MSeqDR Mitochondrial Disease Portal

*:HP: HPO terms, UMDF: 1= Disease, ND: NAMDC terms.
  Most Studied  CPEO, Complex I Deficiency, COXPD1, Leigh, LHON, MELAS, MERRF, Myopathy, SANDO
Disease Browser
Parent Node:
Lipid Metabolism, Inborn Errors (D008052)
Parent Node:
Mitochondrial Diseases (D028361)
Parent Node:
Muscular Diseases (D009135)
..Starting node
VLCAD deficiency (C536353)

       Child Nodes:

 Sister Nodes: 
..expandAlpha-B Crystallinopathy (C563848)
..expandAnal Sphincter Myopathy, Internal (C566287)
..expandAplasia of Extensor Muscles of Fingers, Unilateral, with Generalized Polyneuropathy (C565945)
..expandArthrogryposis (D001176) Child55
..expandCamptodactyly, fibrous tissue hyperplasia, and skeletal dysplasia (C537974)
..expandCarnitine Palmitoyltransferase II Deficiency, Late-Onset (C563461)  LSDB  L: 00486;
..expandCompartment Syndromes (D003161) Child3
..expandContracture (D003286) Child41
..expandCraniomandibular Disorders (D017271) Child4
..expandDimauro disease (C536176)
..expandEncephalopathy, Axonal, with Necrotizing Myopathy, Cardiomyopathy, and Cataracts (C565596)
..expandEosinophilia-Myalgia Syndrome (D016603)
..expandEpiphyseal Dysplasia, Multiple, with Myopathy (C563420)
..expandErythrocyte Amp Deaminase Deficiency (C567878)
..expandErythrocyte Lactate Transporter Defect (C565449)
..expandFatigue Syndrome, Chronic (D015673)
..expandFibromyalgia (D005356)
..expandFingerprint Body Myopathy (C564425)
..expandHereditary Myopathy with Early Respiratory Failure (C566343)
..expandHypertrophia Musculorum Vera (C564152)
..expandIsaacs Syndrome (D020386)
..expandKocher-Debre-Semelaigne syndrome (C537211)
..expandMarinesco-Sjogren-like syndrome (MSLS) (C535913)
..expandMedial Tibial Stress Syndrome (D058923)
..expandMesoectodermal dysplasia (C538472)
..expandMitochondrial DNA Depletion Syndrome, Myopathic Form (C563698)
..expandMitochondrial Myopathies (D017240) Child33  LSDB C:22 L: 00400;
..expandMuscle Cramp (D009120) Child3
..expandMuscle Neoplasms (D019042)
..expandMuscle Rigidity (D009127) Child3
..expandMuscle Spasticity (D009128) Child17
..expandMuscle Weakness (D018908) Child5  LSDB C:2
..expandMuscular Disorders, Atrophic (D020966) Child120  LSDB C:1
..expandMuscular Hypoplasia, Congenital Universal, of Krabbe (C563553)
..expandMusculoskeletal Pain (D059352) Child2
..expandMyalgia (D063806)
..expandMyofascial Pain Syndromes (D009209) Child1
..expandMyopathic carnitine deficiency (C536100)
..expandMyopathies, Structural, Congenital (D020914) Child34
..expandMyopathy due to Malate-Aspartate Shuttle Defect (C564973)
..expandMyopathy with Giant Abnormal Mitochondria (C564971)  LSDB  L: 00409;
..expandMyopathy with Lactic Acidosis, Hereditary (C564972)  LSDB  L: 00476;
..expandMyopathy, Cataract, Hypogonadism Syndrome (C563578)
..expandMyopathy, congenital nonprogressive with Moebius and Robin sequences (C536102)
..expandMyopathy, Congenital, With Excess Of Muscle Spindles (C566896)
..expandMyopathy, Early-Onset, with Fatal Cardiomyopathy (C567129)
..expandMyopathy, Granulovacuolar Lobular, with Electrical Myotonia (C564974)
..expandMyopathy, Hyaline Body, Autosomal Recessive (C564970)
..expandMyopathy, Myosin Storage (C564253)
..expandMyopathy, Reducing Body, X-Linked, Childhood-Onset (C567468)
..expandMyopathy, Reducing Body, X-Linked, Early-Onset, Severe (C567469)
..expandMyopathy, X-Linked, with Excessive Autophagy (C564093)
..expandMyositis (D009220) Child16
..expandMyostatin-related muscle hypertrophy (C536106)
..expandMyotonic Disorders (D020967) Child10
..expandNeutral Lipid Storage Disease with Myopathy (C565192)
..expandOphthalmoplegic Neuromuscular Disorder with Abnormal Mitochondria (C564925)  LSDB  L: 00410;
..expandOptic Atrophy, Deafness, Ophthalmoplegia, and Myopathy (C565117)
..expandParalyses, Familial Periodic (D010245) Child7
..expandPectoralis Muscle, Absence of (C566793)
..expandPolymyalgia Rheumatica (D011111)
..expandProximal Myopathy with Focal Depletion of Mitochondria (C563453)  LSDB  L: 00412;
..expandRhabdomyolysis (D012206) Child6  LSDB C:2
..expandRippling muscle disease, 1 (C535686)
..expandSalih Myopathy (C580430)
..expandSecretory Diarrhea, Myopathy, and Deafness (C564382)
..expandSingleton Merten syndrome (C537343)
..expandSystemic carnitine deficiency (C536778)  LSDB  L: 00473;
..expandTel Hashomer camptodactyly syndrome (C536953)
..expandTendinopathy (D052256) Child5
..expandTreft Sanborn Carey syndrome (C536544)
..expandTriglyceride storage disease with impaired long-chain fatty acid oxidation (C536560)
..expandUruguay Faciocardiomusculoskeletal Syndrome (C564544)
..expandVacuolar myopathy (C536522)
..expandVLCAD deficiency (C536353)  LSDB  L: 00436;

Human Disease MESH is developed by UMLS.
Further data from MedGen, OMIM,ClinVar, CTD
Term ID:11649
Name:VLCAD deficiency
Alternative IDs:OMIM:201475
TreeNumbers:C05.651/C536353 |C10.668.491/C536353 |C16.320.565.398/C536353 |C18.452.584.562/C536353 |C18.452.648.398/C536353 |C18.452.660/C536353
Synonyms:Acadvl |ACADVLD |Acyl-Coa Dehydrogenase Very Long Chain Deficiency |Acyl-CoA Dehydrogenase, Very Long-Chain, Deficiency of |Pearson Marrow-Pancreas Syndrome |Pearson's marrow-pancreas syndrome |Sideroblastic anemia with marrow cell vacuolization and exocrine p
Slim Mappings:Genetic disease (inborn)|Metabolic disease|Musculoskeletal disease|Nervous system disease
Reference: MedGen: C536353
MeSH: C536353
OMIM: 201475;
MSeqDR LSDB: 00436;  
Genes: ACADVL;
1 HP:0000007Autosomal recessive inheritance
2 HP:0003234Decreased plasma carnitine
3 HP:0003215Dicarboxylic aciduria
4 HP:0003236Elevated serum creatine phosphokinase
5 HP:0003738Exercise-induced myalgia
6 HP:0008305Exercise-induced myoglobinuria
7 HP:0009045Exercise-induced rhabdomyolysis
8 HP:0001397Hepatic steatosis
NAMDC:  Hepatopathy with steatosis or oncocytic changes by liver biopsy
9 HP:0001404Hepatocellular necrosis
10 HP:0002240Hepatomegaly
11 HP:0001639Hypertrophic cardiomyopathy
NAMDC:  Hypertrophic cardomyopathy
12 HP:0001254Lethargy
13 HP:0003552Muscle stiffness
14 HP:0001324Muscle weakness
NAMDC:  Muscle weakness: diffuse
15 HP:0001252Muscular hypotonia
NAMDC:  Hypotonia
16 HP:0001958Nonketotic hypoglycemia
17 HP:0001645Sudden cardiac death
18 HP:0002789Tachypnea
19 HP:0002013Vomiting
Disease Causing ClinVar Variants
NM_001608.3(ACADL):c.*928A>G33ACADLUncertain significance75520497RCV000312539; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970052211052757211052757-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_001608.3(ACADL):c.*724T>C33ACADLUncertain significance149291223RCV000367324; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970052211052961211052961-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_001608.3(ACADL):c.*711G>A33ACADLUncertain significance886055549RCV000277419; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970052211052974211052974-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_001608.3(ACADL):c.*621G>A33ACADLUncertain significance886055550RCV000332204; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970052211053064211053064-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_001608.3(ACADL):c.*530T>C33ACADLUncertain significance191601306RCV000382177; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970052211053155211053155-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_001608.3(ACADL):c.1144G>A (p.Asp382Asn)33ACADLUncertain significance774103658RCV000269134; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970052211057583211057583-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_001608.3(ACADL):c.997A>C (p.Lys333Gln)33ACADLBenign2286963RCV000328841; RCV000115027; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172022211060050211060050OMIM Allelic Variant:609576.0001,UniProtKB (protein):P28330#VAR_000329CN517202 not provided;
NM_001608.3(ACADL):c.992A>G (p.Gln331Arg)33ACADLUncertain significance199818269RCV000383103; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970052211060055211060055-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_001608.3(ACADL):c.939T>C (p.Tyr313=)33ACADLUncertain significance148069105RCV000284006; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970052211068100211068100-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_001608.3(ACADL):c.654C>T (p.Val218=)33ACADLLikely benign77160779RCV000338950; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970052211070470211070470-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_001608.3(ACADL):c.651G>A (p.Ala217=)33ACADLUncertain significance76781609RCV000379569; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970052211070473211070473-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_001608.3(ACADL):c.629G>A (p.Ser210Asn)33ACADLUncertain significance777252645RCV000285284; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970052211070495211070495-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_001608.3(ACADL):c.621G>T (p.Gly207=)33ACADLUncertain significance150844488RCV000335578; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970052211070503211070503-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_001608.3(ACADL):c.603+11A>G33ACADLBenign3764913RCV000403038; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970052211074909211074909-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_001608.3(ACADL):c.374C>T (p.Ala125Val)33ACADLUncertain significance571156599RCV000300623; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970052211081233211081233-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_001608.3(ACADL):c.253G>A (p.Val85Ile)33ACADLUncertain significance886055551RCV000350299; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970052211082807211082807-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_001608.3(ACADL):c.233+13T>C33ACADLUncertain significance750412940RCV000406063; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970052211085358211085358-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_001608.3(ACADL):c.113C>T (p.Thr38Ile)33ACADLLikely benign61731470RCV000315201; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970052211085491211085491-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_001608.3(ACADL):c.94G>A (p.Gly32Arg)33ACADLUncertain significance767313935RCV000369859; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970052211085510211085510-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_001608.3(ACADL):c.86A>G (p.His29Arg)33ACADLUncertain significance546630522RCV000270501; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970052211085518211085518-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_001608.3(ACADL):c.7G>T (p.Ala3Ser)33ACADLUncertain significance763274790RCV000306957; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970052211089981211089981-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_001270447.1(ACADVL):c.28+1G>A37ACADVLUncertain significance1555526472RCV000673715; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771204937120493-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_001270447.1(ACADVL):c.52A>G (p.Ile18Val)37ACADVLUncertain significance730880036RCV000157090; RCV000666003; NMedGen:C0949658, Orphanet:ORPHA155,SNOMED CT:83978005; MedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771210587121058-C0949658 Primary familial hypertrophic cardiomyopathy;
NM_001270447.1(ACADVL):c.61_66dup (p.Ala22_Gln23insGluAla)37ACADVLUncertain significance1555526655RCV000665391; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771210597121059-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.-2231C>T37ACADVLUncertain significance1237915800RCV000665785; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771210737121073-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.-2216C>T37ACADVLUncertain significance1555526667RCV000673132; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771210887121088-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.-2209G>A37ACADVLUncertain significance1555526671RCV000668479; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771210957121095-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NG_007975.1:g.2965_2970dup37ACADVLUncertain significance1258394272RCV000664571; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771211157121115-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_001270447.1(ACADVL):c.115_119del (p.Thr39Lysfs)37ACADVLUncertain significance1178274476RCV000673163; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771211207121125-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.-132C>T37ACADVLUncertain significance886053371RCV000400753; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771231727123172-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.-65_-64ins1537ACADVLUncertain significance1555527385RCV000668084; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771232327123232-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.-72_-71ins1537ACADVLUncertain significance1555527381RCV000668330; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771232327123232-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.-64T>C37ACADVLUncertain significance77051465RCV000299039; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771232407123240-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.-52_-51ins1537ACADVLUncertain significance1555527401RCV000670373; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771232407123240-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.-50_-49ins3037ACADVLUncertain significance1555527393RCV000674467; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771232407123240-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.-49_-48ins2337ACADVLUncertain significance6145976RCV000671629; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771232407123240-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.-63_-49dupGGGCGTGCAGGACGC37ACADVLBenign6145976RCV000335414; RCV000152731; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN1693741771232417123255-CN169374 not specified;
NM_000018.3(ACADVL):c.-49_-48ins3037ACADVLUncertain significance753389263RCV000667551; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771232417123241-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.-49_-48ins1537ACADVLUncertain significance1555527399RCV000668563; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771232557123255-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.-36A>G37ACADVLConflicting interpretations of pathogenicity372592554RCV000398787; RCV000434907; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN1693741771232687123268-CN169374 not specified;
NM_000018.3(ACADVL):c.3G>A (p.Met1Ile)37ACADVLLikely pathogenic768236474RCV000671153; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771233067123306-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.16_32del17 (p.Met6Alafs)37ACADVLLikely pathogenic1555527450RCV000667776; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771233167123333-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.33delG (p.Arg12Glyfs)37ACADVLLikely pathogenic1555527464RCV000673805; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771233327123333-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.49C>T (p.Leu17Phe)37ACADVLBenign/Likely benign2230179RCV000020078; RCV000224359; RCV000251701; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN517202; MedGen:CN1693741771233527123352UniProtKB (protein):P49748#VAR_029286CN517202 not provided;
NM_000018.3(ACADVL):c.54G>A (p.Gly18=)37ACADVLLikely benign759918601RCV000533108; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771233577123357-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.62+6T>C37ACADVLUncertain significance1555527495RCV000664668; RCV000498130; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771233717123371-CN517202 not provided;
NM_000018.3(ACADVL):c.62+9G>A37ACADVLLikely benign369512281RCV000671685; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771233747123374-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.62+10delT37ACADVLLikely benign1251002707RCV000671242; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771233747123375-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.62+18G>A37ACADVLLikely benign780776419RCV000671211; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771233837123383-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_001270448.1(ACADVL):c.-197C>T37ACADVLLikely benign372982295RCV000671357; RCV000508529; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN1693741771234107123410-CN169374 not specified;
NM_000018.3(ACADVL):c.63-18A>G37ACADVLLikely benign1481782237RCV000670892; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771234237123423-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.63-2A>C37ACADVLLikely pathogenic1555527513RCV000531909; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771234397123439-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.65C>A (p.Ser22Ter)37ACADVLPathogenic727503788RCV000175507; RCV000152732; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771234437123443HGMD:CM001606CN517202 not provided;
NM_000018.3(ACADVL):c.68G>A (p.Arg23Gln)37ACADVLBenign/Likely benign34153370RCV000020079; RCV000755204; RCV000444066; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN517202; MedGen:CN1693741771234467123446-CN169374 not specified;
NM_000018.3(ACADVL):c.86G>A (p.Gly29Glu)37ACADVLUncertain significance1247979958RCV000652040; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771234647123464-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.95G>A (p.Arg32Gln)37ACADVLUncertain significance-1RCV000690917; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771234737123473-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.105_109dup (p.Arg37Leufs)37ACADVLLikely pathogenic1555527532RCV000665413; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771234787123478-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.103_112delCCTGCCCGGC (p.Pro35Glyfs)37ACADVLPathogenic1329022268RCV000652031; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771234817123490-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.104delC (p.Pro35Leufs)37ACADVLPathogenic1443151475RCV000652036; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771234827123482-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.109C>T (p.Arg37Trp)37ACADVLUncertain significance536992268RCV000367977; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771234877123487-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.121G>A (p.Ala41Thr)37ACADVLUncertain significance-1RCV000690439; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771234997123499-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.128G>A (p.Gly43Asp)37ACADVLBenign/Likely benign2230178RCV000020071; RCV000253810; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN1693741771235067123506UniProtKB (protein):P49748#VAR_000330CN169374 not specified;
NM_000018.3(ACADVL):c.138+1G>A37ACADVLLikely pathogenic747351687RCV000665642; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771235177123517-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.138+2T>C37ACADVLLikely pathogenic1057516817RCV000410269; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771235187123518-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.138+2dup37ACADVLConflicting interpretations of pathogenicity1555527548RCV000666464; RCV000523516; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771235187123518-CN517202 not provided;
NM_000018.3(ACADVL):c.139-3C>T37ACADVLUncertain significance1555527630RCV000671543; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771237807123780-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.180G>C (p.Leu60=)37ACADVLUncertain significance886053372RCV000315448; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771238247123824-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.192delA (p.Lys64Asnfs)37ACADVLLikely pathogenic771055189RCV000669061; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771238307123831-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.192dup (p.Pro65Thrfs)37ACADVLPathogenic-1RCV000690630; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771238367123836-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.194C>T (p.Pro65Leu)37ACADVLBenign/Likely benign28934585RCV000001698; RCV000020076; RCV000420053; RCV000077913; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN517202; MedGen:CN1693741771238387123838OMIM Allelic Variant:609575.0011,UniProtKB (protein):P49748#VAR_048176CN517202 not provided;
NM_000018.3(ACADVL):c.204+5G>A37ACADVLUncertain significance958328801RCV000668790; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771238537123853-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.204+15G>A37ACADVLLikely benign1404625751RCV000672068; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771238637123863-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.204+31dup37ACADVLLikely benign1555527700RCV000666685; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771238787123878-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.205-8C>G37ACADVLUncertain significance774353448RCV000270843; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771239157123915-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.205-7T>C37ACADVLUncertain significance760625298RCV000325779; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771239167123916-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.205-5C>G37ACADVLUncertain significance768537914RCV000668373; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771239187123918-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.227G>A (p.Gly76Glu)37ACADVLUncertain significance750043368RCV000669555; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771239457123945-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.230T>C (p.Met77Thr)37ACADVLUncertain significance1555527718RCV000666717; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771239487123948-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.251_252delCA (p.Thr84Argfs)37ACADVLLikely pathogenic1452339268RCV000667548; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771239667123968-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.256C>T (p.Gln86Ter)37ACADVLLikely pathogenic1555527732RCV000667158; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771239747123974-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.266delC (p.Pro89Hisfs)37ACADVLPathogenic/Likely pathogenic771808680RCV000667604; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771239817123982-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.277+1delG37ACADVLLikely pathogenic1555527741RCV000665640; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771239947123995-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.277+1G>T37ACADVLLikely pathogenic1057517012RCV000412197; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771239967123996-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.277+2T>G37ACADVLLikely pathogenic1555527745RCV000672219; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771239977123997-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.277+6G>T37ACADVLUncertain significance776422793RCV000652046; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771240017124001-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.277+24T>C37ACADVLLikely benign199945418RCV000671544; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771240197124019-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.277+27delG37ACADVLLikely benign775298132RCV000671358; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771240197124020-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.278-39C>T37ACADVLLikely benign202244937RCV000671343; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771240467124046-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.278-8C>T37ACADVLUncertain significance1178133251RCV000671740; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771240777124077-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.278T>C (p.Val93Ala)37ACADVLUncertain significance886053373RCV000385029; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771240857124085-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.286G>A (p.Glu96Lys)37ACADVLUncertain significance-1RCV000703241; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771240937124093-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.298_299delCA (p.Gln100Valfs)37ACADVLPathogenic/Likely pathogenic786204713RCV000169528; RCV000724267; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771241057124106-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.299_305del7 (p.Gln100Leufs)37ACADVLLikely pathogenic1555527806RCV000673162; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771241057124112-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.308A>G (p.Lys103Arg)37ACADVLBenign140566084RCV000526707; RCV000241751; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN1693741771241157124115-CN169374 not specified;
NM_000018.3(ACADVL):c.308_309delAA (p.Lys103Argfs)37ACADVLLikely pathogenic1057516979RCV000410821; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771241157124116-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.331_339del9 (p.Arg111_Phe113del)37ACADVLUncertain significance1555527820RCV000667871; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771241367124145-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.339C>A (p.Phe113Leu)37ACADVLUncertain significance750653177RCV000541584; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771241467124146-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.340G>A (p.Glu114Lys)37ACADVLUncertain significance557260142RCV000652033; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771241477124147-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.342+1G>C37ACADVLPathogenic780020193RCV000556138; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771241507124150-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.342+14C>T37ACADVLLikely benign567468883RCV000671615; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771241637124163-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.342+15G>A37ACADVLLikely benign777751102RCV000671604; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771241647124164-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.342+16G>C37ACADVLLikely benign536497611RCV000671687; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771241657124165-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.342+25C>T37ACADVLLikely benign771711857RCV000672069; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771241747124174-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.343-41C>A37ACADVLLikely benign368107662RCV000671327; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771242027124202-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.343-23G>A37ACADVLLikely benign781064781RCV000666049; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771242207124220-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.343delG (p.Glu115Lysfs)37ACADVLPathogenic/Likely pathogenic387906249RCV000001691; RCV000077915; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771242437124243HGMD:CD961740,OMIM Allelic Variant:609575.0004,OMIM Allelic Variant:609575.0005CN517202 not provided;
NM_000018.4(ACADVL):c.364A>G (p.Asn122Asp)37ACADVLConflicting interpretations of pathogenicity1057520088RCV000690847; RCV000432463; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771242647124264-CN517202 not provided;
NM_000018.3(ACADVL):c.374T>C (p.Leu125Pro)37ACADVLUncertain significance-1RCV000706914; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771242747124274-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.388_390delGAG (p.Glu130del)37ACADVLPathogenic/Likely pathogenic387906251RCV000001693; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771242887124290OMIM Allelic Variant:609575.0006C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.393C>G (p.Thr131=)37ACADVLLikely benign754931255RCV000530066; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771242937124293-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.398G>A (p.Trp133Ter)37ACADVLLikely pathogenic1555527907RCV000675043; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771242987124298-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.428_467del40 (p.Gly143Alafs)37ACADVLPathogenic/Likely pathogenic758144859RCV000671508; RCV000480851; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771243287124367-CN517202 not provided;
NM_000018.3(ACADVL):c.431T>C (p.Leu144Pro)37ACADVLUncertain significance1555527925RCV000652038; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771243317124331-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.433C>T (p.Gln145Ter)37ACADVLLikely pathogenic786204738RCV000169585; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771243337124333-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.439C>T (p.Pro147Ser)37ACADVLUncertain significance1032857886RCV000673732; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771243397124339-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.478-1G>C37ACADVLLikely pathogenic1057517130RCV000411583; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771248567124856-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.481G>A (p.Ala161Thr)37ACADVLUncertain significance375284481RCV000271784; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771248607124860-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.482C>T (p.Ala161Val)37ACADVLConflicting interpretations of pathogenicity796051908RCV000675132; RCV000185711; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771248617124861-CN517202 not provided;
NM_000018.3(ACADVL):c.497_498delTC (p.Ile166Serfs)37ACADVLLikely pathogenic1057516369RCV000412008; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771248767124877-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.4(ACADVL):c.520G>A (p.Val174Met)37ACADVLPathogenic/Likely pathogenic369560930RCV000179696; RCV000077919; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771248997124899HGMD:CM990084,UniProtKB (protein):P49748#VAR_000334CN517202 not provided;
NM_000018.3(ACADVL):c.535G>T (p.Gly179Trp)37ACADVLUncertain significance796051909RCV000671223; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771249147124914-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.538G>A (p.Ala180Thr)37ACADVLConflicting interpretations of pathogenicity727503791RCV000675106; RCV000152735; RCV000259047; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN517202; MedGen:CN1693741771249177124917-CN517202 not provided;
NM_000018.3(ACADVL):c.542A>G (p.His181Arg)37ACADVLUncertain significance1425862331RCV000554955; RCV000594820; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771249217124921-CN169374 not specified;
NM_000018.4(ACADVL):c.553G>A (p.Gly185Ser)37ACADVLPathogenic/Likely pathogenic545215807RCV000412436; RCV000185742; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771249327124932UniProtKB (protein):P49748#VAR_000335CN517202 not provided;
NM_000018.3(ACADVL):c.578G>A (p.Gly193Asp)37ACADVLConflicting interpretations of pathogenicity1220348903RCV000673457; RCV000498240; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771249577124957-CN517202 not provided;
NM_000018.3(ACADVL):c.603C>G (p.Tyr201Ter)37ACADVLLikely pathogenic371407903RCV000670134; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771249827124982-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.619T>C (p.Ser207Pro)37ACADVLUncertain significance768975918RCV000666689; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771249987124998-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.623-8C>T37ACADVLConflicting interpretations of pathogenicity144996066RCV000322156; RCV000152736; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN1693741771252637125263-CN169374 not specified;
NM_000018.3(ACADVL):c.623-2_623-1delAG37ACADVLLikely pathogenic1555528265RCV000671828; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771252687125270-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.636C>T (p.Ala212=)37ACADVLConflicting interpretations of pathogenicity76547988RCV000376900; RCV000421031; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN1693741771252847125284-CN169374 not specified;
NM_000018.3(ACADVL):c.637G>C (p.Ala213Pro)37ACADVLUncertain significance140629318RCV000702574; RCV000152737; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771252857125285HGMD:CM990086,UniProtKB (protein):P49748#VAR_010101CN169374 not specified;
NM_000018.3(ACADVL):c.637G>A (p.Ala213Thr)37ACADVLConflicting interpretations of pathogenicity140629318RCV000180089; RCV000723371; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771252857125285-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.640T>G (p.Phe214Val)37ACADVLUncertain significance1192969297RCV000652043; RCV000734877; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771252887125288-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.644_647delGTCT (p.Cys215Terfs)37ACADVLLikely pathogenic1057516714RCV000410797; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771252927125295-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.652G>A (p.Glu218Lys)37ACADVLUncertain significance1432183079RCV000556767; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771253007125300-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.652_682dup (p.Ile228Argfs)37ACADVLPathogenic-1RCV000704804; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771253007125330-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.664G>A (p.Gly222Arg)37ACADVLLikely pathogenic398123091RCV000169301; RCV000077922; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771253127125312HGMD:CM101566CN517202 not provided;
NM_000018.3(ACADVL):c.685C>T (p.Arg229Ter)37ACADVLPathogenic/Likely pathogenic786204536RCV000169238; RCV000579295; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771253337125333-CN517202 not provided;
NM_000018.3(ACADVL):c.693T>A (p.Ser231=)37ACADVLConflicting interpretations of pathogenicity77763289RCV000341852; RCV000755777; RCV000123478; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN517202; MedGen:CN1693741771253417125341-CN169374 not specified;
NM_000018.3(ACADVL):c.708_709delCT (p.Cys237Trpfs)37ACADVLLikely pathogenic1555528304RCV000586725; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771253567125357-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.736A>G (p.Ser246Gly)37ACADVLUncertain significance1555528320RCV000559821; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771253847125384-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.739A>C (p.Lys247Gln)37ACADVLno interpretation for the single variant387906253RCV000001698; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771253877125387OMIM Allelic Variant:609575.0011C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.739A>G (p.Lys247Glu)37ACADVLUncertain significance387906253RCV000668561; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771253877125387-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.751A>G (p.Ser251Gly)37ACADVLUncertain significance749159573RCV000373221; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771253997125399-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.752+24C>T37ACADVLLikely benign201030339RCV000671689; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771254247125424-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.753-27C>T37ACADVLBenign/Likely benign374911841RCV000550616; RCV000603826; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN1693741771254697125469-CN169374 not specified;
NM_000018.3(ACADVL):c.753-2A>C37ACADVLPathogenic398123092RCV000180449; RCV000077923; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771254947125494HGMD:CS991281CN517202 not provided;
NM_000018.3(ACADVL):c.756T>C (p.Asn252=)37ACADVLLikely benign143233413RCV000652048; RCV000244168; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN1693741771254997125499-CN169374 not specified;
NM_000018.3(ACADVL):c.759_761delGGG (p.Gly254del)37ACADVLUncertain significance1555528346RCV000673326; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771254997125502-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.757G>A (p.Gly253Arg)37ACADVLUncertain significance1555528345RCV000652028; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771255007125500-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.779C>T (p.Thr260Met)37ACADVLPathogenic/Likely pathogenic113994168RCV000020080; RCV000429481; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771255227125522UniProtKB (protein):P49748#VAR_000339CN517202 not provided;
NM_000018.3(ACADVL):c.799_802delGTTA (p.Val267Glnfs)37ACADVLLikely pathogenic761204548RCV000410749; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771255427125545-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.809delC (p.Pro270Glnfs)37ACADVLPathogenic-1RCV000693564; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771255527125552-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.818G>C (p.Gly273Ala)37ACADVLConflicting interpretations of pathogenicity150149784RCV000549399; RCV000185714; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771255617125561-CN169374 not specified;
NM_000018.3(ACADVL):c.826_849delAAGGAGAAGATCACAGCTTTTGTG (p.Lys276_Val283del)37ACADVLUncertain significance1555528367RCV000652037; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771255697125592-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.829_831delGAG (p.Glu277del)37ACADVLConflicting interpretations of pathogenicity796051913RCV000527513; RCV000185735; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771255727125574-CN517202 not provided;
NM_000018.3(ACADVL):c.833_835delAGA (p.Lys278del)37ACADVLUncertain significance769280599RCV000271659; RCV000723470; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771255767125578-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.848T>C (p.Val283Ala)37ACADVLPathogenic113994167RCV000020081; RCV000077925; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771255917125591HGMD:CM960004,UniProtKB (protein):P49748#VAR_000342CN517202 not provided;
NM_000018.3(ACADVL):c.864C>T (p.Phe288=)37ACADVLLikely benign753748672RCV000552447; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771256077125607-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.864delC (p.Phe288Leufs)37ACADVLPathogenic1555528386RCV000625573; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771256077125607-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.865G>A (p.Gly289Arg)37ACADVLPathogenic/Likely pathogenic200788251RCV000408960; RCV000489455; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771256087125608-CN517202 not provided;
NM_000018.3(ACADVL):c.869dupG (p.Ile291Hisfs)37ACADVLPathogenic886044671RCV000404620; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771256127125612-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.4(ACADVL):c.881G>A (p.Gly294Glu)37ACADVLConflicting interpretations of pathogenicity200573371RCV000530883; RCV000185715; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771259887125988UniProtKB (protein):P49748#VAR_000344CN517202 not provided;
NM_000018.3(ACADVL):c.881_884dupGGCC (p.Pro296Alafs)37ACADVLLikely pathogenic766192888RCV000409715; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771259887125991-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.887_888delCT (p.Pro296Argfs)37ACADVLPathogenic/Likely pathogenic753108198RCV000169392; RCV000185736; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771259947125995-CN517202 not provided;
NM_000018.3(ACADVL):c.891delG (p.Lys298Argfs)37ACADVLLikely pathogenic1057517180RCV000412387; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771259987125998-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.896_898delAGA (p.Lys299del)37ACADVLConflicting interpretations of pathogenicity387906252RCV000001694; RCV000077926; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771260037126005HGMD:CD961742,OMIM Allelic Variant:609575.0007CN517202 not provided;
NM_000018.3(ACADVL):c.898A>G (p.Met300Val)37ACADVLUncertain significance1026112888RCV000665146; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771260057126005-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_001270448.1(ACADVL):c.679A>G (p.Lys227Glu)37ACADVLUncertain significance369149696RCV000689725; RCV000506644; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN1693741771260147126014-CN169374 not specified;
NM_000018.3(ACADVL):c.932delT (p.Phe311Serfs)37ACADVLLikely pathogenic764488310RCV000670204; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771260377126038-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.944T>G (p.Val315Gly)37ACADVLUncertain significance1555528469RCV000674305; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771260517126051-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.947G>A (p.Arg316Gln)37ACADVLUncertain significance147366714RCV000555764; RCV000755205; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771260547126054-CN169374 not specified;
NM_001270448.1(ACADVL):c.722T>C (p.Val241Ala)37ACADVLUncertain significance398123095RCV000706679; RCV000723572; RCV000077927; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN517202; MedGen:CN1693741771260577126057HGMD:CM960007,UniProtKB (protein):P49748#VAR_000347CN169374 not specified;
NM_001270448.1(ACADVL):c.725C>T (p.Pro242Leu)37ACADVLConflicting interpretations of pathogenicity201676770RCV000529486; RCV000506254; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN1693741771260607126060-CN169374 not specified;
NM_000018.3(ACADVL):c.956C>A (p.Ser319Ter)37ACADVLLikely pathogenic149467828RCV000673848; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771260637126063-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.969G>A (p.Leu323=)37ACADVLUncertain significance749734276RCV000338520; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771260767126076-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.992A>C (p.Lys331Thr)37ACADVLUncertain significance727503792RCV000694458; RCV000152738; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771260997126099-CN169374 not specified;
NM_000018.3(ACADVL):c.994G>A (p.Val332Ile)37ACADVLUncertain significance775761275RCV000390406; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771261017126101-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.996delT (p.Ala333Profs)37ACADVLLikely pathogenic1057516843RCV000410931; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771261037126103-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.996dupT (p.Ala333Cysfs)37ACADVLPathogenic/Likely pathogenic1057516843RCV000409885; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771261037126103-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1001T>G (p.Met334Arg)37ACADVLUncertain significance398123079RCV000668860; RCV000077898; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771261087126108-CN517202 not provided;
NM_000018.3(ACADVL):c.1005C>A (p.His335Gln)37ACADVLUncertain significance753624994RCV000311336; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771261127126112-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1009_1011delCTC (p.Leu337del)37ACADVLUncertain significance1315330884RCV000674673; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771261137126116-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1007_1026delTCCTCAACAATGGAAGGTTT (p.Ile336Argfs)37ACADVLPathogenic-1RCV000705209; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771261147126133-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1009C>T (p.Leu337Phe)37ACADVLUncertain significance-1RCV000691839; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771261167126116-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.4(ACADVL):c.1019G>T (p.Gly340Val)37ACADVLConflicting interpretations of pathogenicity934797393RCV000555492; RCV000489813; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771261267126126-CN517202 not provided;
NM_000018.3(ACADVL):c.1037C>T (p.Ala346Val)37ACADVLUncertain significance-1RCV000685409; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771261447126144-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.4(ACADVL):c.1038G>A (p.Ala346=)37ACADVLBenign/Likely benign8064573RCV000020068; RCV000755778; RCV000077899; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN517202; MedGen:CN1693741771261457126145-CN169374 not specified;
NM_000018.3(ACADVL):c.1043_1065dup (p.Ile356Trpfs)37ACADVLLikely pathogenic1555528508RCV000667710; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771261487126148-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1065_1067delCAT (p.Ile356del)37ACADVLUncertain significance754325237RCV000671665; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771261687126171-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1066A>G (p.Ile356Val)37ACADVLConflicting interpretations of pathogenicity150140386RCV000544014; RCV000173615; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN1693741771261737126173-CN169374 not specified;
NM_000018.3(ACADVL):c.1076C>T (p.Ala359Val)37ACADVLUncertain significance539029862RCV000652045; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771261837126183-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1077_1077+1delGGinsCAC37ACADVLPathogenic/Likely pathogenic1057516686RCV000411230; RCV000725401; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771261847126185-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1077G>A (p.Ala359=)37ACADVLUncertain significance779458466RCV000652035; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771261847126184-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1077+1G>T37ACADVLLikely pathogenic140989450RCV000412397; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771261857126185-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1077+1G>A37ACADVLPathogenic/Likely pathogenic140989450RCV000666633; RCV000520772; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771261857126185-CN517202 not provided;
NM_000018.3(ACADVL):c.1077+2T>C37ACADVLLikely pathogenic1057516370RCV000411047; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771261867126186-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1096C>T (p.Arg366Cys)37ACADVLConflicting interpretations of pathogenicity771874163RCV000675110; RCV000185719; RCV000508196; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN517202; MedGen:CN1693741771264707126470UniProtKB (protein):P49748#VAR_000349CN517202 not provided;
NM_000018.4(ACADVL):c.1097G>A (p.Arg366His)37ACADVLPathogenic/Likely pathogenic112406105RCV000411732; RCV000185720; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771264717126471UniProtKB (protein):P49748#VAR_000350CN517202 not provided;
NM_001270448.1(ACADVL):c.875A>C (p.Gln292Pro)37ACADVLConflicting interpretations of pathogenicity776063244RCV000558671; RCV000726785; RCV000507714; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN517202; MedGen:CN1693741771264777126477-CN169374 not specified;
NM_000018.3(ACADVL):c.1106T>C (p.Phe369Ser)37ACADVLLikely pathogenic398123080RCV000173951; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771264807126480-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1113delG (p.Ile373Phefs)37ACADVLLikely pathogenic1057517416RCV000411060; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771264877126487-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_001270448.1(ACADVL):c.899T>C (p.Phe300Ser)37ACADVLUncertain significance758928307RCV000652042; RCV000507850; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771265017126501-CN169374 not specified;
NM_000018.3(ACADVL):c.1141_1143delGAG (p.Glu381del)37ACADVLLikely pathogenic1057517281RCV000409783; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771265157126517-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1144A>C (p.Lys382Gln)37ACADVLPathogenic118204015RCV000001695; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771265187126518OMIM Allelic Variant:609575.0008,UniProtKB (protein):P49748#VAR_000352C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1153C>T (p.Arg385Trp)37ACADVLUncertain significance745832866RCV000668844; RCV000173952; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771265277126527-CN169374 not specified;
NM_000018.2(ACADVL):c.1182+1G>A37ACADVLPathogenic/Likely pathogenic113690956RCV000001689; RCV000210824; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771265577126557OMIM Allelic Variant:609575.0002
NM_000018.3(ACADVL):c.1182+2T>C37ACADVLLikely pathogenic1555528635RCV000667334; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771265587126558-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_001270448.1(ACADVL):c.955-15A>G37ACADVLConflicting interpretations of pathogenicity765390290RCV000668926; RCV000506806; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN1693741771269487126948-CN169374 not specified;
NM_000018.3(ACADVL):c.1183-7A>G37ACADVLUncertain significance-1RCV000687039; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771269567126956-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1183-2dup37ACADVLUncertain significance1555528721RCV000674331; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771269607126960-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1183-1G>A37ACADVLLikely pathogenic1057516818RCV000409279; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771269627126962-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1198G>A (p.Val400Met)37ACADVLUncertain significance149116708RCV000666127; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771269787126978-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1217A>C (p.Gln406Pro)37ACADVLUncertain significance-1RCV000685865; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771269977126997-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1220G>C (p.Gly407Ala)37ACADVLUncertain significance904631654RCV000544920; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771270007127000-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.4(ACADVL):c.1226C>T (p.Thr409Met)37ACADVLUncertain significance113994169RCV000020069; RCV000755779; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771270067127006-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1239A>G (p.Ile413Met)37ACADVLLikely benign143172658RCV000537897; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771270197127019-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1246G>A (p.Ala416Thr)37ACADVLPathogenic118204018RCV000001700; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771270267127026OMIM Allelic Variant:609575.0013C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1246G>T (p.Ala416Ser)37ACADVLUncertain significance118204018RCV000668964; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771270267127026-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1253G>A (p.Ser418Asn)37ACADVLUncertain significance1555528737RCV000548112; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771270337127033-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1268C>T (p.Ser423Leu)37ACADVLUncertain significance-1RCV000706755; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771270487127048-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1269G>A (p.Ser423=)37ACADVLUncertain significance-1RCV000690205; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771270497127049-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1269+1G>A37ACADVLPathogenic773401248RCV000671502; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771270507127050-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1269+10C>T37ACADVLLikely benign1555528738RCV000526383; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771270597127059-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1270-38A>G37ACADVLLikely benign1555528742RCV000666824; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771270947127094-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1273G>A (p.Ala425Thr)37ACADVLConflicting interpretations of pathogenicity138834083RCV000652034; RCV000418569; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771271357127135-CN517202 not provided;
NM_000018.3(ACADVL):c.1280G>A (p.Trp427Ter)37ACADVLLikely pathogenic1057516519RCV000412097; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771271427127142-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1283delA (p.Lys428Argfs)37ACADVLLikely pathogenic1555528745RCV000673169; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771271437127144-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1284G>A (p.Lys428=)37ACADVLLikely benign35501596RCV000020070; RCV000424423; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN1693741771271467127146-CN169374 not specified;
NM_000018.3(ACADVL):c.1291G>C (p.Asp431His)37ACADVLUncertain significance-1RCV000696893; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771271537127153-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1297T>C (p.Cys433Arg)37ACADVLUncertain significance886053374RCV000400488; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771271597127159-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1313G>A (p.Gly438Glu)37ACADVLUncertain significance748450834RCV000551302; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771271757127175-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.4(ACADVL):c.1316G>A (p.Gly439Asp)37ACADVLConflicting interpretations of pathogenicity533055438RCV000703664; RCV000185723; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771271787127178-CN517202 not provided;
NM_000018.3(ACADVL):c.1322G>A (p.Gly441Asp)37ACADVLPathogenic2309689RCV000020072; RCV000077903; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771271847127184HGMD:CM960010,OMIM Allelic Variant:609575.0009,UniProtKB (protein):P49748#VAR_000354CN517202 not provided;
NM_000018.4(ACADVL):c.1328T>G (p.Met443Arg)37ACADVLConflicting interpretations of pathogenicity886043236RCV000673223; RCV000327267; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771271907127190-CN169374 not specified;
NM_000018.3(ACADVL):c.1332+27C>T37ACADVLLikely benign200161683RCV000672031; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771272217127221-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1333-25T>C37ACADVLLikely benign770876053RCV000665325; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771272627127262-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1333-7G>T37ACADVLLikely benign1228196483RCV000539799; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771272807127280-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1333-2A>T37ACADVLLikely pathogenic1057517280RCV000411741; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771272857127285-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1340G>A (p.Gly447Glu)37ACADVLUncertain significance1555528779RCV000554531; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771272947127294-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.4(ACADVL):c.1349G>A (p.Arg450His)37ACADVLPathogenic/Likely pathogenic118204016RCV000001701; RCV000724571; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771273037127303OMIM Allelic Variant:609575.0010,OMIM Allelic Variant:609575.0014,UniProtKB (protein):P49748#VAR_000355C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1355dupT (p.Arg453Profs)37ACADVLLikely pathogenic1057517331RCV000409489; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771273097127309-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1357C>T (p.Arg453Ter)37ACADVLPathogenic/Likely pathogenic794727113RCV000174654; RCV000724448; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771273117127311-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1360G>A (p.Asp454Asn)37ACADVLUncertain significance1419606204RCV000668005; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771273147127314-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1366C>T (p.Arg456Cys)37ACADVLUncertain significance794727111RCV000696055; RCV000174652; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771273207127320-CN169374 not specified;
NM_000018.3(ACADVL):c.1367G>A (p.Arg456His)37ACADVLConflicting interpretations of pathogenicity794727112RCV000410559; RCV000174653; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771273217127321UniProtKB (protein):P49748#VAR_000358CN169374 not specified;
NM_000018.3(ACADVL):c.1372T>C (p.Phe458Leu)37ACADVLPathogenic118204017RCV000001699; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771273267127326OMIM Allelic Variant:609575.0012,UniProtKB (protein):P49748#VAR_010103C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_001270448.1(ACADVL):c.1147C>T (p.Arg383Trp)37ACADVLConflicting interpretations of pathogenicity766742117RCV000652041; RCV000506090; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN1693741771273297127329UniProtKB (protein):P49748#VAR_000359CN169374 not specified;
NM_000018.3(ACADVL):c.1375dup37ACADVLPathogenic796051916RCV000538432; RCV000185739; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771273297127329-CN517202 not provided;
NM_000018.4(ACADVL):c.1376G>A (p.Arg459Gln)37ACADVLPathogenic/Likely pathogenic751995154RCV000414939; RCV000414939; RCV000412089; RCV000185726; NHuman Phenotype Ontology:HP:0003198,MedGen:C0026848; Human Phenotype Ontology:HP:0003201,MedGen:C0035410; MedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771273307127330-CN517202 not provided;
NM_000018.3(ACADVL):c.1376G>C (p.Arg459Pro)37ACADVLUncertain significance751995154RCV000652030; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771273307127330-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1389dupG (p.Thr464Aspfs)37ACADVLPathogenic398123082RCV000174651; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771273437127343-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1391C>T (p.Thr464Ile)37ACADVLUncertain significance1555528796RCV000531461; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771273457127345-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.4(ACADVL):c.1405C>T (p.Arg469Trp)37ACADVLPathogenic/Likely pathogenic113994170RCV000020073; RCV000756952; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771273597127359UniProtKB (protein):P49748#VAR_000362C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1406G>A (p.Arg469Gln)37ACADVLPathogenic/Likely pathogenic398123083RCV000169627; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771273607127360HGMD:CM990103,UniProtKB (protein):P49748#VAR_000361C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1430G>A (p.Cys477Tyr)37ACADVLUncertain significance1555528803RCV000673535; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771273847127384-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1434+2T>G37ACADVLLikely pathogenic1555528804RCV000669283; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771273907127390-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1434+14T>A37ACADVLConflicting interpretations of pathogenicity202217537RCV000174650; RCV000723493; RCV000246029; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN517202; MedGen:CN1693741771274027127402-CN169374 not specified;
NM_000018.3(ACADVL):c.1434+23G>A37ACADVLLikely benign759991740RCV000671883; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771274117127411-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1434+24G>A37ACADVLLikely benign1555528806RCV000670928; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771274127127412-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1434+27G>A37ACADVLLikely benign1271483942RCV000666510; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771274157127415-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1434+38G>C37ACADVLLikely benign763704056RCV000673589; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771274267127426-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1452C>T (p.Leu484=)37ACADVLLikely benign1555528820RCV000546226; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771274827127482-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1468G>C (p.Ala490Pro)37ACADVLConflicting interpretations of pathogenicity759775666RCV000554101; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771274987127498-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1473A>G (p.Leu491=)37ACADVLConflicting interpretations of pathogenicity150518187RCV000362559; RCV000428813; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN1693741771275037127503-CN169374 not specified;
NM_000018.3(ACADVL):c.1496G>C (p.Gly499Ala)37ACADVLUncertain significance-1RCV000693646; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771275267127526-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1504C>G (p.Leu502Val)37ACADVLLikely pathogenic779901247RCV000352142; RCV000723372; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771275347127534-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1532G>A (p.Arg511Gln)37ACADVLConflicting interpretations of pathogenicity200771970RCV000410771; RCV000595069; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771275627127562-CN169374 not specified;
NM_000018.3(ACADVL):c.1532G>C (p.Arg511Pro)37ACADVLUncertain significance200771970RCV000669087; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771275627127562-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1532+2T>C37ACADVLLikely pathogenic111851815RCV000411534; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771275647127564-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1532+7T>C37ACADVLLikely benign534469222RCV000672197; RCV000616319; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN1693741771275697127569-CN169374 not specified;
NM_000018.3(ACADVL):c.1532+7T>A37ACADVLLikely benign534469222RCV000652049; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771275697127569-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1532+10G>A37ACADVLLikely benign775913504RCV000532430; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771275727127572-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1532+11G>A37ACADVLLikely benign372900326RCV000671368; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771275737127573-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1533-4T>A37ACADVLConflicting interpretations of pathogenicity369986567RCV000547159; RCV000604631; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN1693741771276367127636-CN169374 not specified;
NM_000018.3(ACADVL):c.1567G>A (p.Gly523Arg)37ACADVLUncertain significance139425622RCV000272698; RCV000725179; RCV000370922; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN517202; MedGen:CN1693741771276747127674-CN169374 not specified;
NM_000018.3(ACADVL):c.1581G>A (p.Pro527=)37ACADVLConflicting interpretations of pathogenicity149436747RCV000309125; RCV000612544; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN1693741771276887127688-CN169374 not specified;
NM_000018.4(ACADVL):c.1591C>T (p.Arg531Trp)37ACADVLUncertain significance146379816RCV000208321; RCV000652029; RCV000185729; NEFO:EFO_0000407,Human Phenotype Ontology:HP:0001644,MedGen:C0007193, Orphanet:ORPHA217604,SNOMED CT:195021004; MedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771276987127698HGMD:CM118330CN169374 not specified;
NM_000018.3(ACADVL):c.1591_1592insG (p.Ser532Glufs)37ACADVLLikely pathogenic1060499596RCV000477936; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771276997127699-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1600G>A (p.Glu534Lys)37ACADVLConflicting interpretations of pathogenicity2230180RCV000020074; RCV000077907; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN1693741771277077127707HGMD:CM990107,UniProtKB (protein):P49748#VAR_010105CN169374 not specified;
NM_000018.3(ACADVL):c.1605+6T>C37ACADVLBenign17671352RCV000169539; RCV000077908; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN1693741771277187127718-CN169374 not specified;
NM_000018.3(ACADVL):c.1605+22A>G37ACADVLLikely benign1052646012RCV000671483; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771277347127734-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1606-42C>T37ACADVLLikely benign372357967RCV000671541; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771277577127757-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1606-42C>G37ACADVLLikely benign372357967RCV000672032; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771277577127757-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1606-36G>A37ACADVLLikely benign890862631RCV000673252; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771277637127763-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1606-28G>A37ACADVLLikely benign773931227RCV000673503; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771277717127771-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_001270448.1(ACADVL):c.1378-22C>T37ACADVLLikely benign370303265RCV000671330; RCV000506906; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN1693741771277777127777-CN169374 not specified;
NM_000018.3(ACADVL):c.1606-2A>C37ACADVLLikely pathogenic113467582RCV000671155; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771277977127797-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1606-1G>A37ACADVLLikely pathogenic1057517386RCV000411804; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771277987127798-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1613G>A (p.Arg538Gln)37ACADVLUncertain significance201350598RCV000652027; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771278067127806-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1617T>C (p.Ala539=)37ACADVLUncertain significance1555528948RCV000668391; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771278107127810-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1657A>C (p.Lys553Gln)37ACADVLUncertain significance1555528957RCV000545827; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771278507127850-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1678+15C>T37ACADVLLikely benign371402802RCV000671363; RCV000616516; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN1693741771278867127886-CN169374 not specified;
NM_000018.3(ACADVL):c.1678+22C>T37ACADVLLikely benign761650394RCV000671478; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771278937127893-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1678+23C>T37ACADVLConflicting interpretations of pathogenicity147546456RCV000652047; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771278947127894-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1678+24G>A37ACADVLLikely benign751665756RCV000671235; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771278957127895-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1678+27C>A37ACADVLLikely benign759729168RCV000672175; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771278987127898-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1678+39C>G37ACADVLLikely benign377062362RCV000671486; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771279107127910-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1679-34C>T37ACADVLLikely benign779439503RCV000671353; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771279277127927-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1679-5delG37ACADVLUncertain significance1555528999RCV000666022; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771279547127955-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1679-6G>A37ACADVLPathogenic/Likely pathogenic113994171RCV000031857; RCV000185730; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771279557127955-CN517202 not provided;
NM_001270447.1(ACADVL):c.1768C>T (p.Arg590Trp)37ACADVLUncertain significance864321651RCV000203523; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771279817127981-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1714dup (p.Ala572Glyfs)37ACADVLLikely pathogenic1555529004RCV000670489; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771279927127992-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.4(ACADVL):c.1733T>C (p.Met578Thr)37ACADVLUncertain significance375806217RCV000669184; RCV000723595; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771280157128015-CN169374 not specified;
NM_000018.3(ACADVL):c.1748C>G (p.Ser583Trp)37ACADVLConflicting interpretations of pathogenicity1085307648RCV000675075; RCV000489971; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771280307128030-CN517202 not provided;
NM_000018.3(ACADVL):c.1748C>T (p.Ser583Leu)37ACADVLLikely pathogenic1085307648RCV000665031; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771280307128030-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.4(ACADVL):c.1751+1G>A37ACADVLLikely pathogenic-1RCV000761524; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771280347128034-
NM_000018.3(ACADVL):c.1751+18G>A37ACADVLLikely benign528002997RCV000671356; RCV000432937; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN1693741771280517128051-CN169374 not specified;
NM_000018.3(ACADVL):c.1751+30C>T37ACADVLLikely benign757837505RCV000671352; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771280637128063-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1751+46C>G37ACADVLLikely benign375203448RCV000671348; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771280797128079-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1752-36G>A37ACADVLLikely benign200709964RCV000671364; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771280927128092-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1752-32_1752-31delCA37ACADVLLikely benign758750087RCV000671570; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771280957128097-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1752-33C>T37ACADVLLikely benign760851448RCV000671481; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771280957128095-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1752-23T>C37ACADVLLikely benign368009800RCV000671666; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771281057128105-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1752-2delA37ACADVLLikely pathogenic1555529044RCV000652039; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771281267128126-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1754C>T (p.Ala585Val)37ACADVLUncertain significance374729641RCV000264459; RCV000383480; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771281307128130-CN169374 not specified;
NM_000018.3(ACADVL):c.1765delC (p.Leu589Terfs)37ACADVLLikely pathogenic1057516226RCV000411935; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771281417128141-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1770_1773delTGAG (p.Ser590Argfs)37ACADVLLikely pathogenic1555529048RCV000673234; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771281417128145-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1766T>C (p.Leu589Pro)37ACADVLUncertain significance-1RCV000701465; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771281427128142-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1806_1807delCT (p.Cys603Terfs)37ACADVLPathogenic/Likely pathogenic796051917RCV000666299; RCV000185740; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771281827128183-CN517202 not provided;
NM_000018.3(ACADVL):c.1820G>C (p.Cys607Ser)37ACADVLUncertain significance200117742RCV000534253; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771281967128196-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1824C>T (p.Ile608=)37ACADVLConflicting interpretations of pathogenicity146115467RCV000324256; RCV000604568; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN1693741771282007128200-CN169374 not specified;
NM_000018.3(ACADVL):c.1825G>A (p.Glu609Lys)37ACADVLUncertain significance398123086RCV000670696; RCV000185732; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771282017128201-CN169374 not specified;
NM_000018.3(ACADVL):c.1828-4C>G37ACADVLConflicting interpretations of pathogenicity184559206RCV000549028; RCV000251264; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN1693741771282727128272-CN169374 not specified;
NM_000018.3(ACADVL):c.1835C>G (p.Ala612Gly)37ACADVLUncertain significance374898424RCV000527141; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771282837128283-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1837C>T (p.Arg613Trp)37ACADVLPathogenic/Likely pathogenic118204014RCV000001690; RCV000185733; RCV000507731; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN517202; MedGen:CN1693741771282857128285OMIM Allelic Variant:609575.0003,UniProtKB (protein):P49748#VAR_000365CN517202 not provided;
NM_000018.3(ACADVL):c.1839G>A (p.Arg613=)37ACADVLConflicting interpretations of pathogenicity79125791RCV000360248; RCV000243077; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN1693741771282877128287-CN169374 not specified;
NM_000018.3(ACADVL):c.1843C>T (p.Arg615Ter)37ACADVLPathogenic1057520507RCV000537328; RCV000438504; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771282917128291-CN517202 not provided;
NM_000018.3(ACADVL):c.1844G>A (p.Arg615Gln)37ACADVLConflicting interpretations of pathogenicity148584617RCV000193309; RCV000176020; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771282927128292UniProtKB (protein):P49748#VAR_010106CN517202 not provided;
NM_000018.3(ACADVL):c.1864C>T (p.Gln622Ter)37ACADVLUncertain significance1555529172RCV000665971; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771283127128312-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.4(ACADVL):c.1878G>A (p.Trp626Ter)37ACADVLUncertain significance1555529186RCV000652044; RCV000755774; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771283267128326-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1894C>T (p.Arg632Cys)37ACADVLUncertain significance151254520RCV000525816; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771283427128342-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1908dup (p.Ile637Hisfs)37ACADVLLikely pathogenic1555529204RCV000673345; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771283557128355-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1923G>C (p.Leu641Phe)37ACADVLUncertain significance1452402269RCV000668695; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771283717128371-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1929G>C (p.Glu643Asp)37ACADVLUncertain significance1208010882RCV000652032; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771283777128377-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1932G>A (p.Arg644=)37ACADVLUncertain significance886053375RCV000260747; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771283807128380-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.1965C>T (p.Phe655=)37ACADVLBenign9674RCV000020077; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771284137128413-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.*8delC37ACADVLUncertain significance398123078RCV000316014; RCV000077897; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:237997005; MedGen:CN5172021771284247128424-CN169374 not specified;
NM_000018.3(ACADVL):c.*32T>G37ACADVLUncertain significance886053376RCV000375152; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771284487128448-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
NM_000018.3(ACADVL):c.*53C>T37ACADVLUncertain significance535274747RCV000280760; NMedGen:C3887523,OMIM:201475, Orphanet:ORPHA26793,SNOMED CT:237996001,SNOMED CT:2379970051771284697128469-C3887523 201475 Very long chain acyl-CoA dehydrogenase deficiency;
MSeqDR Portal
Ensembl Gene IDAssociated Gene NameLSDB GenesLSDB VariantsclinVar hitsDescriptionDisease id
ENSG00000072778 MSeqDR Search EnsemblACADVL121319acyl-CoA dehydrogenase, very long chain [Source:HGNC Symbol;Acc:92]00436

*Click on gene and variants to check details. Or view all variants in new page