MSeqDR Mitochondrial Disease Portal


 
*:HP: HPO terms, UMDF: 1= Disease, ND: NAMDC terms.
  Most Studied  CPEO, Complex I Deficiency, COXPD1, Leigh, LHON, MELAS, MERRF, Myopathy, SANDO
Disease Browser
Parent Node:
expand
Spinocerebellar Ataxias (D020754)
..Starting node
..expand
Machado-Joseph Disease (D017827)

       Child Nodes:
........expandSpinocerebellar ataxia, X-linked, 3 (C537315)



 Sister Nodes: 
..expandAnemia, sideroblastic spinocerebellar ataxia (C536358)
..expandAtaxia Telangiectasia (D001260) Child6
..expandChorioretinal Dystrophy, Spinocerebellar Ataxia, and Hypogonadotropic Hypogonadism (C565850)
..expandGemignani syndrome (C537678)
..expandMachado-Joseph Disease (D017827) Child1
..expandMITOCHONDRIAL DNA DEPLETION SYNDROME 7 (HEPATOCEREBRAL TYPE) (OMIM:271245)  LSDB  L: 00036;
..expandSpastic Ataxia (C564815)
..expandSpastic ataxia Charlevoix-Saguenay type (C536787)
..expandSpinocerebellar Ataxia 10 (C566874)
..expandSpinocerebellar Ataxia 11 (C565772)
..expandSpinocerebellar Ataxia 12 (C565790)
..expandSpinocerebellar ataxia 13 (C537195)
..expandSpinocerebellar ataxia 14 (C537196)
..expandSpinocerebellar Ataxia 15 (C564685)
..expandSpinocerebellar Ataxia 17 (C564616)
..expandSpinocerebellar ataxia 20 (C537199)
..expandSpinocerebellar ataxia 25 (C537202)
..expandSpinocerebellar ataxia 26 (C537203)
..expandSpinocerebellar ataxia 28 (C537205)  LSDB  L: 00498;
..expandSpinocerebellar ataxia 30 (C575214)
..expandSpinocerebellar Ataxia 31 (C566146)
..expandSpinocerebellar Ataxia And Plaque-Like Deposits (C566671)
..expandSpinocerebellar Ataxia with Dysmorphism (C564802)
..expandSpinocerebellar Ataxia with Epilepsy (C564395)
..expandSpinocerebellar Ataxia With Rigidity And Peripheral Neuropathy (C566669)
..expandSpinocerebellar ataxia, autosomal recessive 1 (C537308)
..expandSpinocerebellar Ataxia, Autosomal Recessive 7 (C563753)
..expandSpinocerebellar Ataxia, Autosomal Recessive 8 (C565188)
..expandSpinocerebellar Ataxia, Autosomal Recessive 9 (C567436)
..expandSpinocerebellar Ataxia, X-Linked 1 (C563134)
..expandSpinocerebellar Ataxia, X-Linked 5 (C567478)
   

Human Disease MESH is developed by UMLS.
Further data from MedGen, OMIM,ClinVar, CTD
Term ID:7285
Name:Machado-Joseph Disease
Definition:A dominantly-inherited ATAXIA first described in people of Azorean and Portuguese descent, and subsequently identified in Brazil, Japan, China, and Australia. This disorder is classified as one of the SPINOCEREBELLAR ATAXIAS (Type 3) and has been associated with a mutation of the MJD1 gene on chromosome 14. Clinical features include progressive ataxia, DYSARTHRIA, postural instability, nystagmus, eyelid retraction, and facial FASCICULATIONS. DYSTONIA is prominent in younger patients (referred to as Type I Machado-Joseph Disease). Type II features ataxia and ocular signs; Type III features MUSCULAR ATROPHY and a sensorimotor neuropathy; and Type IV features extrapyramidal signs combined with a sensorimotor neuropathy. (From Clin Neurosci 1995;3(1):17-22; Ann Neurol 1998 Mar;43(3):288-96)
Alternative IDs:DO:DOID:1440|OMIM:109150
ParentIDs:MESH:D020754
TreeNumbers:C10.228.140.252.190.530.530 |C10.228.140.252.700.700.500 |C10.228.854.787.875.500 |C10.574.500.825.700.500 |C10.597.350.090.500.530.530 |C16.320.400.780.875.500
Synonyms:3s, Spinocerebellar Ataxia |Ataxia 3, Spinocerebellar |Ataxia 3s, Spinocerebellar |Atrophy III, Spinocerebellar |Atrophy IIIs, Spinocerebellar |Autosomal Dominant Striatonigral Degeneration |Azorean Ataxia |Azorean Disease |Azorean Disease (Machado Joseph) |Azore
Slim Mappings:Genetic disease (inborn)|Nervous system disease
Reference: MedGen: D017827
MeSH: D017827
OMIM: 109150;
MSeqDR LSDB:  
Genes: ATXN3;
Phenotypes
1 HP:0000006Autosomal dominant inheritance
2 HP:0002459DysautonomiaHP:0040283
3 HP:0030454Abnormal electrooculogram
4 HP:0003438Absent Achilles reflex
5 HP:0001251AtaxiaHP:0040284
6 HP:0003487Babinski sign
7 HP:0002067Bradykinesia
8 HP:0001272Cerebellar atrophy
9 HP:0012532Chronic pain
10 HP:0000726Dementia
NAMDC:  Dementia
11 HP:0002198Dilated fourth ventricle
12 HP:0000651Diplopia
13 HP:0003693Distal amyotrophy
14 HP:0001260Dysarthria
NAMDC:  Dysarthria
HP:0040284
15 HP:0000641Dysmetric saccades
16 HP:0002015Dysphagia
NAMDC:  Dysphagia
17 HP:0001332Dystonia
NAMDC:  Dystonia
HP:0040284
18 HP:0000544External ophthalmoplegiaHP:0040284
19 HP:0007089Facial-lingual fasciculations
20 HP:0002380FasciculationsHP:0040284
21 HP:0000640Gaze-evoked nystagmusHP:0040284
22 HP:0003743Genetic anticipation
23 HP:0002171Gliosis
24 HP:0001151Impaired horizontal smooth pursuit
25 HP:0002495Impaired vibratory sensation
26 HP:0002070Limb ataxia
27 HP:0003394Muscle cramps
28 HP:0001300Parkinsonism
NAMDC:  Parkinsonism
HP:0040284
29 HP:0002172Postural instability
30 HP:0003676Progressive
31 HP:0002073Progressive cerebellar ataxia
NAMDC:  Ataxia cerebellar
32 HP:0000520Proptosis
33 HP:0000508Ptosis
NAMDC:  Ptosis
34 HP:0002063Rigidity
35 HP:0001257Spasticity
NAMDC:  Spasticity
HP:0040284
36 HP:0002503Spinocerebellar tract degeneration
37 HP:0000623Supranuclear ophthalmoplegia
38 HP:0002078Truncal ataxia
39 HP:0002839Urinary bladder sphincter dysfunction
Disease Causing ClinVar Variants
Variation_NameGeneIDGeneSymbolClinicalSignificancedbSNPRCVaccessionTestedInGTRPhenotypeIDsChromosomeStartStopHGVS_cHGVS_pHGVS_gOtherIDsDisease_ClinVar
NM_004993.6(ATXN3):c.916G>C (p.Gly306Arg)4287ATXN3Benign/Likely benignrs12895357RCV000116485|RCV000191937; NMedGen:CN169374|MONDO:MONDO:0007182,MedGen:C0024408,OMIM:109150, Orphanet:98757149253735492537354CG14:g.92537354C>GClinGen:CA152015C0024408 109150 Azorean disease;
NM_004993.6(ATXN3):c.892CAG[12] (p.Gln302_Gln305dup)4287ATXN3Benignrs193922928RCV001198814; NMONDO:MONDO:0007182,MedGen:C0024408,OMIM:109150, Orphanet:98757149253735492537355CCCTGCTGCTGCTG14:g.92537354_92537355insCTGCTGCTGCTG-
NM_004993.6(ATXN3):c.892CAG[11] (p.Gln303_Gln305dup)4287ATXN3Uncertain significance-1RCV001768440; NMONDO:MONDO:0007182,MedGen:C0024408,OMIM:109150, Orphanet:98757149253735492537355CCCTGCTGCTG92537354-
NM_004993.5(ATXN3):c.892CAG[(8_36)]4287ATXN3Pathogenic; risk factor-1RCV000003729|RCV000003730; NMONDO:MONDO:0007182,MedGen:C0024408,OMIM:109150, Orphanet:98757|MONDO:MONDO:0008199,MedGen:C3160718,OMIM:168600, Orphanet:411602149253735592537357CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGOMIM:607047.0001C0024408 109150 Azorean disease;
NM_004993.5(ATXN3):c.886_888CAG(12_44) (p.Gln305_Gly306insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)4287ATXN3Benign-1RCV000191938; NMONDO:MONDO:0007182,MedGen:C0024408,OMIM:109150, Orphanet:98757149253738292537384TTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC-C0024408 109150 Azorean disease;
NM_004993.5(ATXN3):c.886_888CAG(60_86) (p.Gln305_Gly306insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln4287ATXN3Pathogenic-1RCV000191939; NMONDO:MONDO:0007182,MedGen:C0024408,OMIM:109150, Orphanet:98757149253738292537384TTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT-C0024408 109150 Azorean disease;
MSeqDR Portal