic Paraplegia, Hereditary (D015419) Child78
..expandSpastic Paraplegia, Optic Atrophy, and Neuropathy (C563702)
..expandTamari Goodman syndrome (C536896)
..expandTomaculous neuropathy (C536965)
..expandTremor hereditary essential, 2 (C536546)
   

Human Disease MESH is developed by UMLS.
Further data from MedGen, OMIM,ClinVar, CTD
Term ID:2167
Name:Charcot-Marie-Tooth Disease
Definition:A hereditary motor and sensory neuropathy transmitted most often as an autosomal dominant trait and characterized by progressive distal wasting and loss of reflexes in the muscles of the legs (and occasionally involving the arms). Onset is usually in the second to fourth decade of life. This condition has been divided into two subtypes, hereditary motor and sensory neuropathy (HMSN) types I and II. HMSN I is associated with abnormal nerve conduction velocities and nerve hypertrophy, features not seen in HMSN II. (Adams et al., Principles of Neurology, 6th ed, p1343)
Alternative IDs:DO:DOID:0070161|DO:DOID:10595|OMIM:118200|OMIM:118220|OMIM:180800
ParentIDs:MESH:D015417
TreeNumbers:C10.500.300.200 |C10.574.500.495.200 |C10.668.829.800.300.200 |C16.131.666.300.200 |C16.320.400.375.200
Synonyms:Areflexic Dystasia, Hereditary |Areflexic Dystasias, Hereditary |Atrophies, Peroneal Muscular |Atrophy, Muscular, Peroneal |Atrophy, Peroneal Muscular |Charcot Marie Disease |Charcot-Marie Disease |Charcot Marie Tooth Disease |Charcot-Marie-Tooth Disease, Autoso
Slim Mappings:Congenital abnormality|Genetic disease (inborn)|Nervous system disease
Reference: MedGen: D002607
MeSH: D002607
OMIM: 118200;
MSeqDR LSDB:
MSeqDR has 1 matches in descendants: 00488;  
Genes: MPZ; PMP22;
Phenotypes
1 HP:0000006Autosomal dominant inheritance
2 HP:0003587Insidious onset
3 HP:0003621Juvenile onset
4 HP:0001284Areflexia
5 HP:0003449Cold-induced muscle cramps
6 HP:0003431Decreased motor nerve conduction velocity
7 HP:0003380Decreased number of peripheral myelinated nerve fibers
8 HP:0003693Distal amyotrophy
9 HP:0002460Distal muscle weakness
NAMDC:  Muscle weakness: distal
10 HP:0002936Distal sensory impairment
11 HP:0009027Foot dorsiflexor weakness
12 HP:0001765Hammertoe
13 HP:0001425Heterogeneous
14 HP:0003382Hypertrophic nerve changes
15 HP:0001265Hyporeflexia
16 HP:0002751KyphoscoliosisHP:0040282
17 HP:0003690Limb muscle weakness
18 HP:0004336Myelin outfoldings
19 HP:0003383Onion bulb formation
20 HP:0011096Peripheral demyelinationHP:0040282
21 HP:0009830Peripheral neuropathy
22 HP:0001761Pes cavus
23 HP:0003677Slow progression
24 HP:0001171Split hand
25 HP:0003376Steppage gait
26 HP:0012074Tonic pupil
27 HP:0001178Ulnar claw
28 HP:0003828Variable expressivity
Disease Causing ClinVar Variants
Variation_NameGeneIDGeneSymbolClinicalSignificancedbSNPRCVaccessionTestedInGTRPhenotypeIDsChromosomeStartStopHGVS_cHGVS_pHGVS_gOtherIDsDisease_ClinVar
NM_000530.8(MPZ):c.*1074A>C4359MPZUncertain significancers886045471RCV000261032|RCV000301051|RCV000305607|RCV000353504|RCV001093765; NMONDO:MONDO:0008392,MedGen:C0205713,OMIM:180800, Orphanet:3115|MONDO:MONDO:0011909,MedGen:C1843075,OMIM:607791, Orphanet:100046|MONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MONDO:MONDO:0011527,MedGen:C4721436,OMIM:605253, Orphanet:99951|1161274592161274592TGNC_000001.10:g.161274592T>GClinGen:CA10608565C0751036 Charcot-Marie-Tooth disease, type I;
NM_000530.8(MPZ):c.*1048A>T4359MPZConflicting interpretations of pathogenicityrs71639057RCV000265703|RCV000269004|RCV000327786|RCV000358066|RCV001093818; NMONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MONDO:MONDO:0011527,MedGen:C4721436,OMIM:605253, Orphanet:99951|MONDO:MONDO:0008392,MedGen:C0205713,OMIM:180800, Orphanet:3115|MONDO:MONDO:0011909,MedGen:C1843075,OMIM:607791, Orphanet:100046|1161274618161274618TANC_000001.10:g.161274618T>AClinGen:CA10608566C0751036 Charcot-Marie-Tooth disease, type I;
NM_000530.8(MPZ):c.*1020G>A4359MPZUncertain significancers886045472RCV000295760|RCV000326435|RCV000348310|RCV000386477|RCV001093819; NMONDO:MONDO:0011527,MedGen:C4721436,OMIM:605253, Orphanet:99951|MONDO:MONDO:0008392,MedGen:C0205713,OMIM:180800, Orphanet:3115|MONDO:MONDO:0011909,MedGen:C1843075,OMIM:607791, Orphanet:100046|MONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|1161274646161274646CTNC_000001.10:g.161274646C>TClinGen:CA10608161C0751036 Charcot-Marie-Tooth disease, type I;
NM_000530.8(MPZ):c.*954C>A4359MPZUncertain significancers372340608RCV000280448|RCV000298286|RCV000338011|RCV000341490|RCV001093865; NMONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MONDO:MONDO:0011909,MedGen:C1843075,OMIM:607791, Orphanet:100046|MONDO:MONDO:0008392,MedGen:C0205713,OMIM:180800, Orphanet:3115|MONDO:MONDO:0011527,MedGen:C4721436,OMIM:605253, Orphanet:99951|1161274712161274712GTNC_000001.10:g.161274712G>TClinGen:CA10608164C0751036 Charcot-Marie-Tooth disease, type I;
NM_000530.8(MPZ):c.*903G>A4359MPZUncertain significancers1489097338RCV001100822|RCV001100821|RCV001100823|RCV001100824; NMONDO:MONDO:0011909,MedGen:C1843075,OMIM:607791, Orphanet:100046|MONDO:MONDO:0008392,MedGen:C0205713,OMIM:180800, Orphanet:3115|MONDO:MONDO:0020765,MedGen:C4722277,OMIM:618184|MONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:1010821161274763161274763CT1:g.161274763C>T-
NM_000530.8(MPZ):c.*761A>G4359MPZBenignrs16832786RCV000282450|RCV000316529|RCV000331888|RCV000373521|RCV001093878|RCV001683172; NMONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MONDO:MONDO:0011909,MedGen:C1843075,OMIM:607791, Orphanet:100046|MONDO:MONDO:0008392,MedGen:C0205713,OMIM:180800, Orphanet:3115|MONDO:MONDO:0011527,MedGen:C4721436,OMIM:605253, Orphanet:99951|1161274905161274905TCNC_000001.10:g.161274905T>CClinGen:CA10608528C0751036 Charcot-Marie-Tooth disease, type I;
NM_000530.8(MPZ):c.*752G>A4359MPZUncertain significancers533147214RCV001101072|RCV001101071|RCV001101073|RCV001101074; NMONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MONDO:MONDO:0020765,MedGen:C4722277,OMIM:618184|MONDO:MONDO:0008392,MedGen:C0205713,OMIM:180800, Orphanet:3115|MONDO:MONDO:0011909,MedGen:C1843075,OMIM:607791, Orphanet:1000461161274914161274914CT1:g.161274914C>T-
NM_000530.8(MPZ):c.*743C>T4359MPZConflicting interpretations of pathogenicityrs140992541RCV000286154|RCV000339052|RCV000347133|RCV000396851|RCV001093769; NMONDO:MONDO:0011527,MedGen:C4721436,OMIM:605253, Orphanet:99951|MONDO:MONDO:0008392,MedGen:C0205713,OMIM:180800, Orphanet:3115|MONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MONDO:MONDO:0011909,MedGen:C1843075,OMIM:607791, Orphanet:100046|1161274923161274923GANC_000001.10:g.161274923G>AClinGen:CA10608531C0751036 Charcot-Marie-Tooth disease, type I;
NM_000530.8(MPZ):c.*681A>T4359MPZUncertain significancers886045474RCV000307585|RCV000311202|RCV000369359|RCV000396867|RCV001093770; NMONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MONDO:MONDO:0008392,MedGen:C0205713,OMIM:180800, Orphanet:3115|MONDO:MONDO:0011527,MedGen:C4721436,OMIM:605253, Orphanet:99951|MONDO:MONDO:0011909,MedGen:C1843075,OMIM:607791, Orphanet:100046|1161274985161274985TANC_000001.10:g.161274985T>AClinGen:CA10608007C0751036 Charcot-Marie-Tooth disease, type I;
NM_000530.8(MPZ):c.*624C>T4359MPZBenign/Likely benignrs60821801RCV000261171|RCV000262294|RCV000368241|RCV000357089|RCV001093822|RCV001709575; NMONDO:MONDO:0011909,MedGen:C1843075,OMIM:607791, Orphanet:100046|MONDO:MONDO:0011527,MedGen:C4721436,OMIM:605253, Orphanet:99951|MONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MONDO:MONDO:0008392,MedGen:C0205713,OMIM:180800, Orphanet:3115|1161275042161275042GANC_000001.10:g.161275042G>AClinGen:CA10608567C0751036 Charcot-Marie-Tooth disease, type I;
NM_000530.8(MPZ):c.*568C>G4359MPZBenign/Likely benignrs60731755RCV000286729|RCV000322023|RCV000382378|RCV000376668|RCV001093823|RCV001785548; NMONDO:MONDO:0011527,MedGen:C4721436,OMIM:605253, Orphanet:99951|MONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MONDO:MONDO:0008392,MedGen:C0205713,OMIM:180800, Orphanet:3115|MONDO:MONDO:0011909,MedGen:C1843075,OMIM:607791, Orphanet:100046|1161275098161275098GCNC_000001.10:g.161275098G>CClinGen:CA10608010C0751036 Charcot-Marie-Tooth disease, type I;
NM_000530.8(MPZ):c.*522C>A4359MPZUncertain significancers900816889RCV001099175|RCV001099176|RCV001099177|RCV001099178; NMONDO:MONDO:0020765,MedGen:C4722277,OMIM:618184|MONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MONDO:MONDO:0011909,MedGen:C1843075,OMIM:607791, Orphanet:100046|MONDO:MONDO:0008392,MedGen:C0205713,OMIM:180800, Orphanet:31151161275144161275144GT1:g.161275144G>T-
NM_000530.8(MPZ):c.*435T>G4359MPZUncertain significancers868502674RCV001099182|RCV001099181|RCV001099179|RCV001099180; NMONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MONDO:MONDO:0008392,MedGen:C0205713,OMIM:180800, Orphanet:3115|MONDO:MONDO:0020765,MedGen:C4722277,OMIM:618184|MONDO:MONDO:0011909,MedGen:C1843075,OMIM:607791, Orphanet:1000461161275231161275231AC1:g.161275231A>C-
NM_000530.8(MPZ):c.*369C>T4359MPZUncertain significancers1359055917RCV001101174|RCV001101175|RCV001101176|RCV001101177; NMONDO:MONDO:0008392,MedGen:C0205713,OMIM:180800, Orphanet:3115|MONDO:MONDO:0020765,MedGen:C4722277,OMIM:618184|MONDO:MONDO:0011909,MedGen:C1843075,OMIM:607791, Orphanet:100046|MONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:1010821161275297161275297GA1:g.161275297G>A-
NM_000530.8(MPZ):c.*360C>G4359MPZConflicting interpretations of pathogenicityrs6682046RCV001101179|RCV001101181|RCV001101178|RCV001101180|RCV001847156; NMONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MONDO:MONDO:0011909,MedGen:C1843075,OMIM:607791, Orphanet:100046|MONDO:MONDO:0020765,MedGen:C4722277,OMIM:618184|MONDO:MONDO:0008392,MedGen:C0205713,OMIM:180800, Orphanet:3115|MedGen:CN5172021161275306161275306GC1:g.161275306G>C-
NM_000530.8(MPZ):c.*341A>G4359MPZUncertain significancers557613782RCV001097430|RCV001097431|RCV001097432|RCV001097433; NMONDO:MONDO:0008392,MedGen:C0205713,OMIM:180800, Orphanet:3115|MONDO:MONDO:0020765,MedGen:C4722277,OMIM:618184|MONDO:MONDO:0011909,MedGen:C1843075,OMIM:607791, Orphanet:100046|MONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:1010821161275325161275325TC1:g.161275325T>C-
NM_000530.8(MPZ):c.*251C>G4359MPZUncertain significancers772995394RCV000287992|RCV000293818|RCV000348698|RCV000347391|RCV001093772; NMONDO:MONDO:0011909,MedGen:C1843075,OMIM:607791, Orphanet:100046|MONDO:MONDO:0011527,MedGen:C4721436,OMIM:605253, Orphanet:99951|MONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MONDO:MONDO:0008392,MedGen:C0205713,OMIM:180800, Orphanet:3115|1161275415161275415GCNC_000001.10:g.161275415G>CClinGen:CA10608532C0751036 Charcot-Marie-Tooth disease, type I;
NM_000530.8(MPZ):c.*195G>T4359MPZConflicting interpretations of pathogenicityrs150182811RCV000300540|RCV000313368|RCV000354081|RCV000395380|RCV001093774; NMONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MONDO:MONDO:0011527,MedGen:C4721436,OMIM:605253, Orphanet:99951|MONDO:MONDO:0011909,MedGen:C1843075,OMIM:607791, Orphanet:100046|MONDO:MONDO:0008392,MedGen:C0205713,OMIM:180800, Orphanet:3115|1161275471161275471CANC_000001.10:g.161275471C>AClinGen:CA10608533C0751036 Charcot-Marie-Tooth disease, type I;
NM_000530.8(MPZ):c.*102C>T4359MPZUncertain significancers774748921RCV001097526|RCV001097527|RCV001097524|RCV001097525; NMONDO:MONDO:0011909,MedGen:C1843075,OMIM:607791, Orphanet:100046|MONDO:MONDO:0020765,MedGen:C4722277,OMIM:618184|MONDO:MONDO:0008392,MedGen:C0205713,OMIM:180800, Orphanet:3115|MONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:1010821161275564161275564GA1:g.161275564G>A-
Single allele4359MPZLikely pathogenic-1RCV000235059; NMONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:1010821161275597161275598GGACCATCACCTTTGGGCCTTTGGCGGACTCCACCCCTAACCCCCGATCCCCCGCCCGGCCCGCTAACCGCTATTTCTTATCCTTGCGAGACTCCCCCAGCCCCTTGGCCTNC_000001.10:g.161275598_161279773dupClinGen:CA10584071C1968689 243700 Hyperimmunoglobulin E recurrent infection syndrome, autosomal recessive;
NM_000530.8(MPZ):c.*52G>A4359MPZConflicting interpretations of pathogenicityrs774701563RCV000265390|RCV000270677|RCV000301779|RCV000355341|RCV001093826|RCV001357532; NMONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MONDO:MONDO:0008392,MedGen:C0205713,OMIM:180800, Orphanet:3115|MONDO:MONDO:0011909,MedGen:C1843075,OMIM:607791, Orphanet:100046|MONDO:MONDO:0011527,MedGen:C4721436,OMIM:605253, Orphanet:99951|1161275614161275614CTNC_000001.10:g.161275614C>TClinGen:CA1210041C0751036 Charcot-Marie-Tooth disease, type I;
NM_000530.8(MPZ):c.670G>T (p.Asp224Tyr)4359MPZPathogenicrs267607247RCV000033921|RCV000700463|RCV000789431; NMONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MONDO:MONDO:0019011,MedGen:C0751036, Orphanet:65753|MONDO:MONDO:0015626,MedGen:C0007959,OMIM:PS118220, Orphanet:1661161275743161275743CANC_000001.10:g.161275743C>AClinGen:CA343909,UniProtKB:P25189#VAR_054397,OMIM:159440.0036C0270912 118200 Charcot-Marie-Tooth disease, demyelinating, type 1b;
NM_000530.8(MPZ):c.662C>T (p.Ala221Val)4359MPZUncertain significancers1040557288RCV000552351|RCV001535775; NMONDO:MONDO:0019011,MedGen:C0751036, Orphanet:65753|MONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082; MONDO:MONDO:0011903,MedGen:C1843153,OMIM:607736, Orphanet:99943; MONDO:MONDO:0011909,MedGen:C1843075,OMIM:607791, Orphanet:100046; MONDO:MONDO1161275751161275751GA1:g.161275751G>AClinGen:CA343344430C0751036 Charcot-Marie-Tooth disease, type I;
NM_000530.8(MPZ):c.646-10_650del4359MPZPathogenicrs863225026RCV000201070|RCV000789429; NMONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MONDO:MONDO:0015626,MedGen:C0007959,OMIM:PS118220, Orphanet:1661161275763161275777TGGCGTCTGGGGGAGGTNC_000001.10:g.161275767_161275781delClinGen:CA279078C0270912 118200 Charcot-Marie-Tooth disease, demyelinating, type 1b;
NM_000530.8(MPZ):c.649C>T (p.Pro217Ser)4359MPZConflicting interpretations of pathogenicityrs281865132RCV000033925|RCV000790078; NMONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MONDO:MONDO:0015626,MedGen:C0007959,OMIM:PS118220, Orphanet:1661161275764161275764GANC_000001.10:g.161275764G>AClinGen:CA343918C0270912 118200 Charcot-Marie-Tooth disease, demyelinating, type 1b;
NM_000530.8(MPZ):c.645+1G>T4359MPZConflicting interpretations of pathogenicityrs281865131RCV000033924|RCV000790079; NMONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MONDO:MONDO:0015626,MedGen:C0007959,OMIM:PS118220, Orphanet:1661161275897161275897CANC_000001.10:g.161275897C>AClinGen:CA343917C0270912 118200 Charcot-Marie-Tooth disease, demyelinating, type 1b;
NM_000530.8(MPZ):c.588dup (p.Met197fs)4359MPZPathogenicrs281865129RCV000033920; NMONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:1010821161275954161275955TTA1:g.161275954_161275955insAClinGen:CA343908C0270912 118200 Charcot-Marie-Tooth disease, demyelinating, type 1b;
NM_000530.8(MPZ):c.584+2T>G4359MPZPathogenicrs879254054RCV000015261|RCV000235519|RCV000790116; NMONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MedGen:CN517202|MONDO:MONDO:0015626,MedGen:C0007959,OMIM:PS118220, Orphanet:1661161276117161276117ACNC_000001.10:g.161276117A>CClinGen:CA10584142,OMIM:159440.0032
NM_000530.8(MPZ):c.499G>A (p.Gly167Arg)4359MPZPathogenicrs121913586RCV000194294|RCV000789484|RCV001053594; NMONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MONDO:MONDO:0015626,MedGen:C0007959,OMIM:PS118220, Orphanet:166|MONDO:MONDO:0019011,MedGen:C0751036, Orphanet:657531161276204161276204CTNC_000001.10:g.161276204C>TClinGen:CA347426,UniProtKB:P25189#VAR_004544C0270912 118200 Charcot-Marie-Tooth disease, demyelinating, type 1b;
NM_000530.8(MPZ):c.487G>C (p.Gly163Arg)4359MPZPathogenic/Likely pathogenicrs281865128RCV000033919|RCV000205003|RCV000217802|RCV000789486; NMONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MONDO:MONDO:0019011,MedGen:C0751036, Orphanet:65753|MedGen:CN517202|MONDO:MONDO:0015626,MedGen:C0007959,OMIM:PS118220, Orphanet:1661161276216161276216CGNC_000001.10:g.161276216C>GClinGen:CA339741,UniProtKB:P25189#VAR_004542
NM_000530.8(MPZ):c.487G>A (p.Gly163Arg)4359MPZPathogenicrs281865128RCV000193606|RCV000538322|RCV000789471; NMONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MONDO:MONDO:0019011,MedGen:C0751036, Orphanet:65753|MONDO:MONDO:0015626,MedGen:C0007959,OMIM:PS118220, Orphanet:1661161276216161276216CTNC_000001.10:g.161276216C>TClinGen:CA347390,UniProtKB:P25189#VAR_004542C0270912 118200 Charcot-Marie-Tooth disease, demyelinating, type 1b;
NM_000530.8(MPZ):c.444A>T (p.Glu148Asp)4359MPZUncertain significancers1670257548RCV001095838|RCV001095840|RCV001095839|RCV001095837; NMONDO:MONDO:0008392,MedGen:C0205713,OMIM:180800, Orphanet:3115|MONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MONDO:MONDO:0011909,MedGen:C1843075,OMIM:607791, Orphanet:100046|MONDO:MONDO:0020765,MedGen:C4722277,OMIM:6181841161276502161276502TA1:g.161276502T>A-
NM_000530.8(MPZ):c.434A>C (p.Tyr145Ser)4359MPZPathogenicrs121913603RCV000015255|RCV000235936|RCV000234112|RCV000763260; NMONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MedGen:CN517202|MONDO:MONDO:0019011,MedGen:C0751036, Orphanet:65753|7 conditions1161276512161276512TGNC_000001.10:g.161276512T>GClinGen:CA257166,UniProtKB:P25189#VAR_029983,OMIM:159440.0026
NM_000530.8(MPZ):c.428C>T (p.Thr143Met)4359MPZUncertain significancers750724650RCV000638163|RCV000790102|RCV001097627|RCV001097625|RCV001097626|RCV001097628; NMONDO:MONDO:0019011,MedGen:C0751036, Orphanet:65753|MONDO:MONDO:0015626,MedGen:C0007959,OMIM:PS118220, Orphanet:166|MONDO:MONDO:0011909,MedGen:C1843075,OMIM:607791, Orphanet:100046|MONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MONDO:MONDO1161276518161276518GANC_000001.10:g.161276518G>AClinGen:CA1210177C0751036 Charcot-Marie-Tooth disease, type I;
NM_000530.8(MPZ):c.410G>A (p.Gly137Asp)4359MPZPathogenicrs863225025RCV000201196; NMONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:1010821161276536161276536CT1:g.161276536C>TClinGen:CA279120C0270912 118200 Charcot-Marie-Tooth disease, demyelinating, type 1b;
NM_000530.8(MPZ):c.409G>A (p.Gly137Ser)4359MPZLikely pathogenicrs121913588RCV000015236|RCV000462311|RCV000712317; NMONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MONDO:MONDO:0019011,MedGen:C0751036, Orphanet:65753|MedGen:CN5172021161276537161276537CT1:g.161276537C>TUniProtKB:P25189#VAR_004540,OMIM:159440.0008,ClinGen:CA257148C0270912 118200 Charcot-Marie-Tooth disease, demyelinating, type 1b;
NM_000530.8(MPZ):c.404T>C (p.Ile135Thr)4359MPZPathogenic/Likely pathogenicrs121913587RCV000015235|RCV000425572|RCV001807729; NMONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MedGen:CN517202|MONDO:MONDO:0007790,MedGen:C0011195,OMIM:145900, Orphanet:647481161276542161276542AGNC_000001.10:g.161276542A>GClinGen:CA257146,UniProtKB:P25189#VAR_004539,OMIM:159440.0007
NM_000530.8(MPZ):c.403A>C (p.Ile135Leu)4359MPZPathogenicrs879253858RCV000235064|RCV000789436; NMONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MONDO:MONDO:0015626,MedGen:C0007959,OMIM:PS118220, Orphanet:1661161276543161276543TGNC_000001.10:g.161276543T>GClinGen:CA10584090,UniProtKB:P25189#VAR_004538C0270912 118200 Charcot-Marie-Tooth disease, demyelinating, type 1b;
NM_000530.8(MPZ):c.393C>A (p.Asn131Lys)4359MPZPathogenicrs121913599RCV000015250|RCV000192587|RCV000517209|RCV001060346; NMONDO:MONDO:0008392,MedGen:C0205713,OMIM:180800, Orphanet:3115|MONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MedGen:CN517202|MONDO:MONDO:0019011,MedGen:C0751036, Orphanet:657531161276553161276553GT1:g.161276553G>TClinGen:CA123803,UniProtKB:P25189#VAR_015978,OMIM:159440.0021C0270912 118200 Charcot-Marie-Tooth disease, demyelinating, type 1b;
NM_000530.8(MPZ):c.389A>G (p.Lys130Arg)4359MPZConflicting interpretations of pathogenicityrs281865127RCV000033918|RCV000516461|RCV000819474; NMONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MedGen:CN517202|MONDO:MONDO:0019011,MedGen:C0751036, Orphanet:657531161276557161276557TCNC_000001.10:g.161276557T>CUniProtKB:P25189#VAR_004534,ClinGen:CA243183C0270912 118200 Charcot-Marie-Tooth disease, demyelinating, type 1b;
NM_000530.8(MPZ):c.371C>T (p.Thr124Met)4359MPZPathogenicrs121913595RCV000015244|RCV000015245|RCV000192248|RCV000517355|RCV000638155|RCV000763262|RCV001262744; NMONDO:MONDO:0011903,MedGen:C1843153,OMIM:607736, Orphanet:99943|MONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MONDO:MONDO:0015626,MedGen:C0007959,OMIM:PS118220, Orphanet:166|MedGen:CN517202|MONDO:MONDO:0019011,MedGen:C0751036, Orphanet:651161276575161276575GA1:g.161276575G>AClinGen:CA257158,UniProtKB:P25189#VAR_004529,OMIM:159440.0016C0007959 Charcot-Marie-Tooth disease;
NM_000530.8(MPZ):c.367G>A (p.Gly123Ser)4359MPZConflicting interpretations of pathogenicityrs121913608RCV000015262|RCV000790090; NMONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MONDO:MONDO:0015626,MedGen:C0007959,OMIM:PS118220, Orphanet:1661161276579161276579CTNC_000001.10:g.161276579C>TClinGen:CA257174,OMIM:159440.0033C0270912 118200 Charcot-Marie-Tooth disease, demyelinating, type 1b;
NM_000530.8(MPZ):c.362A>G (p.Asp121Gly)4359MPZUncertain significancers1571818953RCV000814912|RCV001353168; NMONDO:MONDO:0019011,MedGen:C0751036, Orphanet:65753|MONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:1010821161276584161276584TC1:g.161276584T>C-
NM_000530.8(MPZ):c.347A>G (p.Asn116Ser)4359MPZUncertain significancers281865130RCV000033923|RCV000789688|RCV000994155|RCV001807746|RCV001852685; NMONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MONDO:MONDO:0015626,MedGen:C0007959,OMIM:PS118220, Orphanet:166|MedGen:CN517202|MONDO:MONDO:0011889,MedGen:C3888087,OMIM:607677, Orphanet:99942|MONDO:MONDO:0019011,MedGen:C0751036, Orphanet:651161276599161276599TCNC_000001.10:g.161276599T>CClinGen:CA343914C0270912 118200 Charcot-Marie-Tooth disease, demyelinating, type 1b;
NM_000530.8(MPZ):c.337G>T (p.Val113Phe)4359MPZUncertain significancers281865126RCV000033917|RCV000657923|RCV000789425|RCV001208935; NMONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MedGen:CN517202|MONDO:MONDO:0015626,MedGen:C0007959,OMIM:PS118220, Orphanet:166|MONDO:MONDO:0019011,MedGen:C0751036, Orphanet:657531161276609161276609CANC_000001.10:g.161276609C>AClinVar:208147,ClinGen:CA343905,UniProtKB:P25189#VAR_031890
NM_000530.8(MPZ):c.308G>A (p.Gly103Glu)4359MPZPathogenic/Likely pathogenicrs121913600RCV000015251|RCV000536804|RCV001818160; NMONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MONDO:MONDO:0019011,MedGen:C0751036, Orphanet:65753|MedGen:CN5172021161276638161276638CT1:g.161276638C>TClinGen:CA257164,UniProtKB:P25189#VAR_015976,OMIM:159440.0022C0270912 118200 Charcot-Marie-Tooth disease, demyelinating, type 1b;
NM_000530.8(MPZ):c.306del (p.Asp104fs)4359MPZPathogenic/Likely pathogenicrs281865125RCV000033916|RCV000789496|RCV001705641|RCV001852684; NMONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MONDO:MONDO:0015626,MedGen:C0007959,OMIM:PS118220, Orphanet:166|MONDO:MONDO:0011909,MedGen:C1843075,OMIM:607791, Orphanet:100046|MONDO:MONDO:0019011,MedGen:C0751036, Orphanet:657531161276640161276640CTCNC_000001.10:g.161276640delClinGen:CA343903C0270912 118200 Charcot-Marie-Tooth disease, demyelinating, type 1b;
NM_000530.8(MPZ):c.301T>C (p.Trp101Arg)4359MPZLikely pathogenicrs1060503423RCV000465572|RCV000986450; NMONDO:MONDO:0019011,MedGen:C0751036, Orphanet:65753|MONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:1010821161276645161276645AG1:g.161276645A>GClinGen:CA16609892C0751036 Charcot-Marie-Tooth disease, type I;
NM_000530.8(MPZ):c.293G>C (p.Arg98Pro)4359MPZPathogenicrs121913589RCV000015237|RCV000638160|RCV000790115|RCV001811142; NMONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MONDO:MONDO:0019011,MedGen:C0751036, Orphanet:65753|MONDO:MONDO:0015626,MedGen:C0007959,OMIM:PS118220, Orphanet:166|MedGen:CN5172021161276653161276653CGNC_000001.10:g.161276653C>GClinGen:CA257150,UniProtKB:P25189#VAR_004520,OMIM:159440.0009C0270912 118200 Charcot-Marie-Tooth disease, demyelinating, type 1b;
NM_000530.8(MPZ):c.293G>A (p.Arg98His)4359MPZPathogenic/Likely pathogenicrs121913589RCV000015239|RCV000196172|RCV000415463|RCV000376287|RCV001173692; NMONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MONDO:MONDO:0019011,MedGen:C0751036, Orphanet:65753|Human Phenotype Ontology:HP:0003442,Human Phenotype Ontology:HP:0003714,Human Phenotype Ontology:HP:0006975,Human Phenotype Ontology:HP:001161276653161276653CTNC_000001.10:g.161276653C>TClinGen:CA257154,UniProtKB:P25189#VAR_004519,OMIM:159440.0011
NM_000530.8(MPZ):c.292C>T (p.Arg98Cys)4359MPZPathogenicrs121913590RCV000015238|RCV000237048|RCV000548074; NMONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MedGen:CN517202|MONDO:MONDO:0019011,MedGen:C0751036, Orphanet:657531161276654161276654GANC_000001.10:g.161276654G>AClinGen:CA257152,UniProtKB:P25189#VAR_004518,OMIM:159440.0010
NM_000530.8(MPZ):c.286A>G (p.Lys96Glu)4359MPZPathogenicrs121913583RCV000015229|RCV000812845|RCV000789440; NMONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MONDO:MONDO:0019011,MedGen:C0751036, Orphanet:65753|MONDO:MONDO:0015626,MedGen:C0007959,OMIM:PS118220, Orphanet:1661161276660161276660TCNC_000001.10:g.161276660T>CClinGen:CA257142,UniProtKB:P25189#VAR_004517,OMIM:159440.0001C0270912 118200 Charcot-Marie-Tooth disease, demyelinating, type 1b;
NM_000530.8(MPZ):c.276G>A (p.Val92=)4359MPZLikely pathogenicrs1558154193RCV000015264|RCV000790070|RCV000795131; NMONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MONDO:MONDO:0015626,MedGen:C0007959,OMIM:PS118220, Orphanet:166|MONDO:MONDO:0019011,MedGen:C0751036, Orphanet:657531161276670161276670CTNC_000001.10:g.161276670C>TOMIM:159440.0035C0270912 118200 Charcot-Marie-Tooth disease, demyelinating, type 1b;
NM_000530.8(MPZ):c.270C>A (p.Asp90Glu)4359MPZPathogenicrs121913584RCV000015230|RCV000704216|RCV000789441; NMONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MONDO:MONDO:0019011,MedGen:C0751036, Orphanet:65753|MONDO:MONDO:0015626,MedGen:C0007959,OMIM:PS118220, Orphanet:1661161276676161276676GTNC_000001.10:g.161276676G>TClinGen:CA257144,UniProtKB:P25189#VAR_004515,OMIM:159440.0002C0270912 118200 Charcot-Marie-Tooth disease, demyelinating, type 1b;
NM_000530.8(MPZ):c.266T>C (p.Ile89Thr)4359MPZPathogenicrs267607244RCV000033915; NMONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:1010821161276680161276680AG1:g.161276680A>GClinGen:CA343900C0270912 118200 Charcot-Marie-Tooth disease, demyelinating, type 1b;
NM_000530.8(MPZ):c.244T>C (p.Tyr82His)4359MPZPathogenicrs281865124RCV000033914|RCV000693764|RCV000789426|RCV001699102; NMONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MONDO:MONDO:0019011,MedGen:C0751036, Orphanet:65753|MONDO:MONDO:0015626,MedGen:C0007959,OMIM:PS118220, Orphanet:166|MedGen:CN5172021161276702161276702AGNC_000001.10:g.161276702A>GClinGen:CA343897C0270912 118200 Charcot-Marie-Tooth disease, demyelinating, type 1b;
NM_000530.8(MPZ):c.242A>G (p.His81Arg)4359MPZPathogenicrs121913594RCV000015242|RCV000518134|RCV000789479|RCV001385507; NMONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MedGen:CN517202|MONDO:MONDO:0015626,MedGen:C0007959,OMIM:PS118220, Orphanet:166|MONDO:MONDO:0019011,MedGen:C0751036, Orphanet:657531161276704161276704TCNC_000001.10:g.161276704T>CClinGen:CA341323,UniProtKB:P25189#VAR_004513,OMIM:159440.0014C0270912 118200 Charcot-Marie-Tooth disease, demyelinating, type 1b;
NM_000530.8(MPZ):c.241C>T (p.His81Tyr)4359MPZConflicting interpretations of pathogenicityrs281865123RCV000033913|RCV000789424; NMONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MONDO:MONDO:0015626,MedGen:C0007959,OMIM:PS118220, Orphanet:1661161276705161276705GANC_000001.10:g.161276705G>AUniProtKB:P25189#VAR_031888,ClinVar:208147,ClinGen:CA343894C0270912 118200 Charcot-Marie-Tooth disease, demyelinating, type 1b;
NM_000530.8(MPZ):c.233C>T (p.Ser78Leu)4359MPZPathogenicrs121913601RCV000015252|RCV000201182|RCV000436362|RCV000546842|RCV001173691; NMedGen:C4016266|MONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MedGen:CN517202|MONDO:MONDO:0019011,MedGen:C0751036, Orphanet:65753|MONDO:MONDO:0015626,MedGen:C0007959,OMIM:PS118220, Orphanet:1661161277049161277049GANC_000001.10:g.161277049G>AClinGen:CA123805,UniProtKB:P25189#VAR_004512,OMIM:159440.0023
NM_000530.8(MPZ):c.224A>T (p.Asp75Val)4359MPZPathogenicrs121913597RCV000015248|RCV000190346|RCV001070451; NMONDO:MONDO:0011903,MedGen:C1843153,OMIM:607736, Orphanet:99943|MONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MONDO:MONDO:0019011,MedGen:C0751036, Orphanet:657531161277058161277058TA1:g.161277058T>AClinGen:CA257160,UniProtKB:P25189#VAR_015973,OMIM:159440.0019C0007959 Charcot-Marie-Tooth disease;
NM_000530.8(MPZ):c.200G>A (p.Arg67His)4359MPZConflicting interpretations of pathogenicityrs201720099RCV000228125|RCV000479710|RCV001097629|RCV001097630|RCV001097631|RCV001097632|RCV001174319|RCV001812639; NMONDO:MONDO:0019011,MedGen:C0751036, Orphanet:65753|MedGen:CN169374|MONDO:MONDO:0020765,MedGen:C4722277,OMIM:618184|MONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MONDO:MONDO:0011909,MedGen:C1843075,OMIM:607791, Orphanet:100046|MONDO:MOND1161277082161277082CT1:g.161277082C>TClinGen:CA1210217C0751036 Charcot-Marie-Tooth disease, type I;
NM_000530.8(MPZ):c.188_190del (p.Ser63del)4359MPZPathogenicrs879254109RCV000015231|RCV000235309|RCV000535237|RCV000790083; NMONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MedGen:CN517202|MONDO:MONDO:0019011,MedGen:C0751036, Orphanet:65753|MONDO:MONDO:0015626,MedGen:C0007959,OMIM:PS118220, Orphanet:1661161277092161277094AAGGANC_000001.10:g.161277094_161277096delClinGen:CA10584145,OMIM:159440.0003
NM_000530.8(MPZ):c.188C>T (p.Ser63Phe)4359MPZPathogenic/Likely pathogenicrs121913585RCV000015240|RCV001224917|RCV001173697; NMONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MONDO:MONDO:0019011,MedGen:C0751036, Orphanet:65753|MONDO:MONDO:0015626,MedGen:C0007959,OMIM:PS118220, Orphanet:1661161277094161277094GA1:g.161277094G>AClinGen:CA257156,UniProtKB:P25189#VAR_004509,OMIM:159440.0012C0270912 118200 Charcot-Marie-Tooth disease, demyelinating, type 1b;
NM_000530.8(MPZ):c.184A>G (p.Ile62Val)4359MPZUncertain significancers121913602RCV001099393|RCV001099394|RCV001099395|RCV001099396; NMONDO:MONDO:0011909,MedGen:C1843075,OMIM:607791, Orphanet:100046|MONDO:MONDO:0020765,MedGen:C4722277,OMIM:618184|MONDO:MONDO:0008392,MedGen:C0205713,OMIM:180800, Orphanet:3115|MONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:1010821161277098161277098TC1:g.161277098T>C-
NM_000530.8(MPZ):c.181G>A (p.Asp61Asn)4359MPZPathogenicrs797044845RCV000193325|RCV000688094|RCV000789423|RCV000992318; NMONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MONDO:MONDO:0019011,MedGen:C0751036, Orphanet:65753|MONDO:MONDO:0015626,MedGen:C0007959,OMIM:PS118220, Orphanet:166|MedGen:CN5172021161277101161277101CTNC_000001.10:g.161277101C>TClinGen:CA347381C0270912 118200 Charcot-Marie-Tooth disease, demyelinating, type 1b;
NM_000530.8(MPZ):c.175T>A (p.Ser59Thr)4359MPZPathogenicrs281865122RCV000033912; NMONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:1010821161277107161277107AT1:g.161277107A>TClinGen:CA343891C0270912 118200 Charcot-Marie-Tooth disease, demyelinating, type 1b;
NM_000530.8(MPZ):c.164G>T (p.Ser55Ile)4359MPZConflicting interpretations of pathogenicityrs281865133RCV000033922|RCV000790077; NMONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MONDO:MONDO:0015626,MedGen:C0007959,OMIM:PS118220, Orphanet:1661161277118161277118CANC_000001.10:g.161277118C>AClinGen:CA343911C0270912 118200 Charcot-Marie-Tooth disease, demyelinating, type 1b;
NM_000530.8(MPZ):c.131C>T (p.Ser44Phe)4359MPZPathogenicrs121913598RCV000015249|RCV000190345|RCV000638152|RCV001093014|RCV000790099; NMONDO:MONDO:0011889,MedGen:C3888087,OMIM:607677, Orphanet:99942|MONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MONDO:MONDO:0019011,MedGen:C0751036, Orphanet:65753|MedGen:CN517202|MONDO:MONDO:0015626,MedGen:C0007959,OMIM:PS118220, Orphanet:1161277151161277151GANC_000001.10:g.161277151G>AClinGen:CA257162,UniProtKB:P25189#VAR_004503,OMIM:159440.0020C3888087 607677 Charcot-Marie-Tooth disease type 2I;
NM_000530.8(MPZ):c.89T>C (p.Ile30Thr)4359MPZLikely pathogenicrs281865121RCV000033911|RCV000789434|RCV001051613; NMONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|MONDO:MONDO:0007790,MedGen:C0011195,OMIM:145900, Orphanet:64748|MONDO:MONDO:0019011,MedGen:C0751036, Orphanet:657531161277193161277193AGNC_000001.10:g.161277193A>GClinGen:CA343888C0270912 118200 Charcot-Marie-Tooth disease, demyelinating, type 1b;
NM_000530.8(MPZ):c.-49C>A4359MPZConflicting interpretations of pathogenicityrs750777955RCV000306731|RCV000347617|RCV000396893|RCV000396895|RCV001093888; NMONDO:MONDO:0011527,MedGen:C4721436,OMIM:605253, Orphanet:99951|MONDO:MONDO:0011909,MedGen:C1843075,OMIM:607791, Orphanet:100046|MONDO:MONDO:0008392,MedGen:C0205713,OMIM:180800, Orphanet:3115|MONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:101082|1161279744161279744GT1:g.161279744G>TClinGen:CA1210268C0751036 Charcot-Marie-Tooth disease, type I;
Single allele-1SDHC;MPZLikely pathogenic-1RCV000235057; NMONDO:MONDO:0007307,MedGen:C0270912,OMIM:118200, Orphanet:1010821161279434161299373nana-C1968689 243700 Hyperimmunoglobulin E recurrent infection syndrome, autosomal recessive;
MSeqDR Portal